Natural gene deletion attenuated infectious spleen and kidney necrosis virus strain and application thereof

By preparing a genome-deleted ISKNV NH-1398B strain and culturing it in host cells, a live vaccine was prepared, which solved the need for safety assessment of recombinant vaccine strains, achieved safe and efficient immune protection for fish, and significantly reduced viral virulence.

CN120041406BActive Publication Date: 2025-10-24SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510202940.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-24
Publication Date
2025-10-24
Estimated Expiration
2045-02-24

AI Technical Summary

Technical Problem

Existing recombinant ISKNV gene-deleted vaccine strains require safety assessment due to the insertion of foreign gene fragments, and although their immunoprotective effects are good, further verification is needed. Naturally gene-deleted attenuated ISKNV strains have greater application potential.

Method used

A live vaccine is provided by ISKNV NH-1398B, an infectious spleen and kidney necrosis virus strain with partial deletions in ORF102R and ORF104R and complete deletion of ORF103R. The virus is cultured in host cells and the viral fluid is collected to prepare the vaccine for fish immune protection.

Benefits of technology

It achieves safe, efficient, and low-toxicity fish immune protection. In live experiments on mandarin fish, it showed a significant reduction in viral virulence. Immunized mandarin fish still had a 76% survival rate after challenge, effectively preventing infectious spleen and kidney necrosis virus disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005283691920000011
    Figure HDA0005283691920000011
  • Figure HDA0005283691920000012
    Figure HDA0005283691920000012
  • Figure HDA0005283691920000021
    Figure HDA0005283691920000021
Patent Text Reader

Abstract

The application belongs to the technical field of virus vaccine, and particularly relates to a natural gene deletion attenuated virus strain of infectious spleen and kidney necrosis virus and application thereof. In the process of purchasing live experimental animals of mandarin fish, a natural gene deletion attenuated virus strain NH-1398B of ISKNV is separated from the purchased mandarin fish. The genome of the strain is partially deleted in ORF102R and ORF104R, and ORF103R is completely deleted. In the application, whole genome sequencing and virulence determination are carried out on the NH-1398B strain, and the immunoprotective effect of the strain as an ISKNV vaccine is evaluated. The results show that the ISKNV NH-1398B strain has the characteristics of safety, high efficiency and low toxicity, and can be completely used for the immunoprevention of a new infectious spleen and kidney necrosis virus disease.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of viral vaccines, and particularly relates to a natural gene deletion attenuated virus strain of infectious spleen and kidney necrosis virus and application thereof. BACKGROUND

[0002] Infectious spleen and kidney necrosis virus (ISKNV) belongs to the double-stranded DNA virus of cell swelling virus of Iridoviridae Megalocytivirus, can infect Siniperca chuatsi, Larimichthys crocea, Scophthalmus maximus and more than 50 kinds of marine and freshwater fish, and causes great economic losses to fish farming in China. Vaccination is an effective means to prevent viral diseases of fish. At present, there are many types of vaccines, among which the immersion vaccine has become a research hotspot for the development of fish viral vaccines due to its small damage to fish body, labor saving, high efficiency and other advantages.

[0003] In related technologies, the gene deletion attenuated vaccine has more potential for immunization through immersion due to the retention of viral activity. Studies have shown that ISKNV gene deletion attenuated vaccines have good immune protection effect, such as recombinant ISKNV gene deletion vaccine strains Δorf103r / tk, Δorf022l, Δorf074 obtained by homologous group technology, which have an immune protection rate of more than 95% for Siniperca chuatsi. However, since these recombinant ISKNV gene deletion vaccine strains insert exogenous gene fragments, further safety evaluation is needed. Therefore, naturally existing ISKNV attenuated strains have greater application potential. SUMMARY

[0004] The first aspect of the present application aims to provide an infectious spleen and kidney necrosis virus strain.

[0005] The second aspect of the present application aims to provide the use of the infectious spleen and kidney necrosis virus strain of the first aspect of the present application in the preparation of a drug or preparation for preventing and treating infectious spleen and kidney necrosis virus of fish.

[0006] The third aspect of the present application aims to provide an active vaccine against infectious spleen and kidney necrosis virus.

[0007] The fourth aspect of the present application aims to provide a preparation method of the active vaccine of the third aspect of the present application.

[0008] In order to achieve the above-mentioned purposes of the present application, the technical solutions adopted by the present application are as follows:

[0009] In a first aspect of the present application, an infectious spleen and kidney necrosis virus strain is provided.

[0010] In some embodiments of the present application, the infectious spleen and kidney necrosis virus strain has a deletion of 1398 bp from 91059 bp to 92456 bp of the genome; the genome is NC_003494.1.

[0011] In some embodiments of the present application, the virus comprises a sequence as set forth in SEQ ID NO: 7.

[0012] In some embodiments of the present application, the infectious spleen and kidney necrosis virus strain is named Infectious spleen and kidney necrosis virus ISKNV NH-1398B, which was deposited with the China Center of Type Culture Collection, located at 299 Bao Yi Lu, Wuchang District, Wuhan, Hubei, China on January 16, 2025, and has the accession number CCTCC NO: V202508.

[0013] In a second aspect of the present application, the infectious spleen and kidney necrosis virus strain of the first aspect of the present application is used in the preparation of a medicament or preparation for preventing and treating fish infectious spleen and kidney necrosis virus.

[0014] In some embodiments of the present application, the fish comprises Siniperca chuatsi.

[0015] In some embodiments of the present application, the medicament or preparation comprises a vaccine.

[0016] In some embodiments of the present application, the medicament or preparation comprises a pharmaceutically acceptable excipient.

[0017] In some embodiments of the present application, the pharmaceutically acceptable excipient comprises at least one of a solvent, a propellant, a solubilizer, a cosolvent, an emulsifier, a coloring agent, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a stabilizer, a glidant, a flavoring agent, a preservative, a suspending agent, a coating material, an aromatic agent, an antiadhesive agent, an integrating agent, a penetration enhancer, a pH regulator, a buffer, a plasticizer, a surfactant, a foaming agent, an antifoaming agent, a thickening agent, an inclusion agent, a humectant, an absorbent, a diluent, a flocculating agent and a deflocculating agent, a filter aid, a release retardant, a carrier.

[0018] The above pharmaceutically acceptable excipients are generally recognized for this purpose and as inactive ingredients of a medicament. A compilation of pharmaceutically acceptable excipients can be found in the Handbook of Pharmaceutical Excipients, 2ndEdition, Edited by A. Wade and P. J. Weller; Published by American Pharmaceutical Association, Washington and The Pharmaceutical Press, London, 1994; the Handbook of Chinese Pharmacopoeia-Pharmaceutical Excipients, and the like.

[0019] In a third aspect of the present application, there is provided an active vaccine against infectious spleen and kidney necrosis virus, comprising the infectious spleen and kidney necrosis virus strain of the first aspect of the present application.

[0020] In a fourth aspect of the present application, there is provided a method for preparing the active vaccine of the third aspect of the present application, comprising the following steps:

[0021] Inoculating the infectious spleen and kidney necrosis virus strain of the first aspect of the present application to a host cell, culturing, and collecting the virus liquid.

[0022] In some embodiments of the present application, the host cell comprises a mandarin fish cell.

[0023] In some embodiments of the present application, after collecting the virus culture and determining the TCID50, the vaccine is directly diluted with DMEM medium.

[0024] The present application has the following beneficial effects:

[0025] In the process of purchasing live mandarin fish experimental animals, the research team isolated a naturally gene-deleted ISKNV attenuated strain NH-1398B from the purchased mandarin fish. The genome of the strain is partially deleted at ORF102R and ORF104R, and completely deleted at ORF103R. The present application performs whole genome sequencing and virulence determination on the NH-1398B strain, and evaluates the immune protection effect thereof as an ISKNV vaccine. The results show that the ISKNV NH-1398B strain has the characteristics of safety, high efficiency, and low toxicity, and can be completely used for the immune prevention of infectious spleen and kidney necrosis virus disease. BRIEF DESCRIPTION OF DRAWINGS

[0026] The present application will be further described below in combination with the drawings and examples, in which:

[0027] Figure 1 PCR identification results of ISKNV NH-1398B

[0028] Figure 2 Figure 2 shows the results of the second amplification for ISKNV NH-1398B PCR identification.

[0029] Figure 3 Figure 3 shows a schematic diagram of the ISKNV NH-1398B gene deletion fragment.

[0030] Figure 4 Figure 4 shows the results of the pathogenicity evaluation of ISKNV NH-1398B.

[0031] Figure 5 Figure 5 shows the results of the live vaccine titer evaluation of ISKNV NH-1398B. DETAILED DESCRIPTION

[0032] The concept and the technical effects of the present application will be described below in conjunction with the embodiments so as to fully understand the objects, features and effects of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative effort fall within the scope of the present application.

[0033] Example 1 Purification and identification of infectious spleen and kidney necrosis virus gene deletion mutant virus

[0034] 1. Virus isolation

[0035] (1) Obtaining the sample: the sample was weighed, and then homogenized and ground in a ratio of 1 g:5 mL of phosphate buffered saline (PBS) by weight and volume. The sample was centrifuged at 4000 rpm for 10 min, and the supernatant was filtered with a 0.22 μm filter membrane.

[0036] (2) Sample inoculation: 100 μl of the supernatant was inoculated into MFF-1 cells that had grown into a monolayer in a culture dish, and normal cell controls were set up. After adsorption for 2 h in a 27℃ incubator containing 5% CO2, the culture solution was aspirated, and the cells were washed once with sterile PBS, then new DMEM culture solution was added, and the cells were cultured and observed in a 27℃ incubator containing 5% CO2 for 7 days. After about 80% of the cells showed cytopathic effect, the cells were frozen and thawed 3 times at -80℃.

[0037] (3) Virus purification: the collected sample was diluted 10-fold in DMEM culture medium to 10-10, and 10 -3 ~10 -108 dilutions of the diluted virus were inoculated into MFF-1 cells which had grown into a single layer in 96-well cell culture plates, 8 wells for each dilution, and 8 wells without inoculation as a control. The plates were incubated in a 27℃ incubator with 5% CO2 for 7 days. The cells in the control wells were normal and had no lesions. The culture medium was collected from the wells with the highest dilution and the highest number of lesions, which was the first purified virus.

[0038] The first purified virus was inoculated into MFF-1 cells which had grown into a single layer to propagate. When the cytopathic effect reached about 80%, the cells were frozen and thawed 3 times, and the supernatant was diluted 10 times with DMEM medium to obtain 8 dilutions. -10 The 8 dilutions were inoculated into MFF-1 cells which had grown into a single layer in 96-well cell culture plates, 8 wells for each dilution, and 8 wells without inoculation as a control. The plates were incubated in a 27℃ incubator with 5% CO2 for 7 days. The cells in the control wells were normal and had no lesions. The culture medium was collected from the wells with the highest dilution and the highest number of lesions, which was the first purified virus. -3 The 8 dilutions were inoculated into MFF-1 cells which had grown into a single layer in 96-well cell culture plates, 8 wells for each dilution, and 8 wells without inoculation as a control. The plates were incubated in a 27℃ incubator with 5% CO2 for 7 days. The cells in the control wells were normal and had no lesions. The culture medium was collected from the wells with the highest dilution and the highest number of lesions, which was the first purified virus. -10 8 dilutions of the diluted virus were inoculated into MFF-1 cells which had grown into a single layer in 96-well cell culture plates, 8 wells for each dilution, and 8 wells without inoculation as a control. The plates were incubated in a 27℃ incubator with 5% CO2 for 7 days. The cells in the control wells were normal and had no lesions. The culture medium was collected from the wells with the highest dilution and the highest number of lesions, which was the first purified virus.

[0039] The virus was purified once more according to the above steps, and the obtained virus was the third purified virus, which was named infectious spleen and kidney necrosis virus NH-1398B strain. The TCID 50 was determined, and the virus was stored at -80℃.

[0040] (4) Virus content determination: The virus liquid was diluted with DMEM containing 10% fetal bovine serum at a dilution ratio of 10 times, and 10 -1 to 10 -10 dilutions were selected and inoculated into MFF-1 cells which had grown into a single layer in 96-well cell culture plates, 8 wells for each dilution, and 8 wells without inoculation as a control. The plates were incubated in a 27℃ incubator with 5% CO2 for 7 days. The cells in the control wells were normal and had no lesions. The culture medium was collected from the wells with the highest dilution and the highest number of lesions, which was the first purified virus. 50 .

[0041] 2. Virus identification

[0042] (1) PCR identification

[0043] Primer design: According to the published ISKNV genome sequence (NC_003494.1), the nested PCR primers were designed as follows:

[0044] One primer: The amplified fragment size was 2534 bp.

[0045] F: 5'-AGACCATTGCGTTCACTCCA-3' (primer 1F, SEQ ID NO: 1).

[0046] R: 5'-TGCCTATGGCGATACGTCTT-3' (primer 1R, SEQ ID NO: 2).

[0047] Two pairs of primers: the size of the amplified fragment is 250 bp.

[0048] F: 5'-CATGGACACTGTCAGACAACTG-3' (primer 2F, SEQ ID NO: 3).

[0049] R: 5'-CAACAGGAGAAGGACCGATGA-3' (primer 2R, SEQ ID NO: 4).

[0050] (2) PCR amplification

[0051] Extract viral DNA as a template, and then use the above two pairs of primers for PCR amplification and electrophoresis detection.

[0052] The first amplification identification result of ISKNV NH-1398B PCR is shown in Figure 1 , and the second amplification identification result is shown in Figure 2 . It can be seen that the two amplifications can distinguish ISKNV NH-1398B from wild-type ISKNV virus.

[0053] (2) Sequence analysis

[0054] Referring to the ISKNV genome sequence published in GenBank, sequencing primers are designed to determine and analyze the sequence of the isolated virus.

[0055] The sequencing primers of the amplified fragment are F: 5'-ATGGCAGCAAACCAGACCATTG-3' (SEQ ID NO: 5) and R: 5'-CTAGGCAAAATAGACACGTTGCAACAG-3' (SEQ ID NO: 6), and the size of the amplified fragment is 1283 bp.

[0056] The sequence identification result is shown in Figure 3 . Compared with the reported infectious spleen and kidney necrosis virus genome (NC_003494.1), the natural gene deletion mutant strain loses 1398 bp (91059 bp to 92456 bp) in the genome, and the sequence of the amplified ISKNV NH-1398B is:

[0057] ATGGCAGCAAACCAGACCATTGCGTTCACTCCACGCCACCAACACTCCAATGGCAT

[0058] GCTCCAGCACGTCATCTTTTCAGACGGCACCTGGAAGTGTACCATCACCGGCATGGTGT

[0059] TTGTGACCACTGGGACTGTACATGTGATGTACCGTGTGGTTACTGTGCCGCCCATCAGTG

[0060] GAGTGCGATGTGCGCGATTTTGTGTCACTGCACGCTGGGGCGCGCTCAAGGCTGTCTTG

[0061] CTACCACGCACGTGCATGGGACCTGCCCACATGCTTCGTGTGACTGCTGCGGGTGTTAG

[0062] TGTGATACGGGCCGTTGGGGCCACTGAGGCGCACATGGCACTGGATGGTGATCTCATGG

[0063] AATGGGTGTGCGAACCGCCATACGTGCACAATCGGTGTACCATCGCTGTGGTGTATGGC

[0064] ACTGCGGACCAGCTGCACCTCGATTGCATGATGCCCTTGTATCTGAATATGGTTACTGAC

[0065] CCCAATAGGCCTGACGACGATGGCGTTACACCTCTGATGCACGCCATACGCAACAAGTG

[0066] TGCTTACGTCACCGAGAGGCTGCTGTACGCACACTGCGTGGATGTGACCGTGGCCGACA

[0067] ATCAAGGGCGTACCGCATTGCACTGGGCTGTGCTATGGGACCAAACTCTGGCTGGCGAG

[0068] CTGATGTCGCGCGGCGCCAGCGTCAACGTTGGTGGCACCTGCACCCCGATGGACATGAT

[0069] ATTTACGGGACCCGACAGCGGACACCGTGCTGCAATGGCGCCGACGCACTCAGCAGAC

[0070] TGCGCGCTTGCAGCGCCCTTGTAACTATATGCTATGACGAGTACATGTCTGTGTCGTACA

[0071] GTAACCGACATCTGTGTGCCGCACACCTGCGACGTGACATTCTATCCAAGCCATGCCTCT

[0072] TCAGGCAACGGGTGTGGTGCGAGTGTGTACGTGCTGACCATAGGCGTCTAATACAGCCA

[0073] CAGGGCAATGCGATAATGTATGTGGATATTGATGTCACAATAAACGGAGTGCCTCACAAG

[0074] TGGCCGTGTCAAGAGGGTGTCTATTTCTTTATGGCAGCGTCTTCACGGGTGTTGCAAGTG

[0075] ATGCCGGCTGAGTGCGACGTGCTGACATTGGATAACATACAGCAAGTGTTGACAATGTC

[0076] ACATGCAAGACGTATCGCCATAGGCACACCACGGGTCATCATGGTGGGATACAGTCACG

[0077] GCCACGTGTACGCCCGCGCTCGGGGTAGTACACACATTCGGCGACAGAAGGTCCTTAACCAGATGCTGCTAATACTGTTGCAACGTGTCTATTTTGCCTAG(SEQ ID NO: 7).

[0078] Therefore, it is named as Infectious spleen and kidney necrosis virus ISKNV NH-1398B (ISKNV NH-1398B Infectious spleen and kidney necrosis virus), and the strain of virus has been deposited in China Center for Type Culture Collection, No. 299, Bajilu, Wuchang District, Wuhan City, on January 16, 2025, with the accession number of CCTCC NO: V202508.

[0079] Example 2 Toxicity evaluation of NH-1398B strain

[0080] 1. Animal regression test

[0081] M. labeo inoculation test: 25 healthy M. labeo of 30-50 g were inoculated with the isolated infectious spleen and kidney necrosis virus NH-1398B strain, each with 100 μL (virus copy number 7.89 x 107copies / mL) injected into the abdominal cavity. At the same time, 25 tails of non-inoculated control group and 25 tails of positive control group injected with WT type ISKNV were set. The inoculation observation was carried out for 21 days, and the morbidity and mortality of M. labeo were recorded. 8

[0082] 2. Experimental results

[0083] The results are shown in Table 1. The ISKNV wild type virus group died completely on the 11th day, while the NH-1398B strain still had a survival rate of 76% on the 21st day, which was significantly lower in virulence compared with the wild type. Figure 4 Example 3 Preparation of injectable infectious spleen and kidney necrosis virus live vaccine (NH-1398B strain)

[0084] 1. Preparation of production virus: well-grown MFF-1 cells were inoculated with infectious spleen and kidney necrosis virus deletion mutant NH-1398B at MOI = 0.01, and placed in a 27°C incubator with 5% CO2. When about 80% of the cells appeared lesions, they were harvested. Freeze-thawed 3 times at -80°C, filtered with 0.22 μm filter membrane, quantitatively packaged, and marked with harvest date, virus generation number, etc., and stored at -80°C.

[0085] 2. Semi-finished product inspection

[0086] Sterility test: according to the current "Chinese Veterinary Pharmacopoeia" appendix, the test should be sterile growth.

[0087] Gene test: 200 μL of virus solution was extracted for DNA as a template, and primer 1F and primer 1R were used for the first PCR detection. The nucleic acid electrophoresis result should have only a band of 1136 bp size, and no band of 2534 bp size. Primer 2F and primer 2R were used for the second PCR detection, and the nucleic acid electrophoresis result should have no band of about 250 bp size.

[0088] 3. Dilution and packaging: the virus solution was diluted with DMEM medium to a suspension of ≥10 8 copies / mL, packaged with batch number, delivery date, and stored at -80°C for standby.

[0089] Example 4 Evaluation of the titer of injectable ISKNV NH-1398B live vaccine

[0090] 1. Vaccine quality inspection

[0091] 2. Vaccine titer test

[0092] ​The virus liquid of Example 3 was thawed and subjected to quality inspection.

[0093] Characteristics: The solution was clear and had no precipitate, and the color was red, which was the same as DMEM.

[0094] Sterile test: The test was performed according to the current Appendix of Chinese Veterinary Pharmacopoeia, and no sterile growth was observed.

[0095] Mycoplasma test: The test was performed according to the current Appendix of Chinese Veterinary Pharmacopoeia, and no mycoplasma growth was observed.

[0096] Virus gene identification: The gene identification PCR test method was used, 200 μl of virus liquid was extracted for DNA as a template, primer 1F and primer 1R were used for the first PCR detection, the nucleic acid electrophoresis result should have only a band of 1136 bp size, no band of 2534 bp size; primer 2F and primer 2R were used for the second PCR detection, and the nucleic acid electrophoresis result should have no band of about 250 bp size.

[0097] 2. Potency test

[0098] The vaccine with a virus copy number of 7.89 x 10 8 copies / mL was inoculated by intraperitoneal injection in 25 mandarin fish of about 30-50 g, 100 μL per fish, and a control group of 20 fish was set up. After 21 days of immunization, the surviving mandarin fish were intraperitoneally injected with infectious spleen and kidney necrosis virus (NH-2005 strain) together with the control group, 100 μL per fish, and the virus liquid had a copy number of 6.68 x 10 7 copies / mL, and the wild type virus was observed for 28 days after challenge.

[0099] The results are shown in Table 1. Figure 5 As shown in Table 1, all the control mandarin fish were sick and died on the 10th day, while all the immunized mandarin fish were protected.

Claims

1. A strain of infectious spleen and kidney necrosis virus, ISKNV NH-1398B, deposited with the China Center of Type Culture Collection, located at No. 299, Bajilu, Wuchang District, Wuhan City, on January 16, 2025, and assigned the accession number CCTCC NO: V202508.

2. Use of the strain of infectious spleen and kidney necrosis virus, ISKNV NH-1398B, of claim 1 in the preparation of a medicament for preventing and treating the infectious spleen and kidney necrosis virus of Siniperca chuatsi.

3. The use of claim 2, characterized in that: the medicament comprises a pharmaceutically acceptable excipient.

4. The use of claim 3, characterized in that: the medicament is a vaccine.

5. The live vaccine of claim 4, characterized in that: the live vaccine comprises the strain of infectious spleen and kidney necrosis virus, ISKNV NH-1398B, of claim 1.

6. A method for preparing the live vaccine of claim 5, characterized in that: the strain of infectious spleen and kidney necrosis virus, ISKNV NH-1398B, of claim 1 is inoculated into host cells, cultured, and the virus liquid is collected.

5. A live vaccine against infectious spleen and kidney necrosis virus, characterized in that, 7. The method of claim 6, characterized in that: the host cells comprise Siniperca chuatsi cells. ​ ​ ​ ​

Citation Information

Patent Citations

  • Infectious leenand kidney necrosis virus ORF022 gene deletion strain as well as preparation method and application thereof

    CN108220252A

  • Infectious spleen and kidney necrosis virus attenuated vaccine strain and application thereof

    CN118667774A