Hybridoma cell strain secreting anti-influenza virus PB1 protein monoclonal antibody and application thereof

Abstract

The invention discloses a hybridoma cell strain secreting an anti-influenza virus PB1 protein monoclonal antibody and application of the hybridoma cell strain. The hybridoma cell strain is named as 4F7 and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: C2024115. The monoclonal antibody 4F7 secreted by the hybridoma cell belongs to an IgG1 subclass and specifically targets an influenza virus PB1 protein C-terminal region, 629NPFVS633 is a core antigen epitope recognized by the monoclonal antibody 4F7, and the monoclonal antibody 4F7 has high sequence conservative property in avian influenza virus, human influenza virus and other mammal-derived influenza virus. The monoclonal antibody can also be well applied to IFA, WB, IP / Co-IP and other tests, can be used for broad-spectrum recognition of PB1 proteins of various different influenza viruses such as H5, H7 and H9 subtype avian influenza viruses and H1 and H3 subtype human influenza viruses, and has high application potential in the aspects of PB1 protein function and antiviral preparation research and broad-spectrum detection of influenza viruses.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and mainly relates to a hybridoma cell line that can stably secrete monoclonal antibodies against influenza virus PB1 protein. At the same time, it relates to the monoclonal antibodies secreted by the hybridoma cell line and their applications. Background Art

[0002] Influenza viruses are infectious pathogens that seriously endanger human health and animal welfare. Currently, four types, namely A, B, C, and D, have been classified. Among them, influenza A virus has the widest host infection spectrum, covering various animals such as humans, birds, pigs, horses, dogs, minks, and dairy cows. This virus is extremely prone to genetic and antigenic variations, not only causing outbreaks, epidemics, and even pandemics, but also being able to cause cross-species transmission events, posing a great threat to public health security. The influenza A viruses that cause human influenza are mainly H1 and H3 subtypes, both of which have caused influenza pandemics worldwide and have become important pathogen components of seasonal influenza. The influenza A viruses that seriously endanger livestock and poultry farming are mainly H5, H7, and H9 subtype avian influenza viruses. Among them, H5 and H7 subtypes can cause highly pathogenic avian influenza, which can lead to 100% morbidity and death in unvaccinated poultry flocks; H9 subtype can significantly reduce the production performance of poultry and cause more serious losses through mixed infections with various other pathogens; in addition, cases of avian influenza viruses breaking through the interspecies barrier and directly infecting humans are mainly caused by H5, H7, and H9 subtypes, so they also have significant public health significance.

[0003] During the infection and replication process of influenza viruses, the RNA polymerase complex composed of the conserved PB2, PB1, and PA proteins plays a crucial role. It forms ribonucleoprotein particles together with viral RNA (vRNA) and NP protein, and can affect many aspects such as vRNA replication and mRNA transcription. Among them, the PB1 protein encoded by the PB1 gene provides the backbone elements for the assembly of the polymerase, interacting with PA and PB2 proteins through its amino-terminal (N-terminal) and carboxyl-terminal (C-terminal) regions respectively; moreover, the PB1 protein is the core catalytic subunit of the polymerase, and a large catalytic cavity can be formed inside it, participating in the process of RNA chain extension.

[0004] The monoclonal antibody against PB1 protein is an important tool for studying the interaction between PB1 protein and host proteins and its impact on virus infection and immunity. However, currently available commercial PB1 protein antibodies are limited, and most of the antibodies with known immunogen information target the N-terminal region of PB1 protein (such as the product GTX125923 of GeneTex) or the middle segment (such as the products GTX637313 and GTX637314 of GeneTex), which greatly limits the in-depth exploration of the functions of PB1 protein, especially its C-terminal domain. Therefore, it is necessary to develop monoclonal antibodies targeting the C-terminal region of PB1 protein. Moreover, when the obtained PB1 monoclonal antibody has good reactivity with different influenza viruses, it will provide good candidate test materials for broad-spectrum pathogen detection.

[0005] In addition, considering that polymerase proteins are highly conserved among different influenza viruses and have no homologous proteins in mammalian cells, designing antiviral drugs targeting polymerase is less likely to generate drug resistance and has no serious toxic and side effects on the human body, showing good application prospects. Currently, polymerase inhibitor drugs have been marketed as new anti-influenza virus drugs, such as baloxavir, a PA protein inhibitor, and favipiravir, a PB1 protein inhibitor. Therefore, the identification of antigenic epitopes of the developed PB1 protein monoclonal antibody with broad binding ability can also provide candidate targets for the development of anti-influenza virus agents. Summary of the Invention

[0006] To solve the problems existing in the prior art, the present invention prepared a monoclonal antibody belonging to the IgG1 subclass by combining prokaryotic expression technology and hybridoma technology. This monoclonal antibody can specifically target the C-terminal region of influenza virus PB1 protein, with the conserved amino acids at positions 629-633 as the core antigenic epitope, and can broadly recognize various influenza viruses such as H5, H7, H9 subtype avian influenza viruses and H1, H3 subtype human influenza viruses. The successful acquisition of this monoclonal antibody, on the one hand, provides important technical support for the study of the function of influenza virus PB1 protein, which is conducive to further analyzing the pathogenic and immune mechanisms of influenza viruses; on the other hand, it also lays an important foundation for the rapid diagnosis of influenza viruses covering different subtypes and different host sources, which is conducive to the further development of related detection reagents and antiviral agents.

[0007] The present invention provides a hybridoma cell line 4F7 (Hybridoma cell line 4F7) that secretes a monoclonal antibody against influenza virus PB1 protein, and the preservation number is CCTCC NO: C2024115.

[0008] The present invention also provides a monoclonal antibody 4F7 produced by the hybridoma cell line CCTCC NO: C2024115. This monoclonal antibody can specifically immunologically bind to a variety of influenza viruses with different subtypes and host sources in indirect immunofluorescence assay (IFA) and Western blot (WB) assays.

[0009] The present invention also provides an antigenic epitope recognized by the monoclonal antibody 4F7, which specifically recognizes the C-terminal region of the influenza virus PB1 protein.

[0010] Furthermore, the core antigenic epitope specifically recognized by this monoclonal antibody is the peptide segment at positions 629 - 633 of the influenza virus PB1 protein, and the amino acid sequence of the peptide segment at positions 629 - 633 is shown as SEQ ID NO.1, specifically 629 NPFVS 633 . By using the truncation method, it is identified that the monoclonal antibody targets a linear epitope with the amino acids at positions 629 - 633 of the influenza virus PB1 protein as the core motif. This epitope is highly conserved in influenza A viruses and can be used as a candidate target for further application in the research and development of anti-influenza virus drugs.

[0011] The present invention also discloses the application of the monoclonal antibody 4F7 in the preparation of broad-spectrum detection reagents for influenza viruses and their PB1 proteins.

[0012] The present invention also provides the application of the monoclonal antibody 4F7 in identifying interacting proteins of the influenza virus PB1 protein.

[0013] The features and advantages of the present invention are as follows: The present invention discloses a broad-spectrum monoclonal antibody 4F7 targeting a conserved linear epitope in the C-terminal domain of the influenza virus PB1 protein, which is secreted by the hybridoma cell 4F7 (deposit number CCTCC NO: C2024115). It can be applied to the detection of influenza viruses and their PB1 proteins and has good broad-spectrum properties. Both IFA and WB assays prove that the monoclonal antibody can specifically bind to different influenza viruses such as H5, H7, H9 subtype avian influenza viruses and H1, H3 subtype human influenza viruses. Moreover, this monoclonal antibody also has good reactivity in immunoprecipitation (IP) / co-immunoprecipitation assay (Co-IP). It can not only be applied to promote the in-depth study of the function of the PB1 protein and influenza viruses, but also be applied to the further development of universal detection kits and antiviral preparations for influenza viruses, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1The antigenic epitopes of the PB1 protein of the 0936 (H5N6) strain were predicted by bioinformatics analysis tools (TMHMM, IEDB, and DNAStar - Protean). Figure A shows the surface accessibility of the PB1 protein analyzed by TMHMM, Figure B shows the linear epitopes of the PB1 protein predicted by IEDB, and Figure C shows the hydrophilicity, flexibility regions, antigenicity, and surface accessibility of the PB1 protein analyzed by DNAStar - Protean.

[0015] Figure 2 This is the SDS - PAGE identification diagram of the polypeptide of the C - terminal region (amino acids 561 - 669) of the PB1 protein of the 0936 (H5N6) strain. Lane M is the protein molecular weight standard, lane 1 is the lysed whole bacteria, lane 2 is the sample effluent, lanes 3 - 7 are the washing effluents, and lanes 8 - 13 are the elution effluents.

[0016] Figure 3 This is the IFA identification diagram of the supernatant of hybridoma cell 4F7 on 293T cells transfected with the eukaryotic expression plasmid of the PB1 protein. In Figure A, the primary antibody used is a commercial PB1 protein antibody (product of GeneTex, catalog number GTX125923), in Figure B, the primary antibody used is the supernatant of hybridoma cell 4F7, and in Figure C, the primary antibody used is the serum of non - immunized mice (negative serum).

[0017] Figure 4 This is the WB identification diagram of the supernatant of hybridoma cell 4F7 on 293T cells transfected with the eukaryotic expression plasmid of the PB1 protein.

[0018] Figure 5 This is the IFA identification diagram of monoclonal antibody 4F7 on MDCK cells infected with the 0936 (H5N6) virus. In Figure A, the primary antibody used is the serum of fused mice (positive serum), in Figure B, the primary antibody used is the ascites of 4F7 mice, and in Figure C, the primary antibody used is the serum of non - immunized mice (negative serum).

[0019] Figure 6 This is the WB identification diagram of monoclonal antibody 4F7 on MDCK cells infected with the 0936 (H5N6) virus.

[0020] Figure 7 This is the result diagram of monoclonal antibody 4F7 applied to the IP / Co - IP assay.

[0021] Figure 8 This is the identification result of the antigenic epitopes recognized by monoclonal antibody 4F7. In Figures A, C, and E, the primary antibody used is the antibody against the GFP tag, and in Figures B, D, and F, the primary antibody used is the ascites of 4F7 mice.

[0022] Figure 9Results of the conservative analysis of the antigenic epitope recognized by monoclonal antibody 4F7. Panel A shows the degree of conservation of the amino acid sequence at positions 626 - 636 of the PB1 protein in influenza A viruses from different host sources. Panel B shows 626 NPLNPFVSHKE 636 the degree of conservation in influenza A viruses from different host sources.

[0023] Figure 10 WB results of monoclonal antibody 4F7 against MDCK cells infected with influenza viruses of different subtypes and from different host sources.

[0024] The hybridoma cell line 4F7 in the present invention was deposited at the China Center for Type Culture Collection (address: Wuhan University, China) on September 29, 2024. It was classified and named as hybridoma cell line 4F7, and its Latin name is Hybridoma cell line4F7. The deposit number is CCTCC NO: C2024115. Detailed implementation manners

[0025] The present invention will be further elaborated below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it. However, these embodiments are not intended to limit the scope of the present invention. The experimental methods used in the following embodiments are all conventional methods unless otherwise specified. The materials and reagents used can be obtained from commercial sources unless otherwise specified.

[0026] The following publicly available biological materials are preserved in the applicant's laboratory: 0936 (H5N6) strain (Ge Z, Gu M, Cai T, et al. Phylogenetic tracing andbiological characterization of a novel clade 2.3.2.1 reassortantof H5N6subtype avian influenza virus in China [J]. TransboundEmerg Dis, 2021, 68(2):730 - 741); The accession numbers of the 8 gene sequences of the 0936 (H5N6) virus in the GenBank database are MK554831 - MK554838; Recombinant plasmid pCAGGS - PB1 (Ge Zhichuang. Genetic evolution of H5 subtype avian influenza viruses in East China from 2017 to 2019 and the mechanism of the PB1 gene affecting the replication of H5N6 virus [D]. Yangzhou: Yangzhou University, 2023).

[0027] Example 1: Obtaining of Hybridoma Cell Line 4F7 and Monoclonal Antibody Produced Thereby Prediction of Protein Antigen Epitope and Preparation of Immunogen Based on the bioinformatics analysis tools TMHMM (http: / / www.cbs.dtu.dk / services / TMHMM, online analysis of protein transmembrane domains), IEDB (https: / / www.iedb.org / , immune epitope database), and the Protean module of DNAStar software (https: / / www.dnastar.com / ), the antigen epitopes of the PB1 protein of the 0936 (H5N6) strain were predicted, and the results are as shown in the appendix Figure 1 First, TMHMM analysis indicated that the amino acid sequences at positions 1 - 404 and 518 - 757 of the PB1 protein were highly likely to be located outside the membrane ( Figure 1 A). Second, IEDB prediction indicated that linear epitope regions containing 40 amino acids or more were mainly distributed at positions 44 - 83, 175 - 214, 561 - 606, and 611 - 690 of the amino acids, and the latter two were adjacent epitopes ( Figure 1 B). Finally, based on the Kyte - Doolittle, Karplus - Sohulz, Jameson - Wolf, and Emini methods in the DNAStar - Protean tool, the hydrophilicity, flexible regions, antigenicity index, and surface accessibility of the above four peptide segments were predicted, and it was found that they were all good candidate regions for antigen epitopes ( Figure 1 C). Further combining with the known functional domain distribution of the PB1 protein in the literature (Chun - Yeung Lo, Yun - Sang Tang, and Pang - Chui Shaw. Structureand Function of Influenza Virus Ribonucleoprotein[J]. Subcell Biochem, 2018,88: 95 - 128), the amino acids at positions 561 - 669 in the C - terminal region (SEQ ID NO. 2) were finally selected as the antigen epitope target region, and its prokaryotic expression was carried out to prepare the immunogen.

[0028] According to the multiple cloning sites of the PB1 gene (GenBank accession number: MK554832.1) and the pET - 32a vector (purchased from Miaoling Biology, product number P0033), specific primers were designed using Snap Gene software. The sequence of the upstream primer was: 5’ - CCATGGCTGATATCGGATCC GAATTC TGCCACAGGGGTGATACGCA (the underlined part is EcoRⅠ restriction site ) (SEQ ID NO. 3), the downstream primer sequence is: 5’-CACACTCATGGATCCCTAAA AAGCTT GCGGCCGCACTCGAGCACCA (the underlined part is Hin dⅢ restriction site) (SEQ ID NO. 4), and the primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. Using the recombinant plasmid pCAGGS-PB1 stored in this laboratory as a template, the target gene fragment was amplified by polymerase chain reaction (PCR). The amplification system was: 2 μL of pCAGGS-PB1 template, 1 μL of each upstream and downstream primer, 10 μL of 2×Taq Plus Master Mix Ⅱ (DyePlus), ddH 2 O 6 μL. The PCR program was set as follows: pre-denaturation at 94 °C for 4 min; denaturation at 94 °C for 30 s, annealing at 62 °C for 30 s, extension at 72 °C for 1 min, for a total of 30 cycles; and then extension at 72 °C for 10 min. The obtained PCR product was subjected to gel extraction and recovery, and it was simultaneously digested with Eco RⅠ and Hin dⅢ by double digestion. The target gene was cloned into the pET-32a vector by homologous recombination technology to obtain a prokaryotic expression recombinant plasmid expressing amino acids 561 - 669 of the PB1 protein of the 0936(H5N6) strain.

[0029] The obtained recombinant plasmid was transferred into BL21(DE3) competent cells. Positive single colonies were picked and inoculated into LB liquid medium with ampicillin resistance, and cultured with shaking at 33 °C and 180 rpm for 16 - 18 h. Subsequently, according to a ratio of 1:200, the culture was expanded at 33 °C and 180 rpm for 4 - 5 h until the OD 600 value reached 0.4 - 0.6. IPTG with a final concentration of 0.1 mM was added and induced at 16 °C for 12 h. The bacterial solution was centrifuged to obtain a bacterial cell precipitate, which was then ultrasonically disrupted. Then, the His-tagged protein purification kit (reduction-resistant chelating type) from Beyotime Institute of Biotechnology was used to purify the protein according to the instruction manual, and the obtained protein was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The results are as shown in Figure 2 the appendix, and finally a recombinant protein expressing amino acids 561 - 669 of PB1 of the 0936(H5N6) strain was obtained.

[0030] Animal immunization The recombinant protein expressing amino acids 561 - 669 of PB1 of 0936 (H5N6) strain constructed with pET-32a as the vector was used as the immunogen, and 6-week-old BALB / c mice were immunized by conventional methods. At the first immunization, the immunogen was mixed with Freund's complete adjuvant at a ratio of 1:1. After complete emulsification, it was subcutaneously injected into the mice to be immunized at a dose of 100 μg / mouse at multiple points. Two weeks after the first immunization, the second immunization was carried out. Freund's complete adjuvant was replaced with Freund's incomplete adjuvant, and other immunization conditions remained unchanged. Two weeks after the second immunization, the third immunization was carried out under the same immunization conditions. One week after the third immunization, the immunized mice were bled from the submandibular vein, and the antibody titer of the sera obtained after the third immunization was measured by indirect enzyme-linked immunosorbent assay (ELISA). When the ELISA titer of the immunized mice ≥ 1:25600, the mice were intraperitoneally injected with the purified recombinant protein expressing amino acids 561 - 669 of PB1 protein of 0936 (H5N6) strain for boost immunization. Three days after completion, cell fusion was performed.

[0031] Cell fusion and screening of positive hybridoma cells It was carried out according to the conventional hybridoma technology. Briefly, one day before fusion, peritoneal macrophages of healthy ICR mice were used as feeder cells and were appropriately aliquoted into 96-well cell culture plates. The culture medium was HAT medium containing 15% fetal bovine serum. On the day of fusion, the immunized mice were bled from the eyeballs, and this was used as the positive serum for later experiments. Immediately, the mouse spleens were taken out in a laminar flow hood, ground to obtain spleen cell suspensions, and the Sp2 / 0 cells in the logarithmic growth phase were mixed with the prepared spleen cells. During this period, polyethylene glycol pre-warmed to 37°C (such as PEG1500) was added to promote the fusion of the two types of cells, and then the fusion reaction was terminated using DMEM medium without antibiotics and serum. Finally, the supernatant was discarded by low-speed centrifugation, and the cell pellet was resuspended with HAT medium and evenly added dropwise to the 96-well cell culture plates pre-coated with feeder cells, and then incubated statically in a 5% CO 2 2, 37°C cell incubator.

[0032] After about 5 days, the cells in each well of the cell plate were replenished with HAT medium; after about 10 days, when the culture supernatant of the fused hybridoma cells turned yellow or there were obvious cell clumps distributed at the bottom of the wells, the cell supernatant could be taken for an indirect ELISA test to screen for positive hybridoma cells. In this ELISA test, the antigen-coated was a recombinant protein expressing amino acids 561-669 of the PB1 protein of the 0936 (H5N6) strain. The cell supernatant to be tested was used as the primary antibody (the positive serum control was the immune mouse serum collected during fusion), and HRP-labeled goat anti-mouse IgG was used as the secondary antibody. After color development with TMB solution, the reaction was terminated with TMB color development termination solution. The absorbance value at a wavelength of 450 nm was read, and the cell wells with an OD450 reading close to 1.0 and a P / N ratio ≥ 2.1 were selected as positive cell wells; the cell wells with positive readings in all three screenings were counted as positive hybridoma cell wells with ELISA reaction activity.

[0033] To exclude the possible false positive results caused by the same immunogen and detection antigen, the cell supernatants of the cells positive in the ELISA test were further subjected to indirect immunofluorescence assay (IFA) and Western blot assay using eukaryotic-expressed PB1 protein. The IFA assay is briefly described as follows: 293T cells were transfected with the eukaryotic expression plasmid pCAGGS-PB1. After 24 hours of transfection, the cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes; after fixation, the cells were treated with immunostaining permeabilization solution at room temperature for 10 minutes; after permeabilization, the cells were incubated with QuickBlock™ immunostaining blocking solution at room temperature for 20 minutes for blocking; after washing 3 times with PBST, commercial PB1 protein antibody, the hybridoma cell supernatant to be tested, and negative mouse serum (collected from ICR mice used to prepare feeder cells) were used as the primary antibodies and incubated overnight at 4°C; after washing 3 times with PBST; AF555-labeled goat anti-rabbit IgG or FITC-labeled goat anti-mouse IgG diluted with PBST at a ratio of 1:5000 was used as the fluorescent secondary antibody, and it was incubated at 37°C for 1 h in the dark, then washed 3 times with PBST, and finally observed under a microscope for the presence of specific orange-red or yellow-green fluorescence. The results are as follows Figure 3 shown. The commercial PB1 protein antibody ( Figure 3 A) and the supernatant of hybridoma cell 4F7 ( Figure 3 B) could both bind to the PB1 protein expressed by the pCAGGS-PB1 plasmid and produce bright fluorescence, while the negative mouse serum had no specific fluorescence ( Figure 3 C). Therefore, 1 strain of hybridoma cell 4F7 that could recognize the PB1 protein was successfully screened out.

[0034] Meanwhile, to further verify whether the antibody secreted by the hybridoma cell 4F7 can be applied to WB assay, the eukaryotic expression plasmid pCAGGS-PB1 was transfected into 293T cells, and the pCAGGS empty vector and non-transfected plasmid empty cells (Mock) were set as negative controls. After 24 hours of transfection, the culture medium was discarded, and the cells were lysed with cell lysate on ice. Subsequently, the supernatant was collected by centrifugation at 10000 r / min for 10 min, which was the protein sample. An appropriate amount of loading buffer was added thereto, and after mixing, the sample was boiled at 97 °C for 10 minutes; then SDS-PAGE electrophoresis, transfer, and blocking were carried out; the supernatant of 4F7 cells and the primary antibody diluent were diluted 1:1 and used as the primary antibody, and incubated overnight in a shaker at 4 °C; after the PVDF membrane was taken out and washed 3 times with TBST, HRP-labeled goat anti-mouse IgG was used as the secondary antibody, and incubated in a shaker at room temperature for 1 hour; after washing 3 times with PBST as above, the PVDF membrane was developed and the results were observed. The results are as shown in Figure 4 As shown, there were no bands in the cell samples transfected with the pCAGGS empty vector and those not transfected with any plasmid, while a distinct single reaction band appeared at 78 kDa in the cell sample transfected with the pCAGGS-PB1 plasmid, and its size was the same as that of the PB1 protein. This further proved that the hybridoma cell 4F7 could recognize the eukaryotically expressed PB1 protein.

[0035] Subcloning of positive hybridoma cells and preparation of ascites The positive hybridoma cell 4F7 was cloned using the limiting dilution method. The original culture medium in the 4F7 cell well was discarded, 100 μL of HT medium was added, and the cells were gently blown down. The entire cell suspension was transferred to the well in the first row and first column of another 96-well cell plate. Subsequently, 100 μL of HT medium was added as the diluent to the wells in the first column of rows 1-7 of the cell plate, and the cell suspension in the first well was serially diluted 2-fold from top to bottom; the cells in the well with a cell count of approximately 100 were further transferred to a centrifuge tube, 4 mL of HT medium was added dropwise for dilution, and 100 μL of the diluted cell suspension was added dropwise to the second and third columns of the cell plate; the remaining cell suspension was supplemented with HT medium to 4 mL again, and after mixing, it was added to the fourth to fifth columns of the cell plate respectively; HT medium was continuously supplemented and the above method was repeated to spread the diluted cell suspension on the sixth and seventh columns, eighth and ninth columns, and tenth to twelfth columns in turn; finally, the cell plate was placed in a 5% CO 2 2, 37 °C cell incubator for culture. On about the 5th day, observation was carried out under a microscope, and the culture wells showing single-clone cell growth were marked; on about the 10th day, the antibody titer in the cell supernatant was detected, and the single-cell colony well with the highest antibody titer was selected, and subcloning was carried out again until the positive rate of the antibody secreted by the monoclonal cell well detected by indirect ELISA assay reached 100%.

[0036] Inject sterilized liquid paraffin into the abdominal cavity of postpartum BALB / c female mice at a dose of 0.5 mL / mouse; on about the 7th day, observe that the abdomen of the mice bulges slightly, and then inoculate about 1×10 6 hybridoma cells into the abdominal cavity of each mouse; on the 14th - 17th day, after the abdomen of the mice bulges significantly, draw ascites, centrifuge to obtain the supernatant, measure its antibody level and store it in aliquots for future use.

[0037] Example 2 Determination of the IFA reactivity of monoclonal antibody 4F7 with influenza virus-infected cells Infect MDCK cells with the 0936 (H5N6) strain, and at the same time set up non-infected cell wells as negative controls. Conduct an IFA test 24 hours after infection, and the operation steps are the same as in Example 1. The primary antibody is monoclonal antibody 4F7 mouse ascites diluted 1:200 with PBST, and incubate overnight at 4°C; the secondary antibody is FITC-labeled goat anti-mouse IgG appropriately diluted with PBST, and finally observe under a microscope whether there is specific green fluorescence. The results are as shown in the Figure 5 attachment. Figure 5 A) and monoclonal antibody 4F7 ( Figure 5 B) can both bind to the PB1 protein of the 0936 (H5N6) strain to produce bright green fluorescence, and there is no specific fluorescence in the non-infected virus cells ( Figure 5 C). This indicates that monoclonal antibody 4F7 can be used for the specific recognition of influenza virus in the IFA test.

[0038] Example 3 Determination of the WB reactivity of monoclonal antibody 4F7 with PB1 protein in the virus-infected state Infect MDCK cells with the 0936 (H5N6) strain, and at the same time set up non-infected cell wells (Mock) as negative controls. Collect samples 24 hours later for Western blot testing, and the testing method is the same as in Example 1. However, the primary antibody at this time is monoclonal antibody 4F7 mouse ascites diluted 1:500, and other conditions remain unchanged. The results are as shown in the Figure 6 attachment. Although there is a non-specific miscellaneous band in the Mock sample at 45 KDa, in addition to this miscellaneous band, the MDCK cell sample infected with the 0936 (H5N6) virus also has a clear single reaction band near 78 kDa, which is the same size as the PB1 protein. This indicates that monoclonal antibody 4F7 can be used for the specific recognition of influenza virus PB1 protein in the WB test.

[0039] Example 4 Application of monoclonal antibody 4F7 in IP / Co-IP assays Taking the infection of MDCK cells with the 0936 (H5N6) virus strain as an example, the application of monoclonal antibody 4F7 in IP / Co-IP assays was evaluated. MDCK cells were infected with a 1 MOI dose of 0936 (H5N6) avian influenza virus. After 24 h, the cells were lysed with cell lysis buffer on ice and then transferred to a pre-cooled centrifuge tube. 40 μL was aspirated from it as the sample input control (Input). Further, monoclonal antibody 4F7 or mouse IgG1 isotype control was added to the centrifuge tube, and incubated overnight at 4˚C to allow the antibody to bind to the corresponding protein. Next, Protein A / G Magnetic Beads were added, and slowly rotated and mixed at room temperature for 1 hour to allow the antibody to bind to the Magnetic Beads. Subsequently, after adsorption on a magnetic stand on ice, the supernatant was discarded, and TBS containing cell lysis buffer was added, and mixed by inverting up and down for washing. Then, adsorbed and the supernatant was discarded again, and repeated 7 - 8 times. An appropriate amount of loading buffer was added to the above-prepared IP sample, and boiled at 97˚C for 10 minutes, and then subjected to WB identification (IB). The results are as follows Figure 7 As shown, IB verified that monoclonal antibody 4F7 can not only bind to the PB1 protein in the cell sample infected with influenza virus, but also detect other viral proteins that interact with the PB1 protein, such as PB2, PA, and NP proteins that together form vRNP with the PB1 protein, by immunoblotting. Therefore, monoclonal antibody 4F7 can not only be applied to IP assays to detect influenza virus PB1 protein; it can also be applied to Co-IP assays to identify the interacting proteins of PB1 protein, including interacting viral proteins and interacting host proteins, which will be beneficial to the in-depth exploration of the pathogenic and immune mechanisms of influenza virus.

[0040] Example Five Subclass identification and epitope identification of monoclonal antibody 4F7 Using the Mouse Monoclonal Antibody Isotyping Reagents kit from Sigma-Aldrich, the monoclonal antibody secreted by hybridoma cell 4F7 was identified according to the instructions. The results showed that its heavy chain was of IgG1 type and the light chain was of κ type.

[0041] For the identification of the antigenic epitope of monoclonal antibody 4F7, first, using pCAGGS-GFP as a vector, recombinant truncated plasmids pCAGGS-GFP-561-620, pCAGGS-GFP-591-650, and pCAGGS-GFP-610-669 expressing the amino acids at positions 561-620, 591-650, and 610-669 of the PB1 protein of the 0936 (H5N6) strain were constructed respectively. The specific construction steps were carried out according to the conventional molecular biology operation methods in this field. The constructed truncated plasmids were transfected into Hela cells. After 24 h, the cell culture medium was discarded, the cells were lysed, and protein samples were extracted. Western blot assay was performed using monoclonal antibody 4F7 as the primary antibody. The results are shown in Figure 8 Figure. As shown, the GFP antibody can recognize the GFP protein on the vector, indicating that all three polypeptides can be normally expressed in cells ( Figure 8 A). While monoclonal antibody 4F7 can simultaneously produce specific immune bands with the amino acid regions at positions 591-650 and 610-669 of the PB1 protein, that is, 4F7 can simultaneously recognize the sequences of these two regions, indicating that its antigenic epitope targets the 610-650th position shared by the two polypeptides ( Figure 8 B). Next, continuing to use pCAGGS-GFP as a vector, the amino acids at positions 610-650 of the identified PB1 protein were truncated and expressed in a way that each group contains approximately 15 amino acids with an 11-amino acid overlap before and after. Recombinant plasmids pCAGGS-GFP-610-624, pCAGGS-GFP-614-628, pCAGGS-GFP-618-632, pCAGGS-GFP-622-636, pCAGGS-GFP-626-640, pCAGGS-GFP-630-644, and pCAGGS-GFP-634-652 expressing the amino acids at positions 610-624, 614-628, 618-632, 622-636, 626-640, 630-644, and 634-652 were constructed respectively, and transfected into Hela cells, and the same operations were carried out as above. The results are shown in Figure 8 Figure C. All the above-mentioned seven polypeptides constructed can be normally expressed in the transfected cells. At the same time, combined with the results of Figure 8 Figure D, monoclonal antibody 4F7 can only simultaneously produce specific immune bands with the amino acid regions at positions 622-636 and 626-640 of the PB1 protein, that is, 4F7 can only simultaneously recognize the sequences of these two regions, indicating that its antigenic epitope targets the 626-636th position shared by the two polypeptides ( Figure 8D). Subsequently, in order to further clarify the core motif of the antigenic epitope targeted by monoclonal antibody 4F7, pCAGGS-GFP was used as a vector to truncate and express the amino acids at positions 626-636 of the identified PB1 protein again. Recombinant plasmids pCAGGS-GFP-627-635, pCAGGS-GFP-628-634, and pCAGGS-GFP-629-633 expressing the amino acids at positions 627-635, 628-634, and 629-633 were constructed respectively, transfected into Hela cells, and the same operations were performed as above. The results are as shown in Figure 8 Figure E. All of the above three polypeptides constructed could be normally expressed in the transfected cells. At the same time, combined with the results of Figure 8 Figure F, monoclonal antibody 4F7 could generate specific immune bands with the amino acid segments at positions 627-635, 628-634, and 629-633 of the PB1 protein, that is, 4F7 could recognize the sequences of these three regions simultaneously, indicating that the core motif targeted by its antigenic epitope was the 629-633 positions shared by the three polypeptides ( Figure 8 D). Therefore, through the step-by-step truncation and expression of the PB1 protein, it was finally shown that the amino acid sequence (NPFVS) at positions 626-636 on the PB1 protein was the core motif of the antigenic epitope recognized by monoclonal antibody 4F7.

[0042] Furthermore, by comparing the amino acid sequences of the PB1 protein, the conservation of this epitope in influenza A virus was analyzed. Influenza A viruses (n = 2817) from different host sources in China in the past five years were downloaded from the GISAID database, including avian influenza viruses (n = 1281), human influenza viruses (n = 1379), and other mammalian-derived influenza viruses (n = 157). Using the amino acid sequence (NPFVS) at positions 629-633 of the PB1 gene of the 0936(H5N6) strain as a template, the amino acid sequences at positions 629-633 of the above PB1 genes were compared. The results are as shown in Figure 9 Figure, 629 NPFVS 633 The sequence was highly conserved in influenza A viruses from different host sources. Among them, the conservation degrees of the four sites 629N, 630P, 631F, and 632V were extremely high. Only at position 633, in addition to the vast majority being S, there was also a small proportion of N ( Figure 9 A); 629 NPFVS 633 The motif accounted for 98%, 92%, and 79% respectively in the avian influenza viruses, mammalian-derived viruses, and human influenza viruses analyzed ( Figure 9B). It is shown that the amino acid sequence at positions 629 - 633 of the PB1 gene is not only highly conserved in avian influenza viruses, but also well - conserved in mammalian - origin influenza viruses including human influenza viruses, suggesting that this conserved linear epitope can be further applied to the development of new targets for broad - spectrum anti - animal influenza virus and even human influenza virus drugs.

[0043] Example 6 Determination of the broad - spectrum reactivity of monoclonal antibody 4F7 In avian influenza viruses, the representative subtypes that pose relatively serious hazards to the poultry industry and public health are mainly H5 (including H5NX subtypes such as H5N1, H5N6, H5N8, etc.), H7 (H7N9 subtype), and H9 (H9N2 subtype). In human - origin influenza A viruses, the mainly prevalent subtypes are H1 (H1N1 subtype) and H3 (H3N2 subtype). Therefore, representative strains of the above - mentioned subtypes were further selected to determine the broad - spectrum reactivity of monoclonal antibody 4F7. The virus strains were used to infect MDCK cells respectively, and the reactivity of monoclonal antibody 4F7 with influenza viruses of different subtypes and different host origins was determined by WB assay. The results are as follows Figure 10 shown. Obvious immunoreactive bands were produced at 78 kDa for the different influenza viruses to be detected, further proving that monoclonal antibody 4F7 can broadly recognize the PB1 protein of influenza viruses and can be further applied to the development of a broad - spectrum rapid detection method for influenza viruses.

Claims

1. A hybridoma cell line 4F7 secreting monoclonal antibodies against influenza virus PB1 protein, characterized in that: The deposit number is CCTCC NO: C2024115.

2. An anti-influenza virus PB1 protein monoclonal antibody 4F7, characterized in that: Produced by the hybridoma cell line CCTCC NO: C2024115 described in claim 1.

3. The anti-influenza virus PB1 protein monoclonal antibody 4F7 according to claim 2, characterized in that: It specifically recognizes the C-terminal region of the influenza virus PB1 protein.

4. The monoclonal antibody 4F7 according to claim 2, characterized in that The core antigen epitope specifically recognized by the monoclonal antibody is the 629-633th peptide segment of the influenza virus PB1 protein, and the amino acid sequence of the 629-633th peptide segment is shown in SEQ ID NO.

1.

5. Use of the monoclonal antibody 4F7 as claimed in claim 2 in the preparation of a broad-spectrum detection reagent for influenza virus and its PB1 protein.

Images