Lipaphis erysimi SIRT1 gene, application thereof and method for preventing and treating Lipaphis erysimi

Abstract

The invention relates to the field of insect prevention and control, in particular to a Lipaphis erysimi SIRT1 gene, application thereof and a Lipaphis erysimi prevention and control method. The gene encodes a protein with an amino acid sequence as shown in SEQ ID NO: 2. The effect of the SIRT1 gene in the lipaphis erysimi growth and development process is found, the death rate of lipaphis erysimi nymphs can be remarkably increased by inhibiting expression of the SIRT1, the proportion of winged aphids is remarkably reduced, and finally population development declines, and the virus transmission capacity is weakened. The RNA interference technology is used to find that the expression of the Lipaphis erysimi SIRT1 gene is inhibited, the nymph death rate of the Lipaphis erysimi is obviously increased, and the winged type ratio of the Lipaphis erysimi developed into imagoes is obviously reduced. In addition, dsRNA of a lipaphis erysimi SIRT1 gene interference sequence packaged by a nano material is sprayed, so that the death rate of lipaphis erysimi nymphs is remarkably increased.

Description

Technical Field

[0001] The present invention relates to the field of insect control, and particularly to the SIRT1 gene of Lipaphis erysimi, its application, and a method for controlling Lipaphis erysimi. Background Art

[0002] Lipaphis erysimi Kaltenbach belongs to the family Aphididae of the order Homoptera and is distributed throughout the country. Also known as the cabbage aphid and the turnip aphid, it often occurs mixed with the green peach aphid. It mainly harms cruciferous vegetables such as Chinese cabbage, radish, mustard, cabbage, cauliflower, and turnip, and has a preference for Chinese cabbage and mustard.

[0003] The technique of using in vitro synthesized double-stranded RNA (dsRNA) to inhibit the expression of specific genes in cells has characteristics such as specificity, high efficiency, position effect, ATP dependence, and transmissibility. RNAi induces gene silencing by introducing double-stranded RNA (dsRNA) into cells and has been widely used in pest control. Research shows that most agricultural pests exhibit a death phenotype after interfering with specific target genes, which provides the possibility of widely using dsRNA as an insecticide in the field.

[0004] The protein deacetylase SIRT1 is involved in various cellular functions and has been widely studied in recent years. It can affect nutrient and energy metabolism, aging, regulation of inflammation, circadian rhythm, and the occurrence of related diseases. SIRT1 has been studied more in tumors and plays an important role in various tumors.

[0005] Research shows that overexpression of SIRT1 in Drosophila can extend lifespan. After Sarcophaga bullata induces diapause, the acetylation level of its histone H3 decreases significantly. Paradoxically, the expression of genes such as SIRT1 and SIRT2 is downregulated; in Culex pipiens, FOXO, an important factor involved in the regulation of diapause, and its downstream target Pax are involved in the localization of Sirt1 / Sirt2 and related proteins that regulate lifespan extension. These studies indicate that SIRT1 may regulate the diapause process of insects. Currently, there is no report on the regulatory role of SIRT1 in the growth and development of Lipaphis erysimi and its wing type differentiation. Summary of the Invention

[0006] The purpose of the present invention is to provide an isolated SIRT1 gene of Lipaphis erysimi.

[0007] Another purpose of the present invention is to provide the application of the above-mentioned SIRT1 gene of Lipaphis erysimi.

[0008] Another purpose of the present invention is to provide a method for controlling Lipaphis erysimi.

[0009] The Lipaphis erysimi SIRT1 gene according to the present invention encodes a protein with an amino acid sequence as shown in SEQ ID NO: 2, encoding 585 amino acid residues.

[0010] The Lipaphis erysimi SIRT1 gene according to the present invention has a nucleotide sequence as shown in SEQ ID NO: 1, with a full length of 1758 bp.

[0011] SEQ ID NO: 1:

[0012] ATGCGTGCAATGGCGTCCGACGACAACGGTGACTTCGACACGGATCTCTCTGC

[0013] GGCACCAGCTAAACGCATGCGGTACTCGTTCGCCGATGAGATTGCCCAAAGTT

[0014] CGCATTTTGAAGCTTTTGGACAGCGATTCACCGGGTTCCCGTCCGGCGAATGTT

[0015] ACGCCAACAATTTGTACCAGCAATCATACAAATCTTTGGATACTCTATCACCAAA

[0016] TTATTTACAACCAAATTCACCAACTCCTCCATTAACAATGTCTTCAAGTTTACCT

[0017] GAATCTCCAGAAGACTCGAGTATATTTGACGAAAGTTCTGACACTAAAGAAGA

[0018] ACCTGAGGACGATGATTCAACTTCCACATCCAGTTCAGAATCCAGCACACATTC

[0019] TGAGAATGCAGATTCTGAAAAAGGAGTACCTGGTTCAATGAACTGGGTGCAGC

[0020] GACAAATTATGGGTGGTATTAATCCGAGACGTTTGTTACATCAAGTGTTTGGTGC

[0021] TTCTGTTCCATCTCAGTTAGAAGATATAACATTATGGAGGATAATCATGAGTATG

[0022] ACAGATGATTCTCCAATACGAAATCGTTTACGTAGTGTTAGTTCACTAGATGATG

[0023] TTGTTAGGTTATTGAAAACAAGCAATCGTATTATGGTTCTAACTGGAGCAGGTG

[0024] TCTCTGTTTCTTGTGGAATACCGGATTTTCGAAGTCATAATGGAGTTTATGCTAG

[0025] ACTAGCAACAGAATTTCCTGACTTACCTGATCCCCAATCTATGTTTTGTATAGATT

[0026] ATTTCACTAAAGACCCTAGGCCATTTTTTAAATTTGCTAGAGAAATTTATCCAGG

[0027] GCAATTTAAGCCATCACCATCCCACCAATTTATTAAACTCTTAGAAAAAAAAGG

[0028] ACGACTCTTACGTAATTACACTCAAAATATAGATACACTGGAACAAGTTGTTGG

[0029] TATCAATAATGTTATTGAATGTCATGGATCTTTTGCTACTGCATCATGTACTCAGT

[0030] GTGGACACAAAGTATCAGCAGAAACTATAAGACCTGATGTATTCGACCAACGA

[0031] ATTCCTCGTTGCCCAATATGTATCAATAGTACTGGTATTATGAAACCAGACATTGT

[0032] TTTTTTTGGAGAAGGTCTTCCAGACAGTTTCCATAAAGCAATTGAAGATGACAA

[0033] AAATAATTGTGATTTGTTGATAGTAATTGGATCGTCTTTGAAAGTTCGACCAGTG

[0034] GCTCGTATACCTAATATGTTGGACAAACATGTTCCACAAATATTAATAAACCGAG

[0035] AAAGACTTCCGCATATGAATTTTGATGTTGAACTTCTTGGTGACAGTGATGTTAT

[0036] CGTGGATCACCTCTGTCGCATGCTAGGTTCAGATTGGACTGAGCTATGCTGGTG

[0037] CAAAGAAGAGTTGACCGAAACTAAAACTTTAAATACTCCTATGTCATCACCAAG

[0038] GTCTAATGTTGCTATAAGTGAAACTGTGGAAGGTGAAATGTCTACTGAATCTAC

[0039] AAGAGATAGTGCTAACAGTATGTCACCACCACTTGGTGATGATAGGTTCACCCC

[0040] AGGTACTTCAGGCGAACAACGAAATTTATCAACAGACTCTACAAGAGATAGTG

[0041] GTATTGACCCAGATGATCCTCAAAAGTCTAGTTTAGCTGCGTATTTACCATTTAA

[0042] TAAATATTACATGTTGAAAAAAAGAAGGTACATGTTTTCTGGTGCAGAAGTAGA

[0043] TTTAAATGACATGAATGATGACAGTGAAACCGAATCAGACTCAAGTGAAAAATCTGAAACTCCGTTACAATAA。

[0044] SEQ ID NO:2

[0045] MRAMASDDNGDFDTDLSAAPAKRMRYSFADEIAQSSHFEAFGQRFTGFPSGECYANNLYQQSYKSLDTLSPNYLQPNSPTPPLTMSSSLPESPEDSSIFDESSDTKEEPEDDDSTSTSSSESSTHSENADSEKGVPGSMNWVQRQIMGGINPRRLLHQVFGASVPSQLEDITLWRIIMSMTDDSPIRNRLRSVSSLDDVVRLLKTSNRIMVLTGAGVSVSCGIPDFRSHNGVYARLATEFPDLPDPQSMFCIDYFTKDPRPFFKFAREIYPGQFKPSPSHQFIKLLEKKGRLLRNYTQNIDTLEQVVGINNVIECHGSFATASCTQCGHKVSAETIRPDVFDQRIPRCPICINSTGIMKPDIVFFGEGLPDSFHKAIEDDKNNCDLLIVIGSSLKVRPVARIPNMLDKHVPQILINRERLPHMNFDVELLGDSDVIVDHLCRMLGSDWTELCWCKEELTETKTLNTPMSSPRSNVAISETVEGEMSTESTRDSANSMSPPLGDDRFTPGTSGEQRNLSTDSTRDSGIDPDDPQKSSLAAYLPFNKYYMLKKRRYMFSGAEVDLNDMNDDSETESDSSEKSETPLQ。

[0046] According to the method for controlling Lipaphis erysimi of the present invention, dsRNA of the SIRT1 gene is synthesized using specific primers. By feeding Lipaphis erysimi dsRNA of the SIRT1 gene interference sequence, with a green fluorescent protein (GFP) control group, the gene expression level is detected by real-time fluorescence quantitative PCR after 72 hours of feeding, and the death situation of Lipaphis erysimi after 7 days of feeding is counted. The results show that this sequence can significantly inhibit the expression of the SIRT1 gene. Further research on the effect of silencing the SIRT1 gene on the growth and development of Lipaphis erysimi larvae shows that inhibiting the expression of the SIRT1 gene significantly increases the mortality rate of larvae and can inhibit the development of the population; at the same time, after silencing the expression of the SIRT1 gene, the proportion of winged forms of the emerged Lipaphis erysimi adults is significantly reduced, which can reduce the large-scale dispersal ability and the ability to transmit virus diseases of Lipaphis erysimi.

[0047] According to the method for controlling Lipaphis erysimi of the present invention, the sequences of the dsRNA specific primers are as follows:

[0048] Upstream primer dsSIRT1-F: 5'ATCAAGCTTGCGAATGTTACGCC3',

[0049] Downstream primer dsSIRT1-R: 5'CGCGGTACCGAATCATCTGTCATACTCATG3',

[0050] Upstream primer dsSIRT1-2F: 5'CGCAAGCTTCACTAAAGACCCTAGGC3',

[0051] Downstream primer dsSIRT1-2F: 5'ATAGGTACCCTGTCTGGAAGACCTT3'.

[0052] According to the method for controlling Lipaphis erysimi of the present invention, the gene silencing method of dripping dsRNA encapsulated by chitosan nanoparticles is used to target the SIRT1 gene. It is found that after dripping the dsRNA of the SIRT1 gene encapsulated by chitosan nanomaterials, the mortality rate of Lipaphis erysimi larvae is significantly increased, and the proportion of winged adults after eclosion is reduced, which has an adverse effect on the population development and large-scale spread of Lipaphis erysimi. The role of SIRT1 in the growth and development process of Lipaphis erysimi is verified for the first time. The SIRT1 gene can be used as an alternative gene for cultivating transgenic plants of Lipaphis erysimi, developing green and environmentally friendly insect-resistant plants, and can also be used as a target gene for spraying RNA biological pesticides to develop new biological pesticides, ultimately achieving the purpose of green pest control.

[0053] The positive and beneficial effects of the present invention:

[0054] (1) The present invention discovers for the first time that the SIRT1 gene is involved in the growth and development process of Lipaphis erysimi. The deletion of SIRT1 expression significantly increases the mortality rate of Lipaphis erysimi larvae and reduces the proportion of winged adults, ultimately inhibiting the population development and large-scale spread ability. This gene can be used to develop products for controlling insects of the genus Lipaphis in the Aphididae family.

[0055] (2) The present invention provides an interfering sequence of the SIRT1 gene of Lipaphis erysimi. This sequence can significantly inhibit the expression of the SIRT1 gene. The expression of the SIRT1 gene can be interfered with using this sequence to inhibit the growth of Lipaphis erysimi and reduce the proportion of winged aphids, ultimately controlling its population development and spread ability. It can be used to develop green and environmentally friendly insect-resistant plants, ultimately achieving the purpose of green pest control.

[0056] (3) Using genetic engineering technology, foreign genes can be introduced into a plant expression vector and then into plant cells to obtain insect-resistant transgenic cells and transgenic plants.

[0057] (4) By using genetic engineering techniques, dsRNA can be conjugated with chitosan nanomaterials to obtain a nano-carrier - dsRNA spray for controlling Lipaphis erysimi. Brief Description of the Drawings

[0058] Figure 1 Showing the silencing efficiency of the SIRT1 gene 72 h after feeding dsRNA of the SIRT1 gene interference sequence, where "*" represents p < 0.05, "dsSIRT1-1" represents the treatment group fed with dsRNA fragment 1 of the SIRT1 gene, "dsSIRT1-2" represents the treatment group fed with dsRNA fragment 2 of the SIRT1 gene, and "dsGFP" represents the control group fed with dsRNA of the GFP gene;

[0059] Figure 2 Showing the effect of feeding dsRNA of the SIRT1 gene interference sequence on the growth and development of Lipaphis erysimi, where "*" represents p < 0.05, "dsSIRT1-1" represents the treatment group fed with dsRNA fragment 1 of the SIRT1 gene, "dsSIRT1-2" represents the treatment group fed with dsRNA fragment 2 of the SIRT1 gene, and "dsGFP" represents the control group fed with dsRNA of the GFP gene;

[0060] Figure 3 Showing the effect of feeding dsRNA of the SIRT1 gene interference sequence on the proportion of winged adults after eclosion of Lipaphis erysimi, where "*" represents p < 0.05, "dsSIRT1-1" represents the treatment group fed with dsRNA fragment 1 of the SIRT1 gene, "dsSIRT1-2" represents the treatment group fed with dsRNA fragment 2 of the SIRT1 gene, and "dsGFP" represents the control group fed with dsRNA of the GFP gene;

[0061] Figure 4 Showing the effect of dripping dsRNA of the SIRT1 gene interference sequence encapsulated by chitosan nanomaterials on the growth and development of Lipaphis erysimi. Different lowercase letters in the figure indicate significant differences at the P = 0.05 level by Tukey's HSD multiple comparison. "DEPC + CS" represents the control group dripping chitosan nanomaterials, "dsGFP + CS" represents the control group dripping GFP gene dsRNA wrapped by chitosan nanomaterials, and "dsSIRT1-2 + CS" represents the treatment group dripping SIRT1 gene dsRNA fragment 2 wrapped by chitosan nanomaterials. Detailed Description of the Invention

[0062] The techniques used in the following examples, including molecular biology techniques such as RNA extraction, cDNA synthesis, PCR amplification and detection, and dsRNA synthesis, are all conventional techniques known to those skilled in the art unless otherwise specified. The instruments, equipment, reagents, etc. used are all available to those skilled in the art through public relations or commercial channels unless otherwise specified in this specification.

[0063] Example 1: Cloning and analysis of the SIRT1 gene of Lipaphis erysimi

[0064] Extract the RNA of the Lipaphis erysimi sample by the TRIzol method and store it at -80 °C. Use the kit to synthesize the cDNA template from the extracted total RNA (specific steps refer to the kit instruction manual). Design the primers as follows:

[0065] Forward primer SIRT1-1F: 5'TAAATAAACGCGGCGAAAGGGAA3';

[0066] Reverse primer SIRT1-1R: 5'TTTCTGCTGATACTTTGTGTCCACAC3';

[0067] Forward primer SIRT1-2F: 5'GCCATCACCATCCCACCAATT3';

[0068] Reverse primer SIRT1-2R: 5'CCCCATTAAAACATACAATAGTCAGT3';

[0069] Using the cDNA of Lipaphis erysimi as a template and the above primers, perform PCR amplification. After the amplification is completed, identify it by 1% agarose gel electrophoresis, and then purify and recover the target fragment. Connect the recovered product with the pEASY-Blunt vector, transform the recombinant vector into the competent cell T1, culture it overnight at 37 °C in the LB medium with ampicillin resistance, and screen the positive clones for sequencing. The sequencing results show that the sequence of the PCR amplification product is as shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO: 2. The results show that the open reading frame of the SIRT1 gene is 1758 bp in length, encoding 585 amino acid residues, with a predicted molecular mass of about 64 kDa and a theoretical isoelectric point of 4.55. Further compare its amino acid sequence with the SIRT1 amino acid sequences of other insects, and confirm that the protein isolated in the present invention has a typical conserved domain of the SIRT2 superfamily.

[0070] Example 2: dsRNA feeding interference experiment on the SIRT1 gene fragment of Lipaphis erysimi.

[0071] 1. Prokaryotic induction expression of dsRNA

[0072] (1) Preparation of dsRNA template

[0073] According to the SIRT1 gene sequence obtained in Example 1, specific amplification primers (with appropriate restriction enzyme sites added at the 5'-end) were designed for the amplification of two dsRNA fragments of the SIRT1 gene. The designed specific primers are as follows:

[0074] Forward primer dsSIRT1-F: 5' ATCAAGCTT GCGAATGTTACGCC3',

[0075] Reverse primer dsSIRT1-R: 5' CGCGGTACC GAATCATCTGTCATACTCATG3',

[0076] Forward primer dsSIRT1-2F: 5' CGCAAGCTT CACTAAAGACCCTAGGC3',

[0077] Reverse primer dsSIRT1-2F: 5' ATAGGTACC CTGTCTGGAAGACCTT3'.

[0078] Note: The underlined part is the restriction enzyme site and the protection base sequence.

[0079] Using the cDNA of Lipaphis erysimi as a template, PCR amplification was carried out with the above primers dsSIRT1-F + dsSIRT1-R and dsSIRT1-2F + dsSIRT1-2R. The PCR products were detected by 1.5% agarose gel electrophoresis, stained with ethidium bromide (EB), and the electrophoresis results were observed under ultraviolet light. The target fragments were cut out of the gel and purified and recovered using AxyGen's DNA Gel Extraction Kit. The PCR products were ligated to the pEASY-T vector. Subsequently, single colonies detected as positive by colony PCR were picked and sent for sequencing, and sequence alignment was used to verify their correctness.

[0080] (2) Construction of expression vector

[0081] The plasmid containing the target fragment was extracted and digested using AxyGen's AxyPrep PlasmidMiniprep kit. The reaction was carried out at 37 °C for 30 min and terminated by reacting at 95 °C for 5 s. The target fragment was cut out of the 1.5% agarose gel and recovered. The digested target fragment was ligated to the pET-2P vector.

[0082] Process of transforming the recombinant vector into competent cells HT115. Take 100 μL of the bacterial solution and evenly coat it on the LB medium plate containing Kan + and incubate it overnight at 37 °C in an inverted position. The next day, pick single colonies, in Kan +Expand the culture in LB liquid medium, store the fresh bacterial solution at -80 °C in 30% sterilized glycerol for later use.

[0083] (3) dsRNA induction expression

[0084] Take 100 μL of the above-mentioned bacterial solution from the verified correct bacterial solution according to a ratio of 1:100, inoculate it into 10 mL of LB liquid medium containing kanamycin, and culture it overnight at 200 rpm in a shaker at 37 °C for 12 - 14 h. According to a ratio of 1:100, inoculate the overnight-cultured bacterial solution into 1 L of LB liquid medium containing kanamycin, culture until the OD600 reaches 0.5 - 0.8, and take 1 mL of the bacterial solution as a detection control. Add 4 mL of 100 mM IPTG, continue to culture in a shaker at 37 °C for 4 h, and take 1 mL of the bacterial solution to detect the expression situation. Centrifuge the well-expressed bacterial solution at 5000 g for 10 min at 4 °C, discard the supernatant and retain the bacterial pellet precipitate, add 10 mL (1M CH 3 COONH 4 1 mM EDTA) to resuspend the bacterial pellet, and transfer it to a sterilized 50 mL centrifuge tube. Extract dsRNA with chloroform-isoamyl alcohol. Dilute 1 μL of dsRNA by 10 times, use 2 μL for detecting the concentration, and 2 μL for electrophoresis detection. If the electrophoretic band after digestion is a single bright band and the OD values are as follows: A260 / 280: 1.80 - 2.00; A260 / 230: 1.80 - 2.00, it indicates that the purified dsRNA has good quality and can be used as the dsRNA for feeding Lipaphis erysimi. Appropriately aliquot the purified dsRNA and store it at -80 °C for later use.

[0085] 2. dsRNA feeding interference of the SIRT1 gene fragment of Lipaphis erysimi.

[0086] The Lipaphis erysimi used for the bioassay is the second-instar nymph, which is reared on Chinese cabbage and radish. The specific rearing process is as follows:

[0087] The test insects used in the experiment are reared to at least the third generation under the same conditions before the experiment. First, transfer 3 - 5 Lipaphis erysimi adults onto Chinese cabbage plants. After 12 h of laying eggs, transfer the adults away, and retain 15 - 20 nymphs on each plant. When all the nymphs develop into adults, transfer them to fresh excised plant leaves to wait for egg-laying. After 12 h, transfer all the adults to another fresh excised leaf to wait for the next round of egg-laying. The nymphs produced in the previous round wait until they molt to the second instar for RNAi bioassay. The rearing of Lipaphis erysimi and the planting of plants are both carried out indoors, with a growth temperature of 24 ± 1 °C, a photoperiod of 16L - 8D, and a relative air humidity of 75 ± 5%.

[0088] Bioassay experimental device: The bioassay is carried out using a glass tube with a height of 30 mm, an outer diameter of 25 mm, and an inner diameter of 21 mm. One side of the glass tube is open as a "simulated plant leaf" M + artificial liquid diet + An M” feeding membrane was used to mix the dsRNA of the target gene into the artificial liquid diet in the middle layer. The amount of liquid artificial diet used in each tube was 300 μL for the test insects to feed on; on the other side was a 200-mesh breathable filter screen. The experiment set up a control group of dsGFP and an interference group. Each group had 5 tubes, with a density of 25 test insects per tube, and 300 μL of artificial liquid diet with a dsRNA concentration of 0.75 μg / μL was added to each tube. Fresh diet was replaced every 48 h during the interference period, dead test insects were removed and the number of dead insects was recorded. After 72 h of interference, a part of the interfered larvae was collected as a quantitative sample to detect the interference efficiency. After 7 days, the mortality rate and the proportion of winged forms of Lipaphis erysimi were counted. The experiment was repeated 3 times, and the statistical results of the data were analyzed for significant differences using an independent samples t-test.

[0089] 3. Detection of the silencing efficiency of the SIRT1 gene in Lipaphis erysimi.

[0090] The Lipaphis erysimi larvae after 72 h of feeding were collected respectively. After extracting RNA and reverse-transcribing it into cDNA, Premix ExTaq TM II and the Bio-Rad Detection iQ2 System were used to detect the silencing effect of the SIRT1 gene. The results of qRT-PCR showed that compared with the control group fed with dsGFP, both of the two dsRNA fragments of the SIRT1 gene could significantly inhibit the expression of SIRT1 in Lipaphis erysimi ( Figure 1 ). Thus, it can be seen that these two interference sequences of the SIRT1 gene in Lipaphis erysimi can significantly inhibit the expression of the SIRT1 gene.

[0091] 4. Statistics of the death situation of Lipaphis erysimi larvae after feeding dsRNA.

[0092] In the laboratory, the growth situation of Lipaphis erysimi was observed 7 days after the feeding treatment, and the mortality rate was counted. The results showed that compared with the control group of dsGFP, the mortality rate of Lipaphis erysimi in the treatment group fed with dsSIRT1-1 increased by about 27%, and the mortality rate of Lipaphis erysimi in the treatment group fed with dsSIRT1-2 increased by about 35% ( Figure 2 ). After inhibiting the expression of the SIRT1 gene, the mortality rate of Lipaphis erysimi larvae was significantly increased, which ultimately affected the growth and population development of Lipaphis erysimi. Therefore, the interference sequences provided by the present invention can be applied to the development of transgenic Lipaphis erysimi-resistant plants, develop green and environmentally friendly insect-resistant and virus-resistant plants, and achieve the purpose of green pest control.

[0093] 5. Statistics of the proportion of winged forms of Lipaphis erysimi adults after feeding dsRNA.

[0094] In the laboratory, the proportion of winged individuals of Lipaphis erysimi was counted after 7 days of feeding treatment. The results showed that compared with the control group of dsGFP, the proportion of winged individuals of Lipaphis erysimi in the treatment group fed with dsSIRT1-1 decreased by about 19%, and the proportion of winged individuals of Lipaphis erysimi in the treatment group fed with dsSIRT1-2 also decreased by about 19%( Figure 3 ). After inhibiting the expression of the SIRT1 gene, the proportion of winged individuals of adult Lipaphis erysimi was significantly reduced, which could ultimately affect the large-scale spread and virus transmission ability of Lipaphis erysimi. Therefore, the interfering sequences provided by the present invention can be applied to the development of transgenic plants resistant to Lipaphis erysimi, develop green and environmentally friendly insect-resistant and virus-resistant plants, and achieve the purpose of green pest control.

[0095] Example 3: Effects of spraying dsRNA of SIRT1 gene encapsulated in nanomaterials on the growth and development of Lipaphis erysimi.

[0096] 1. Preparation of dsRNA.

[0097] Prepare dsSIRT1-2 according to Example 2 and dilute the concentration to 20 μg / μL for standby.

[0098] 2. Dripping dsRNA of SIRT1 gene encapsulated in nanomaterials.

[0099] Dilute the dsRNA concentration to 20 μg / μL with DEPC water, mix the chitosan nanocarrier reagent with DEPC water and dsRNA at a ratio of 1:1, invert and mix well, and incubate at room temperature for 30 min. After diluting 1.5 times with DEPC water, use a pipette to aspirate 0.2 μL and drip it onto the dorsal plate of the 3rd instar Lipaphis erysimi. Replace the fresh radish leaves every day for Lipaphis erysimi to feed on, and observe the lethal effect continuously for 3 days. Pipette 30 individuals for each replicate and perform 4 replicates. The dripping treatments include three treatments: DEPC / CS, dsGFP / CS, and dsSIRT1-2 / CS. Statistical analysis was performed on the obtained data, and the data statistical analysis was completed by SPSS Statistic 27 software. The data was tested for significant differences in mean values using the Duncan test method of one-way analysis of variance, and the error bars represent the standard errors of independent biological replicates.

[0100] 3. Statistics on the death situation of Lipaphis erysimi larvae after dripping dsRNA of SIRT1 gene encapsulated in nanomaterials.

[0101] In the laboratory, the growth of Lipaphis erysimi was observed after 7 days of feeding treatment, and the mortality rate was counted. The results showed that compared with the DEPC / CS control group and the dsGFP / CS control group, the mortality rate of the treatment group sprayed with dsSIRT1 encapsulated in CS nanomaterials increased significantly, by about 31% and 20% respectively( Figure 4) This indicates that spraying dsRNA of SIRT1 gene encapsulated with chitosan nanomaterials significantly increases the mortality rate of Lipaphis erysimi larvae, inhibits their growth and development, and ultimately affects the development of the Lipaphis erysimi population. Therefore, the interfering sequence provided by the present invention can be applied to the development of spray-type RNA biological pesticides, create new pesticides, and achieve the goal of green pest control.

[0102] The present invention first discovers the role of the SIRT1 gene in the growth and development of Lipaphis erysimi. Inhibiting the expression of SIRT1 will significantly increase the mortality rate of Lipaphis erysimi larvae, reduce the proportion of winged Lipaphis erysimi, ultimately lead to the decline of population development, reduce the ability of large-scale diffusion and the ability to transmit virus diseases, provide new ideas for controlling the development of the Lipaphis erysimi population, and also provide a basis for achieving green control of Lipaphis erysimi and other Hemiptera insects. By using RNA interference technology, dsRNA of the SIRT1 gene of Lipaphis erysimi was synthesized, and then the dsRNA was introduced into the body of Lipaphis erysimi by the feeding method. It was found that inhibiting the expression of the SIRT1 gene of Lipaphis erysimi significantly increased the mortality rate of its larvae. In addition, by dripping dsRNA of the interfering sequence of the SIRT1 gene of Lipaphis erysimi encapsulated with chitosan nanomaterials, it was found that compared with the control group, dripping dsRNA wrapped with nanomaterials led to a significant increase in the mortality rate of Lipaphis erysimi larvae.

[0103] The above embodiments are only used to understand the technical solution of the present application and do not limit the protection scope of the present application.

Claims

1. Aphid radish SIRT1 gene, characterized in that The radish aphid SIRT1 gene encodes a protein with an amino acid sequence as shown in SEQ ID NO:

2.

2. The radish aphid SIRT1 gene according to claim 1, characterized in that The nucleotide sequence of the radish aphid SIRT1 gene is shown in SEQ ID NO:

1.

3. Use of the radish aphid SIRT1 gene according to claim 1 for controlling radish aphid.

4. A method for controlling radish aphids, characterized in that: The method comprises the step of interfering with the radish aphid SIRT1 gene of claim 1 in radish aphid.

5. The method for controlling radish aphids according to claim 4, characterized in that: The method comprises the step of feeding radish aphids with the dsRNA fragment of the radish aphid SIRT1 gene.

6. The method for controlling radish aphids according to claim 5, characterized in that: The dsRNA fragment of the radish aphid SIRT1 gene was obtained by amplifying the radish aphid cDNA with the following primer pair: Primer pair 1: includes the following primers: Upstream primer SIRT1-1F: 5'TAAATAAACGCGGCGAAAGGGAA3', Downstream primer SIRT1-1R: 5'TTTCTGCTGATACTTTGTGTCCACAC3'; or Primer pair 2: The following primers were included: Upstream primer SIRT1-2F: 5′GCCATCACCATCCCACCAATT3′; Downstream primer SIRT1-2R: 5'CCCCATTAAAACATACAATAGTCAGT3'.

7. The method for controlling radish aphids according to claim 4 or 5, characterized in that: The dsRNA fragment of the radish aphid SIRT1 gene is encapsulated in chitosan nanomaterials.

8. A method for reducing the proportion of winged radish aphid adults, characterized in that: The method comprises the step of interfering with the radish aphid SIRT1 gene of claim 1 in radish aphid.

9. The method for reducing the proportion of winged radish aphid adults according to claim 8, characterized in that: The method comprises the step of feeding radish aphids with the dsRNA fragment of the radish aphid SIRT1 gene.

10. The method for reducing the proportion of winged radish aphid adults according to claim 9, characterized in that: The dsRNA fragment of the radish aphid SIRT1 gene was obtained by amplifying the radish aphid cDNA with the following primer pair: Primer pair 1: includes the following primers: Upstream primer SIRT1-1F: 5'TAAATAAACGCGGCGAAAGGGAA3', Downstream primer SIRT1-1R: 5'TTTCTGCTGATACTTTGTGTCCACAC3'; or Primer pair 2: The following primers were included: Upstream primer SIRT1-2F: 5′GCCATCACCATCCCACCAATT3′; Downstream primer SIRT1-2R: 5'CCCCATTAAAACATACAATAGTCAGT3'.

Images