Camellia japonica endophytic bacteria, bacterial agent and anti-influenza a virus application thereof

Abstract

The application provides a camellia plant endophytic bacteria, a bacterial agent thereof and an anti-influenza virus A application; the camellia plant endophytic bacteria is Bacillus thuringiensis, which is preserved in the China General Microbiological Culture Collection Center with a preservation number of CGMCC No.32945. The fermentation product of the strain shows good antiviral activity in in vitro and in vivo experiments, can effectively inhibit the replication of influenza virus, and protect infected mice from lethal influenza virus; also shows the effect of regulating immune response, enhances the secretion of IFN-gamma by down-regulating the secretion of pro-inflammatory factors such as IL-6 and IL-10, thereby improving the immune resistance of the body.

Description

Field of Invention:

[0001] This application belongs to the field of microbiology. Specifically, this application provides an endophytic bacterium of Camellia chrysantha plant, its inoculant, and its application against influenza A virus. Background technology:

[0002] Influenza virus (IV) is one of the leading pathogens causing acute respiratory infections, especially during seasonal influenza and global pandemics, where its spread can lead to high morbidity and mortality rates. Influenza viruses belong to the Orthomyxoviridae family and are characterized by a single-stranded negative-sense RNA genome. Influenza viruses are mainly classified into three types: A, B, and C. Type A influenza virus has become a research focus due to its wide host range, high variability, and cross-species transmission. Type A influenza virus can rapidly mutate through antigenic drift and antigenic switching, causing its antigenicity to constantly change, posing a significant challenge to prevention and control efforts. The variability of influenza viruses necessitates continuous adjustments and updates to the vaccines and antiviral drugs required each year.

[0003] Endophytes are microorganisms that exist within plants and typically exert certain physiological effects on the host plant. The isolation and identification of endophytes is an important research task in microbiology and plant pathology, with the main aim of screening strains with potential biological activity. Due to their unique biological activities, plant endophytes have become a potential source for the development of antiviral drugs, and several compounds that inhibit viruses have already been isolated from various plant endophytes.

[0004] Golden camellia (Camellia nitidissima), belonging to the Theaceae family, is a plant endemic to Guangxi, China, and northern Vietnam, and is known as the "giant panda of the plant kingdom" due to its rarity. Golden camellia contains various bioactive chemical components, such as flavonoids, volatile oils, saponins, and various trace elements. These components endow it with pharmacological effects including antitumor, antioxidant, immunomodulatory, anti-inflammatory, hypoglycemic, and hypolipidemic properties. Research shows that golden camellia is not only a valuable traditional Chinese medicine resource but also a natural drug source with great potential, especially in the field of antiviral applications. By isolating endophytic bacteria from the leaf tissue of golden camellia, microorganisms and active substances with anti-influenza virus properties were discovered, providing new insights for the future development of antiviral drugs. Summary of the Invention

[0005] Endophytic bacteria were isolated and purified from Camellia chrysantha, and a strain YE10 with significant anti-influenza virus activity was screened. Its potential against H1N1 and H9N2 subtype influenza viruses was demonstrated at the cellular level and in animal models using its fermentation broth supernatant. This strain was identified as Bacillus thuringiensis by biochemical identification and 16S rDNA sequencing. Experiments showed that the fermentation products of strain YE10 exhibited good antiviral activity both in vitro and in vivo, effectively inhibiting influenza virus replication and protecting infected mice from lethal influenza virus damage. Furthermore, the fermentation broth supernatant also showed a modulating effect on the immune response, downregulating the secretion of pro-inflammatory factors such as IL-6 and IL-10 and enhancing the secretion of IFN-γ, thereby improving the body's immune resistance.

[0006] On the one hand, this application provides an endophytic bacterium for the Camellia chrysantha plant, which is Bacillus thuringiensis, deposited at the China General Microbiological Culture Collection Center with accession number CGMCC No. 32945.

[0007] On the other hand, this application provides a microbial agent containing the aforementioned endophytic bacteria of the Camellia chrysantha plant.

[0008] The above-mentioned microbial agents can be in liquid or solid form, and in addition to the endophytic bacteria of the Camellia chrysantha plant, they may also contain carriers, freeze-drying protectants, culture media, and other components.

[0009] On the other hand, this application provides a fermentation product, which is the supernatant of the fermentation broth of the above-mentioned Camellia chrysantha plant endophytic bacteria.

[0010] Furthermore, the fermentation product is prepared by the following method: culturing the above-mentioned endophytic bacterial strain of Camellia chrysantha plant in liquid culture medium for 12-36 hours, collecting the fermentation broth and taking the supernatant.

[0011] Furthermore, the liquid culture medium is LB medium, and the above-mentioned endophytic bacterial strain of Camellia chrysantha is cultured for 24 hours at a culture temperature of 37°C.

[0012] In addition to LB medium, other liquid culture media known in the art for culturing Bacillus thuringiensis may also be used. The optimal culture time for obtaining the highest bacterial concentration may vary depending on the culture medium and culture conditions used.

[0013] On the other hand, this application provides the use of the above-mentioned endophytic bacteria, inoculants or ferments of Camellia chrysantha in the preparation of drugs that inhibit influenza A virus.

[0014] Furthermore, the influenza virus is either H1N1 or H9N2 influenza virus.

[0015] On the other hand, this application provides the use of the above-mentioned endophytic bacteria, inoculants or ferments of Camellia chrysantha in the preparation of drugs or health products that enhance immunity.

[0016] On the other hand, this application provides a drug for inhibiting influenza A virus, the drug comprising the aforementioned endophytic bacteria, inoculants, or ferments of the Camellia chrysantha plant.

[0017] Furthermore, the drug is an oral drug, an injectable drug, or a topical drug.

[0018] Furthermore, the drug also contains a pharmaceutically acceptable carrier.

[0019] Beneficial effects:

[0020] (1) No toxicity and no side effects: Compared with traditional anti-influenza drugs (such as amantadine and oseltamivir), the YE10 strain and its fermentation products have shown lower toxicity and side effects, better biosafety, and are suitable for a wider range of patients.

[0021] (2) Low price and easy access to resources: Bacillus thuringiensis has low requirements for culture conditions and culture media, so its fermentation products have a potential low cost advantage, which can be used for large-scale production and meet public health needs, especially during influenza outbreaks.

[0022] (3) Enhanced immune function: The YE10 strain enhances the host’s immune response by regulating pro-inflammatory factors (such as IL-6 and TNF-α) and anti-inflammatory factors (such as IL-10) in mice and upregulating the secretion of antiviral factors (such as IFN-γ), and has a dual antiviral mechanism: directly inhibiting viral replication and enhancing the host’s immune defense.

[0023] (4) Solution to drug resistance problem: Compared with traditional antiviral drugs, endophytic bacteria have more diverse mechanisms of action, which may avoid the problem of viruses developing resistance to existing drugs (such as oseltamivir). In particular, YE10 still shows a significant inhibitory effect on virus strains such as H9N2 influenza virus that have developed resistance to certain drugs.

[0024] (5) Efficacy in cell and animal models: This study not only demonstrated the efficacy of YE10 at the cellular level, but also showed its strong protective effect against influenza viruses in mouse models, especially against highly lethal H1N1 virus and oseltamivir-resistant H9N2 virus. Attached Figure Description

[0025] Figure 1The changes in average body weight of mice (H1N1 efficacy test) are shown in the following groups: C - blank group; D - YE10 toxicity group; H - H1 exposure group; B - H1 Tamiflu group; G - H1 drug administration group.

[0026] Figure 2 The changes in average body weight of mice (H9N2 efficacy test) are shown in the following groups: C - blank group; D - YE10 toxicity group; E - H9 exposure group; F - H9 Tamiflu group; A - H9 drug administration group.

[0027] Figure 3 TCID virus in 3-day mouse tissue 50 Cases: C - Blank group; D - YE10 toxicity group; H - H1 exposure group; B - H1 Tamiflu group; G - H1 drug administration group;

[0028] Figure 4 TCID virus in mouse tissue 5 days later 50 In the following cases: C - blank group; D - YE10 toxicity group; H - H1 exposure group; B - H1 Tamiflu group; G - H1 drug administration group;

[0029] Figure 5 The results of viral load testing in lung tissue are categorized as follows: C - Blank group; D - YE10 virulence group; H - H1 infection group; B - H1 Tamiflu group; G - H1 medication group.

[0030] Figure 6 The results of serum cytokine assays in mice are as follows: C - blank group; D - YE10 toxicity group; H - H1 exposure group; B - H1 Tamiflu group; G - H1 drug treatment group; H9 exposure group; F - H9 Tamiflu group; A - H9 drug treatment group.

[0031] Figure 7 Lung tissue sections of mice were collected on day 3. C - blank group; D - YE10 toxicity group; H - H1 inoculation group; B - H1 Tamiflu group; G - H1 drug treatment group; E - H9 inoculation group; F - H9 Tamiflu group; A - H9 drug treatment group.

[0032] Figure 8 Lung tissue sections of mice were collected on day 5. C - blank group; D - YE10 toxicity group; H - H1 inoculation group; B - H1 Tamiflu group; G - H1 drug treatment group; E - H9 inoculation group; F - H9 Tamiflu group; A - H9 drug treatment group. Detailed Implementation

[0033] Example 1: Isolation, purification, and identification of endophytic bacteria from Camellia chrysantha.

[0034] Plant cleaning and disinfection:

[0035] Clean the fresh golden chrysanthemum tea leaves to remove impurities, and wipe the surface dry with sterile filter paper. Soak all parts of the plant in 75% ethanol, then treat with hydrogen peroxide, and finally rinse thoroughly with sterile water.

[0036] Isolation of plant endophytic bacteria:

[0037] Endophytic bacteria were isolated using a tissue isolation method: Sterilized plant parts were dissected in a laminar flow hood using autoclaved scissors, and surface moisture was removed. The dissected plant tissues were inoculated into beef extract peptone medium using sterile forceps and labeled. Three replicates were set for each tissue type. The inoculated plates were placed in a 28°C incubator and colony growth was observed.

[0038] Purification of the strain was performed using the streak plating method: Hyphae or colonies were carefully sampled from the cut edge of plant tissue using a sterile inoculation loop and transferred to a new plate for streak purification. After new colonies grew on the plate, the streak plating process was repeated at least three times.

[0039] Strain screening:

[0040] MDCK cells with good growth status (3-9 generations) and a monolayer cell density of about 80% were digested with trypsin and diluted with complete culture medium. Then, 100 μl / well was added to a 96-well cell culture plate, shaken up and down and incubated overnight at 37°C.

[0041] The experiment was divided into four groups: a blank control group, a virus-inoculated control group, a fermentation supernatant-treated group, a Tamiflu-treated group (initial Tamiflu concentration of 200 μg / ml), and a non-fermented medium control group. The fermentation supernatant of the cultured endophytic bacteria, the non-fermented medium, and Tamiflu were all serially diluted 2-fold from their original concentrations, resulting in four concentration gradients: 1 / 2, 1 / 4, 1 / 8, and 1 / 16, to achieve a reasonable distribution of high, medium, and low drug concentrations. The virus inoculation concentration was 100 TCID50. 50 .

[0042] Use 100TCID 50 Viral concentration was used for in vitro antiviral assays of the drug. Cells that had grown into a monolayer in 96-well plates were aspirated from the culture medium and discarded. The cells were washed twice with DMEM and 100 mg / L TCID₂ was added. 50Virus solution of 100 μL per well was prepared at the specified concentration. H1N1 influenza virus was adsorbed for 1 hour, and H9N2 influenza virus for 2 hours. The plate was shaken every 15 minutes, then the virus solution was discarded, and the plate was washed three times with DMEM. Finally, the diluted drug was added, and each well was serially diluted 2-fold to four concentrations using the prepared supernatant. Six replicates were set up, along with virus control and blank control wells. The 96-well plate was then placed in a cell culture incubator for further incubation. Observations were made every 8 hours after drug administration to observe cytopathic effect (CPE) and, combined with HA assays, to screen for endophytic fermentation supernatants with antiviral activity. Positive results were verified by repeat experiments, and real-time PCR was performed to detect the virus content in each group to evaluate antiviral activity.

[0043] Plant endophytic bacteria culture, biochemical and molecular identification:

[0044] The purified YE10 strain was inoculated into LB liquid medium and cultured on a 37°C constant temperature shaker for 24 hours to obtain a large number of strains for subsequent strain sequencing.

[0045] The bacterial strain was centrifuged at 5000 rpm and 4℃ for 10 minutes. The bacterial cells in the YE10 fermentation broth were collected, and DNA was extracted and amplified into 16S rDNA before being sent to BGI Genomics for sequencing.

[0046] ATCTTTTATCCCAGTTGAAGAGGATGGAAAAGAAATTGTAGAAGTAAAACAATCAGGAAGTATTGTTTT

[0047] ACAGGCTAAATATTTTAGTGAAATTGTAAAAAAATTGCCGAAAGAAACTGTAGAAATTTCTGTCGAAAA

[0048] TCATTTAATGACAAAAATAACTTCTGGGAAATCAGAATTTAATTTAAATGGTTTAGATTCTGCAGAATA

[0049] TCCATTGTTACCACAAATTGAAGAACATCATGTTTTTAAGATTCCAACAGATTTACTAAACATATGAT

[0050] CAGACAAACTGTATTTGCAGTCTCCACTTCTGAAACAAGACCAATCTTGACAGGTGTAAACTGGAAGGT

[0051] ATATAACAGCGAACTAACTTGTATTGCTACAGATAGTCACAGGTTAGCTCTTCGAAAAGCAAAAATTGA

[0052] AGGTATTGCAGATGAATTCCAGGCAAATGTTGTTATTCCGGGGAAAAGCTTAAATGAATTAAGCAAAAT

[0053] TCTAGATGAGTTCTGAAGAAATGGTAGATATCGTTATTACGGAGTATCAAGTATTATTCCGTACAAAACA

[0054] TTTATTATTCTTCTCAAGATTGTTAGAAGGAAATTATCCTGATACAACTCGATTAATTCCTGCAGAGAG

[0055] TAAAACAGATATTTTTGTAAATACAAAAGAATTTTTACAAGCAATTGATCGTGCATCCCTATTAGCAAG

[0056] AGAGGTCGTAATAATGTTGTAAAATTATCAACTTTAGAGCAGGCAATGCTAGAAATTTTCTTCAAATTC

[0057] ACCAGAAATCGGGAAAGTAGTAGAAGAAGTTCAATGTGAAAAAGTAGATGGAGAAGTTAAAAATATC

[0058] TTTTAGTGCAAAATATATGATGGATGCACTAAAGGCATTAGATAGTACTGAGATTAAGATTAGCTTTAC

[0059] TGGAGCAATGAGACCATTCTTAATTCGTACGGTAAATGATGAATCCATTATTCAATTAATTTTACCGGT

[0060] TCGTACTTACTAAGTAAGAAATAAGGGTTGCTAGTTTTCAGATGCTAGTAGCCCTTATTTGATTTTTGG

[0061] GTATTACTTTCCTAATGCTAGTTTATTTAGTACAATGAAAGAATGAACACTTTCAGAAAGTGAGCGATTTTATGAAACGTATTAAAATTTCAACAGAGTATATTACACT (SEQ ID NO. 1).

[0062] The assembled sequence was compared with the 16S rRNA gene sequence using BLAST on the NCBI website. Based on the BLAST results, strain YE10 is likely either Bacillus cereus or Bacillus thuringiensis.

[0063] Biochemical identification of strain YE10 was performed using Bacillus thuringiensis biochemical identification strips and lysozyme biochemical tubes from Haibo Biotechnology. The results showed that strain YE10 was positive in the VP reaction, could not utilize citrate and propionate, and could not ferment sugars to produce acid. It could hydrolyze gelatin and starch, and reduce nitrates. It could grow in pH 5.7, 7% NaCl, and with lysozyme. Further staining with protein toxin crystals revealed typical square crystals characteristic of Bacillus thuringiensis, thus confirming YE10 as Bacillus thuringiensis.

[0064] Strain preservation:

[0065] Bacillus thuringiensis strain YE10, exhibiting good anti-influenza virus activity, was screened and obtained. This strain was deposited on December 6, 2024, at the China General Microbiological Culture Collection Center (No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 32945.

[0066] Example 2: In vitro efficacy of YE10 fermentation broth

[0067] Preparation of fermentation broth supernatant:

[0068] YE10 strain was cultured in LB liquid medium for 24 hours (37℃, 180rpm constant temperature shaker culture), the fermentation broth was collected, the supernatant was obtained after high-speed centrifugation, and the supernatant was obtained by filtration through a 0.22μm filter membrane.

[0069] The effect of fermentation broth on influenza virus:

[0070] Three 9-day-old SPF chicken embryos were inoculated with H1N1 and H9N2 influenza virus strains for propagation and rejuvenation, 0.2 mL / embryo. The embryos were incubated in a constant temperature incubator, and the survival of the embryos was checked at 24-hour intervals. Allantoic fluid from chicken embryos that did not survive 24-72 hours after a positive hemagglutination test was used to inoculate 9-day-old SPF chicken embryos. This process was repeated for three generations. The allantoic fluid from chicken embryos with the highest hemagglutination titer and stable passage was used as the strain for rejuvenation.

[0071] MDCK cells need to be passaged 3-9 times and are in good condition for cell experiments. MDCK cells with a monolayer density of approximately 80% are trypsinized and diluted with complete culture medium, then seeded into 6-well plates at 2 ml per well and cultured in a 37°C cell culture incubator.

[0072] The influenza virus allantoic fluid obtained from the above-prepared inoculation solution was serially diluted 10-fold on an ice box. Each time, 200 μl was added to 1.8 ml of inoculation solution, diluted to obtain 10... -3 -10 -6 Concentration gradient virus solution.

[0073] 1 ml of diluted virus solution was inoculated into each well of a 6-well plate washed with Hank's solution, with a monolayer cell density of approximately 80%. Three replicates were set up for each concentration gradient. An equal volume of virus-inoculating solution was used as a control. Unfermented medium was used as a control group. The fermentation supernatant of cultured endophytic bacteria, unfermented medium, and Tamiflu (initial concentration 200 μg / ml) were all serially diluted 2-fold from their original concentrations, resulting in four concentration gradients: 1 / 2, 1 / 4, 1 / 8, and 1 / 16, to achieve a reasonable distribution of high, medium, and low drug concentrations.

[0074] The cells were incubated in a cell culture incubator for 1 hour, with the 6-well plate gently shaken every 15 minutes to increase the interaction between virus particles and cells. The virus solution was then aspirated, and 2 ml of virus maintenance medium was added per well. Cell culture was continued. Cell morphology (CPE) was observed every 8 hours. When obvious CPE lesions (e.g., cell elongation, deformation, or even breakage) appeared in a well, the supernatant was aspirated for a hemagglutination assay to determine the viral titer. The inoculation was repeated three times. The highest dilution, highest hemagglutination titer, and most stably passaged cytotoxic virus was aliquoted into 1.5 ml EP tubes and stored at -80°C for later use.

[0075] The experimental results are shown in Tables 1 and 2. The results indicate that the YE10 fermentation broth has good anti-H1N1 and H9N2 influenza virus activity.

[0076] With increasing dilution of the fermentation broth, the inhibitory effect of YE10 on H1N1 influenza virus weakened, and its antiviral activity became concentration-dependent. At a 4-fold dilution, it completely inhibited the virus, and most MDCK cells did not develop severe lesions. Even at a 16-fold dilution, low concentrations still showed inhibitory effects, with the viral titer decreasing 6-fold compared to the control group, and cell damage lessened. Against H9N2 influenza virus, the antiviral effect of the YE10 fermentation broth also showed a concentration-dependent effect. At a 16-fold dilution, YE10 still completely inhibited the virus, while the Tamiflu control group failed to completely inhibit the H9N2 virus at different concentrations.

[0077] Table 1. Results of H1N1 hemagglutination assay (HA)

[0078]

[0079]

[0080] Table 2. Results of H9N2 hemagglutination assay (HA)

[0081]

[0082] Example 3: YE10 fermentation broth for treating mice infected with H1N1 and H9N2

[0083] Dosage regimen:

[0084] Six-week-old female BALB / c mice were randomly divided into eight groups, with 12 mice in each group. The groups included: blank control group, YE10 toxicity group, H1 virus-inoculated group, H1 Tamiflu group, H1 drug-treated group, H9 virus-inoculated group, H9 Tamiflu group, and H9 drug-treated group. The inoculation doses of H1N1 and H9N2 influenza viruses were 10 LDs each. 50 and 10 6 TCID 50 / 50μl. The blank group and the virus-treated group were administered unfermented culture medium by gavage, while the treatment group and the toxicity group were administered YE10 fermentation broth supernatant by gavage.

[0085] The administration time was set at 12 hours after infection. The dosage was calculated based on 0.3 ml / 10 g (Tamiflu was 44 mg / kg) administered via gavage. Gavage was then performed every 24 hours thereafter. BALB / c mice in each group were weighed before each administration, and their symptoms and weight changes were observed and recorded. The administration period lasted seven days, and observation and recording were conducted for 21 days. Infection was recorded as day 0. The control group and the infected group were administered unfermented culture medium via gavage, while the treatment group and the toxicity group were administered E10 fermentation supernatant via gavage.

[0086] Clinical observation results:

[0087] Clinical symptoms of mice in each group were recorded and observed daily for 14 consecutive days (as shown in Table 3). Mice in the blank control group and the YE10 toxicity group showed normal clinical indicators, good mental state, and normal appetite. Mice in the H1 toxicity group exhibited chills and loss of appetite within 24 hours of toxicity, followed by worsening symptoms and weight loss. Compared to the H1 toxicity group, the H1 Tamiflu group and the H1 drug treatment group showed milder symptoms. Mice in the YE10 fermentation broth treatment group gradually recovered after toxicity. The H9 toxicity group and the H9 drug treatment group also showed similar symptoms, but recovered more quickly after drug treatment.

[0088] Table 3 Clinical symptoms in mice during animal efficacy tests

[0089]

[0090] Note: -: Normal; +: Ruffled fur, poor appetite; ++: Depressed, abdominal breathing; +++: Rapid breathing, significant weight loss; ++++: Eyes tightly closed with white discharge, difficulty breathing or even death.

[0091] Weight changes:

[0092] The changes in average body weight of mice in each experimental group are as follows: Figure 1 and Figure 2 As shown. In the in vivo efficacy test against H1N1 influenza virus, the body weight of the control group gradually increased, while the weight gain of the YE10 toxicity group and the H1 drug group differed slightly after inoculation, with the YE10 toxicity group showing a higher weight gain than the control group. Mice in the H1 inoculation group experienced a significant decrease in body weight and all died on day 7. In the in vivo efficacy test against H9N2 influenza virus, the YE10 toxicity group showed the same performance as the control group, while the H9 Tamiflu group and the H9 drug group showed a gradual recovery in body weight after administration.

[0093] Organ virus titer detection:

[0094] Mice in each group underwent aseptic dissection on days 3 and 5, and viral titers in various tissues were measured. No virus was detected in the control group and the YE10 virulence group, while viral titers were detected in the lungs, nasal turbinates, spleen, and other tissues of the H1 inoculation group. Results are as follows: Figure 3 and Figure 4 As shown, no virus was found in any tissues of the blank control group and the YE10 toxicity group. No viral titer was detected in the dissected mouse tissues of any of the H9N2 experimental groups. Viral titers were only detected in the H1 inoculation group, the H1 Tamiflu group, and the H1 drug treatment group. On day 3, viral titers were detected in the lungs, nasal turbinate bones, spleen, and kidneys of the H1 inoculation group, with the highest average viral titer in the lung tissue being 5.44 ± 0.51 log10 TCID. 50 / ml, followed by viral titers in the nasal turbinate bone (4.55±0.39log10TCID). 50 / ml), spleen (0.66±0.58log10TCID) 50 / ml), kidney 0.33log10TCID 50 / ml). On day 3, viral titers were detected only in the nasal turbinate bones in the H1 Tamiflu group and the H1 treatment group, at 4.55±0.19log10TCID, respectively. 50 / ml and 2.79±0.18log10TCID 50 / ml. The viral titer in the nasal turbinate bone of the H1 treatment group was significantly different from that of the H1 infection group (P<0.001). A comparison between day 3 and day 5 revealed a decrease in titers in all tissues. The viral titer in the nasal turbinate bone of the H1 treatment group was 2.43±0.09log10TCID. 50The concentration of TCID50 / ml was lower than that in the H1 group (4.11 ± 0.51 log10 TCID50). 50 / ml) and H1 Tamiflu group (4.11±0.51log10TCID) 50 The difference was extremely significant (P<0.001).

[0095] Detection of titer in mouse lung tissue using quantitative real-time PCR:

[0096] Viral RNA was extracted using a total viral RNA extraction kit and then detected by real-time PCR. No virus was detected in the lung tissue of mice in the control group and the YE10 virulence group. The H1 infection group had a higher viral load, while the viral load significantly decreased in the H1 Tamiflu group and the H1 treatment group on day 5. Results are as follows. Figure 5 As shown in the figure, the results of viral load detection in lung tissue were similar to those of tissue titer detection. No viral load was detected in the lung tissue of the blank control and YE10 toxicity control. The H1 infection group had the highest viral load in the lungs, and the viral load in the lung tissue further increased after 5 days. No virus was detected in the H1 Tamiflu group after 3 days, and extremely low levels were detected on the fifth day. Extremely low levels of virus were detected in the H1 treatment group on both 3 and 5 days, with no significant difference between the two days (P>0.05).

[0097] Plasma cytokine assay:

[0098] Plasma cytokine assays were performed using ELISA to detect pro-inflammatory and anti-inflammatory cytokines such as TNF-α, IFN-γ, IL-6, and IL-10. Results showed that the supernatant from the YE10 fermentation broth could enhance the immune response in mice by regulating cytokine secretion. Serum was obtained from orbital blood collection from mice in each challenge group on days 3 and 5. Changes in TNF-α, IFN-γ, IL-6, and IL-10 levels in mice were detected using a Solarbio cytokine ELISA kit. Serum cytokine ELISA detection results are as follows: Figure 6 As shown:

[0099] In the blank control group, there was no significant difference in the pro-inflammatory factor TNF-α levels between days 3 and 5 (P>0.05), with levels of 148.1±34.1 pg / ml and 131.1±33.5 pg / ml, respectively. In the YE10 toxicity group, compared to the blank control group, TNF-α secretion decreased significantly on both days 3 (111.3±3.0 pg / ml) and 5 (103.8±7.3 pg / ml) (P<0.05). In the H1 infection group, TNF-α secretion first increased and then decreased significantly between days 3 (170.3±36.4 pg / ml) and 5 (93.5±20.7 pg / ml) (P<0.01). In all other groups, TNF-α secretion decreased slightly on days 3 and 5 compared to the blank control group.

[0100] In the blank control group, the pro-inflammatory factor IL-6 remained essentially unchanged on days 3 and 5, with levels of 153.3±12.9 pg / ml and 140.6±5.7 pg / ml, respectively. In the H1 treatment group, IL-6 secretion initially increased and then decreased compared to the blank control group on days 3 (190.4±23.2 pg / ml) and 5 (138.2±5.4 pg / ml), with a significant difference (P<0.05). In the toxicity group, H1 exposure group, H9 exposure group, and H1 Tamiflu group, IL-6 secretion decreased on day 3 but returned to normal levels by day 5.

[0101] On day 3, IFN-γ levels increased in all experimental groups except the H1 treatment group, but the overall difference was small and not significant. Comparing day 3 and day 5, IFN-γ levels in all experimental groups further increased from their original levels, with the H1 treatment group showing the largest increase. The difference between day 3 (406.3±0.9 pg / ml) and day 5 (442.1±5.2 pg / ml) was significant (P<0.01).

[0102] On day 3, the levels of the anti-inflammatory factor IL-10 increased significantly in all experimental groups except for the H1 Tamiflu group, which showed no significant change. The H1 treatment group (229.7±27.0 pg / ml) showed a highly significant upregulation compared to the control group (96.27±7.3 pg / ml) (P<0.001), and the increases in all H9 experimental groups were significantly different from those in the control group (P<0.01). On day 5, the IL-10 level in the H1 treatment group (198.9±6.7 pg / ml) was further upregulated compared to day 3 (148.6±14.3 pg / ml), while the levels in all other groups decreased and returned to normal.

[0103] Tissue section examination:

[0104] Lung tissues from mice in each group were fixed after aseptic dissection on days 3 and 5, and histological sections (HE 200×) were examined. The results are as follows: Figure 7 and 8As shown, no obvious abnormalities were observed in the lung tissue of mice in the blank control group and the YE10 toxicity group, while significant inflammatory responses were observed in the H1-treated group on days 3 and 5. Lung lesions were milder in the H1 Tamiflu group and the H1-treated group. In the blank control group and the YE10 toxicity group, no obvious abnormalities were observed in the morphology and structure of the bronchioles in the lung tissue on days 3 and 5; the alveolar walls were of normal thickness, and no inflammatory cell infiltration was found. Lung tissue sections from the H9-treated, H9-treated, and H9 Tamiflu groups showed normal morphology and structure on days 3 and 5, with slight thickening of the alveolar walls and no significant inflammatory cell infiltration. In the H1-treated group, alveolar wall thickening and capillary congestion were observed on day 3, with narrowing of the alveolar cavities and extensive neutrophil infiltration. On day 5, the alveolar walls were extensively infiltrated with inflammatory cells, thickened, and showed significant congestion, with a significant reduction in the number of alveoli, indicating consolidation lesions. Compared to the H1 treatment group, the alveoli in the H1 Tamiflu group were more intact on day 3, with a large number of neutrophil infiltrations. By day 5, the lung lesions had decreased, similar to the control group. In the H1 treatment group, the alveolar cavities were narrowed on day 3, with a large number of neutrophil infiltrations observed locally. Compared to the H1 Tamiflu group, the alveolar walls were moderately thickened locally. By day 5, the morphology and structure of the bronchioles in the lung tissue did not show obvious abnormalities, but a large number of neutrophil infiltrations were observed.

[0105] In summary:

[0106] YE10 exhibited good antiviral activity against H1N1 and H9N2 subtype influenza viruses in both cell and animal models. The supernatant of YE10 endobiotic fermentation broth effectively protected mice infected with H1N1 influenza virus and also showed significant antiviral activity against oseltamivir-resistant H9N2 influenza virus strains. These results suggest that the supernatant of YE10 endobiotic fermentation broth is a potential candidate drug for anti-influenza virus treatment. Analysis of immune factors in mice revealed that YE10 fermentation broth effectively modulates the immune response, including upregulating anti-inflammatory factors (such as IFN-γ) and downregulating pro-inflammatory factors (such as IL-6 and IL-10), indicating that it not only possesses antiviral capabilities but also enhances the body's immune response.

Claims

1. An endophytic bacterium of the Camellia chrysantha plant, characterized in that, The endophytic bacteria of the Camellia chrysanthemi plant are Bacillus thuringiensis (Bt). Bacillus thuringiensis It is preserved at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 32945.

2. A microbial agent, characterized in that, The microbial agent comprises the endophytic bacteria of the Camellia chrysantha plant as described in claim 1.

3. The application of the endophytic bacteria of Camellia chrysantha according to claim 1 or the bacterial agent according to claim 2 in the preparation of a drug for inhibiting influenza A virus. The influenza virus in question is either H1N1 or H9N2.

4. The application of the endophytic bacteria of the Camellia chrysantha plant according to claim 1 or the microbial agent according to claim 2 in the preparation of drugs or health products that enhance immunity. By downregulating the secretion of pro-inflammatory factors IL-6 and IL-10 and enhancing the secretion of IFN-γ, the body's immune resistance is improved.

5. A drug for inhibiting influenza A virus, characterized in that, The drug comprises the endophytic bacteria of Camellia chrysantha according to claim 1 or the bacterial agent according to claim 2.

6. The medicament according to claim 5, wherein the medicament further comprises a pharmaceutically acceptable carrier.

Images