An efficient circular RNA preparation method and its application

Abstract

The present invention discloses an efficient method for preparing circular RNA and its application, relating to the field of biotechnology. The preparation method includes preparing a transcription vector for circular RNA, wherein the transcription vector includes the following structural elements: a promoter, a cyclization sequence-3' intron / exon, a target sequence, a cyclization sequence-5' intron / exon, and a linearization restriction enzyme cleavage site; the cyclization sequence-3' intron / exon sequence is selected from any one of SEQ ID NOs: 2, 3, and 7, and the cyclization sequence-5' intron / exon sequence is selected from any one of SEQ ID NOs: 5, 6, and 9. The preparation method of circular RNA provided by the present invention improves the circularization ratio of circular RNA and improves the efficiency of circular RNA preparation.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an efficient circular RNA preparation method and application thereof. Background Art

[0002] Circular RNA (circular RNA) is a class of single-stranded RNA characterized by its covalently closed topological structure. Due to its prevalence in eukaryotic cells and its potential biological functions, circular RNA has attracted widespread attention. Like linear mRNA, circRNAs possess coding potential. Furthermore, their lack of free ends required for nuclease-mediated degradation makes them resistant to various RNA degradation mechanisms, resulting in a longer lifespan than linear mRNA. Therefore, circularization may help stabilize mRNAs, which typically have short half-lives, thereby enhancing the overall efficacy of exogenous mRNA in various applications.

[0003] In vitro synthesis of circRNAs typically requires the synthesis of a linear RNA precursor, followed by ligation of its ends to form a covalently closed circle. This process can be achieved through a variety of chemical and enzymatic methods. Ribozymes are RNAs capable of performing the catalytic actions of typical proteases. The use of certain ribozyme sequences constitutes a common strategy for in vitro production of circRNAs. The most common of these methods relies on the autocatalytic activity of group I introns, naturally present in rRNA, tRNA, and mRNA genes of bacteria and non-metazoan eukaryotes. Group I introns are capable of self-splicing without the assistance of the spliceosome or other proteins, relying instead on magnesium ions and a free guanine nucleotide (GTP) to initiate the splicing reaction in vivo. This process results in the ligation of flanking exons and the circularization of the central intron, generating intronic circRNAs.

[0004] By exploiting the self-splicing properties of group I introns, the intron and exon sequences at either end can be replaced and placed on either side of the target sequence to be circularized, thereby artificially synthesizing a circularized sequence. This sequence replacement method is called permuted intron-exon exchange (PIE). Puttaraju and Been (1992) first used PIE sequence design to synthesize circRNAs in vitro from a group I intron of the leucine tRNA precursor (pre-tRNA-Leu) of the cyanobacterium Anabaena. The 5' portion of the pre-tRNA intron was transferred to the tail of the tRNA exon, while the remaining 3' portion of the intron was placed at the head of the same exon. Linear RNA prepared using this replaced DNA template spontaneously circularized under appropriate conditions to produce exon-specific circular RNAs. Ford and Ares replicated this strategy by replacing the intron of the thymidylate synthase (td) gene of bacteriophage T4 and successfully circularized the td exon. The replaced td gene of bacteriophage T4 and the pre-tRNA gene of cyanobacterium Anabaena have become the basic exon-intron sequences widely used for the in vitro preparation of circRNA.

[0005] Limitations of current methods for synthesizing circRNAs include:

[0006] 1. The efficiency of circRNA synthesis catalyzed by the original sequence is low: Although the PIE method can effectively produce simple circRNAs in vitro, for longer and more complex sequences, the sequence itself may cause changes in the original intron and exon structures, thereby reducing the spontaneous circularization efficiency of circRNA and thus reducing the yield.

[0007] 2. Residual fragments: Exonic fragments at the junction site may be incorporated into newly synthesized circRNAs, limiting the design of circRNAs and triggering additional immune responses.

[0008] Based on this, it is necessary to provide a method for preparing circular RNA with higher efficiency. Summary of the Invention

[0009] The purpose of the present invention is to provide an efficient method for preparing circular RNA and its application.

[0010] In order to achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows:

[0011] In one aspect, the present invention provides a method for preparing circular RNA, comprising preparing a transcription vector for the circular RNA, wherein the transcription vector comprises the following structural elements:

[0012] Promoter, cyclization sequence-3' intron / exon, target sequence, cyclization sequence-5' intron / exon, linearization restriction site;

[0013] The cyclization sequence-3' intron / exon sequence is selected from any one of (1) to (3):

[0014] (1) The sequence shown in SEQ ID NO: 2; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 2;

[0015] (2) The sequence shown in SEQ ID NO: 3; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 3;

[0016] (3) The sequence shown in SEQ ID NO: 7; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 7;

[0017] The cyclization sequence-5' intron / exon sequence is selected from any one of (4) to (6):

[0018] (4) The sequence shown in SEQ ID NO: 5; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 5;

[0019] (5) The sequence shown in SEQ ID NO: 6; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 6;

[0020] (6) The sequence shown in SEQ ID NO: 9; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 9.

[0021] Specifically, the cyclization sequence-3' intron / exon and the cyclization sequence-5' intron / exon are randomly paired.

[0022] According to some embodiments of the present invention, the cyclization sequence-3' intron / exon sequence is shown as SEQ ID NO: 2, and the cyclization sequence-5' intron / exon sequence is shown as SEQ ID NO: 5.

[0023] According to some embodiments of the present invention, the cyclization sequence-3' intron / exon sequence is shown as SEQ ID NO: 3, and the cyclization sequence-5' intron / exon sequence is shown as SEQ ID NO: 6.

[0024] According to some embodiments of the present invention, the cyclization sequence-3' intron / exon sequence is shown as SEQ ID NO: 7, and the cyclization sequence-5' intron / exon sequence is shown as SEQ ID NO: 9.

[0025] According to some embodiments of the present invention, the transcription vector of circular RNA comprises the following structural elements:

[0026] Promoter, homology arm sequence A, cyclization sequence-3' intron / exon, target sequence, cyclization sequence-5' intron / exon, homology arm sequence D, linearization restriction site;

[0027] The homology arm sequence A is selected from any one of (1) to (4):

[0028] (1) The sequence shown in SEQ ID NO: 11; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 11;

[0029] (2) The sequence shown in SEQ ID NO: 12; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 12;

[0030] (3) The sequence shown in SEQ ID NO: 13; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 13;

[0031] (4) The sequence shown in SEQ ID NO: 14; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 14;

[0032] The homology arm sequence D is selected from any one of (5) to (9):

[0033] (5) The sequence shown in SEQ ID NO: 16; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 16;

[0034] (6) The sequence shown in SEQ ID NO: 17; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 17;

[0035] (7) The sequence shown in SEQ ID NO: 18; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 18;

[0036] (8) The sequence shown in SEQ ID NO: 19; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 19;

[0037] (9) The sequence shown in SEQ ID NO: 20; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 20.

[0038] Specifically, homology arm sequence A and homology arm sequence D are randomly paired.

[0039] According to some embodiments of the present invention, the homology arm sequence A is shown as SEQ ID NO:11, and the homology arm sequence D is shown as SEQ ID NO:16.

[0040] According to some embodiments of the present invention, the homology arm sequence A is shown as SEQ ID NO: 12, and the homology arm sequence D is shown as SEQ ID NO: 17.

[0041] According to some embodiments of the present invention, the homology arm sequence A is shown as SEQ ID NO: 12, and the homology arm sequence D is shown as SEQ ID NO: 18.

[0042] According to some embodiments of the present invention, the homology arm sequence A is shown as SEQ ID NO: 13, and the homology arm sequence D is shown as SEQ ID NO: 19.

[0043] According to some embodiments of the present invention, the homology arm sequence A is shown as SEQ ID NO: 14, and the homology arm sequence D is shown as SEQ ID NO: 20.

[0044] According to some embodiments of the present invention, the transcription vector of circular RNA comprises the following structural elements:

[0045] Promoter, cyclization sequence-3' intron / exon, homology arm sequence B, target sequence, homology arm sequence C, cyclization sequence-5' intron / exon, linearization restriction site;

[0046] The homology arm sequence B is selected from any one of (1) to (4):

[0047] (1) The sequence shown in SEQ ID NO: 22; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 22;

[0048] (2) The sequence shown in SEQ ID NO: 23; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 23;

[0049] (3) The sequence shown in SEQ ID NO: 24; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 24;

[0050] (4) The sequence shown in SEQ ID NO: 25; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 25;

[0051] The homology arm sequence C is selected from any one of (5) to (9):

[0052] (5) The sequence shown in SEQ ID NO: 26; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 26;

[0053] (6) The sequence shown in SEQ ID NO: 27; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 27;

[0054] (7) The sequence shown in SEQ ID NO: 28; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 28;

[0055] (8) The sequence shown in SEQ ID NO: 29; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 29;

[0056] (9) The sequence shown in SEQ ID NO: 30; or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 30.

[0057] Specifically, homology arm sequence B and homology arm sequence C are randomly paired.

[0058] According to some embodiments of the present invention, the homology arm sequence B is shown as SEQ ID NO: 22, and the homology arm sequence C is shown as SEQ ID NO: 26.

[0059] According to some embodiments of the present invention, the homology arm sequence B is shown as SEQ ID NO: 23, and the homology arm sequence C is shown as SEQ ID NO: 27.

[0060] According to some embodiments of the present invention, the homology arm sequence B is shown as SEQ ID NO: 24, and the homology arm sequence C is shown as SEQ ID NO: 28.

[0061] According to some embodiments of the present invention, the homology arm sequence B is shown as SEQ ID NO: 25, and the homology arm sequence C is shown as SEQ ID NO: 29.

[0062] According to some embodiments of the present invention, the homology arm sequence B is shown as SEQ ID NO: 25, and the homology arm sequence C is shown as SEQ ID NO: 30.

[0063] According to some embodiments of the present invention, the transcription vector of circular RNA comprises the following structural elements:

[0064] Promoter, homology arm sequence A, cyclization sequence-3' intron / exon, homology arm sequence B, target sequence, homology arm sequence C, cyclization sequence-5' intron / exon, homology arm sequence D, linearization restriction site.

[0065] Preferably, the homology arm sequence A is shown as SEQ ID NO: 11, the homology arm sequence D is shown as SEQ ID NO: 16, the homology arm sequence B is shown as SEQ ID NO: 24, and the homology arm sequence C is shown as SEQ ID NO: 28.

[0066] Specifically, the method for preparing circular RNA is to perform an in vitro cyclization reaction on the above-mentioned circular RNA transcription vector to obtain circular RNA.

[0067] According to some embodiments of the present invention, the method for preparing circular RNA comprises the following steps:

[0068] (1) Prepare a circular RNA transcription vector, transform the transcription vector into E. coli cells, amplify the E. coli cells, and extract the plasmid;

[0069] (2) Preparation of DNA template;

[0070] (3) Preparation of linear RNA by in vitro transcription;

[0071] (4) Incubate the linear RNA at 60-80°C, add GTP solution and cyclization buffer, mix well, incubate at 40-60°C, add LiCl solution and precipitate, take the precipitated RNA, centrifuge and discard the supernatant, and purify the circular RNA.

[0072] Specifically, the vector described in step (1) is a pUC57 plasmid.

[0073] Specifically, step (1) further comprises amplifying the sequence shown in any one of SEQ ID NO: 36 to SEQ ID NO: 52, and then enzymatically cutting and inserting the sequence into the EcoRI and HindIII restriction sites of the pUC57 vector.

[0074] Specifically, step (2) of preparing the DNA template includes the following steps:

[0075] 1) Inoculate a single E. coli clone into LB medium and extract and purify the plasmid DNA;

[0076] 2) Incubate the purified plasmid DNA with restriction endonucleases in a buffered solution at 37°C for 1-16 hours.

[0077] 3) When the linearization ratio is 90%-100%, use DNA purification spin columns to purify the enzyme digestion product.

[0078] Specifically, step (3) in vitro transcription to prepare linear RNA includes the following steps:

[0079] 1) Prepare a reaction system with purified linearized plasmid DNA template, polymerase, transcription buffer, GTP, ATP, CTP, UTP, RNAse inhibitor, pyrophosphatase, and water. Incubate the reaction system at 37°C for 1.5-3 hours.

[0080] 2) After the reaction is complete, add DNase I, mix, and incubate at 37°C for 15-30 minutes.

[0081] 3) After the reaction is complete, add LiCl solution, mix well, and place at -20°C for precipitation for 1-24 hours;

[0082] 4) Remove the precipitated RNA and centrifuge at 4°C, 13,000 rpm for 30-60 min. Discard the supernatant, wash the precipitate, and centrifuge at 4°C, 13,000 rpm for 10 min.

[0083] 5) Discard the supernatant, dry the precipitate, and add water to dissolve the RNA precipitate.

[0084] Preferably, step (4) is to incubate the linear RNA at 75°C for 5 minutes and then transfer it to ice for incubation for 5 minutes.

[0085] Preferably, the concentration of the GTP solution in step (4) is 10 mM;

[0086] Preferably, the volume ratio of the GTP solution to the cyclization buffer in step (4) is 2:1.

[0087] Preferably, the cyclization buffer in step (4) is: 500 mM Tris-HCl, 100 mM MgCl2, pH 7.5.

[0088] Preferably, in step (4), GTP solution and cyclization buffer are added, mixed, and then incubated at 55° C. for 8-15 minutes.

[0089] Preferably, after adding the LiCl solution in step (4), the mixture is placed under -20°C for precipitation for 1-24 hours.

[0090] Preferably, the centrifugation conditions after removing the precipitated RNA in step (4) are 4°C and 13,000 rpm for 30-60 min.

[0091] In another aspect, the present invention provides a circular RNA, which is prepared by the above-mentioned preparation method.

[0092] In another aspect, the present invention provides use of the aforementioned circular RNA in preparing a drug.

[0093] The beneficial effects of the present invention are:

[0094] (1) The present invention significantly shortens the residual sequence in the final prepared circRNA by deleting and modifying the original sequence of the thymidylate synthase (td) gene of T4 phage.

[0095] (2) The present invention improves the circularization ratio of circRNA and the efficiency of circRNA preparation by designing and adding auxiliary sequence elements near intron and exon sequences. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] Figure 1 Schematic diagram of the design of DNA transcription vector sequence elements for preparing circRNA.

[0097] Figure 2 This is a formaldehyde agarose gel image of a circRNA (V1) prepared using a transcription vector closest to the original circularization sequence. The insert fragment is CVB3 IRES-EGFP CDS. The circularization sequences are Circularization Sequence-3' Intron / Exon SEQ ID NO:1 and Circularization Sequence-5' Intron / Exon SEQ ID NO:4. Orange arrows indicate the positions of circRNA bands, and blue arrows indicate the positions of linear RNA bands. Lane 1 shows the circularized reaction product, which shows a major band and multiple secondary bands. The reaction product was identified by treatment with RNase R for 15 or 30 minutes. RNase R can digest linear RNAs but has low activity against circular RNAs. The major band significantly weakened, indicating that it is likely a linear RNA. The secondary band showed no significant decrease in brightness, indicating that it is a circular RNA. The target sequence (SEQ ID NO:32) was circularized using the circularization sequence closest to the original circularization sequence and with the least truncation. The proportion of circRNA in the product was very low.

[0098] Figure 3This is a formaldehyde agarose gel image. After truncating the circularization sequence, the proportion of circRNA produced by the new transcription vector was significantly increased. The buffer group represents the circularization reaction product without RNase R treatment, while the RNase R group represents the circularization reaction product after RNase R treatment. Yellow arrows indicate the location of the circRNA band. In V2 (circularization sequence-3' intron / exon SEQ ID NO: 2 and circularization sequence-5' intron / exon SEQ ID NO: 5), the linear RNA and circRNA bands are of similar brightness, indicating an increased circularization rate. In V4 (circularization sequence-3' intron / exon SEQ ID NO: 3 and circularization sequence-5' intron / exon SEQ ID NO: 6), only the circRNA band is visible, indicating that the primary product in the reaction has become a circular RNA.

[0099] Figure 4 This is a formaldehyde agarose gel image. Adding a short auxiliary sequence to the truncated circularization sequence can also increase the proportion of circRNA. The buffer group shows the circularization reaction product without RNase R treatment, while the RNase R group shows the circularization reaction product after RNase R treatment. Yellow arrows indicate the location of circRNA bands. The circularization rate of V5 (Circularization Sequence-3' Intron / Exon SEQ ID NO:7 and Circularization Sequence-5' Intron / Exon SEQ ID NO:9) is essentially the same as that of V4. However, V7 (Circularization Sequence-3' Intron / Exon SEQ ID NO:8 and Circularization Sequence-5' Intron / Exon SEQ ID NO:10) lacks a clear circRNA band, indicating unsuccessful circularization.

[0100] Figure 5 This is a formaldehyde agarose gel image. Replacing the circularized target fragment with a longer fragment (SEQ ID NO: 33) reduced the circularization efficiency of the V4 vector. IVT represents the in vitro transcription product, Re-circ represents the circularization reaction product, the Buffer group represents the circularization reaction product without RNase R treatment, and the RNase R group represents the circularization reaction product after RNase R treatment. Orange arrows indicate the location of circRNA bands, and blue arrows indicate the location of linear RNA bands. It can be seen that circular RNA accounts for approximately 50%.

[0101] Figure 6 For formaldehyde agarose gel, follow Figure 1Adding inner homology arm sequence B between the cyclization sequence-3' intron / exon sequence (SEQ ID NO:3) and the target fragment to be circularized, and adding inner homology arm sequence C between the cyclization sequence-5' intron / exon sequence (SEQ ID NO:6) and the target fragment to be circularized, can significantly increase the circularization rate of long fragments. V9-V13 are combinations of different outer homology arm sequences. V9 is a combination of homology arm sequence B SEQ ID NO:22 and homology arm sequence C SEQ ID NO:26; V10 is a combination of homology arm sequence B SEQ ID NO:23 and homology arm sequence C SEQ ID NO:27; V11 is a combination of homology arm sequence B SEQ ID NO:24 and homology arm sequence C SEQ ID NO:28; V12 is a combination of homology arm sequence B SEQ ID NO:25 and homology arm sequence C SEQ ID NO:29; and V13 is a combination of homology arm sequence B SEQ ID NO:25 and homology arm sequence C SEQ ID NO:30. IVT is the in vitro transcription product, Re-circ is the circularization reaction product, and the RNase R group is the circularization reaction product treated with RNase R. Orange arrows indicate the position of circRNA bands, and blue arrows indicate the position of linear RNA bands. The proportion of circular RNA increased after adding the internal homology arm sequence.

[0102] Figure 7 For formaldehyde agarose gel, follow Figure 1Adding an outer homology arm sequence A between the circularization sequence-3' intron / exon sequence (SEQ ID NO:3) and the T7 promoter, and adding an outer homology arm sequence D between the circularization sequence-5' intron / exon sequence (SEQ ID NO:6) and the linearization restriction site, can also significantly increase the circularization rate of long fragments. V14-V19 are combinations of different outer homology arm sequences. V14 is a combination of homology arm sequence A SEQ ID NO:11 and homology arm sequence D SEQ ID NO:16; V15 is a combination of homology arm sequence A SEQ ID NO:12 and homology arm sequence D SEQ ID NO:17; V16 is a combination of homology arm sequence A SEQ ID NO:12 and homology arm sequence D SEQ ID NO:18; V17 is a combination of homology arm sequence A SEQ ID NO:13 and homology arm sequence D SEQ ID NO:19; V18 is a combination of homology arm sequence A SEQ ID NO:14 and homology arm sequence D SEQ ID NO:20; and V19 is a combination of homology arm sequence A SEQ ID NO:15 and homology arm sequence D SEQ ID NO:21. Circularization reaction products without (-) and with (+) RNase R treatment. It can be seen that, except for V19, all other combinations can effectively produce circRNA.

[0103] Figure 8 For formaldehyde agarose gel, follow Figure 1 The display position of the PCR product is simultaneously increased by adding inner and outer homology arm sequences (A / B / C / D). The cyclization sequence-3' intron / exon sequence is shown in SEQ ID NO:3, the cyclization sequence-5' intron / exon sequence is shown in SEQ ID NO:6, and the homology arm sequence A is SEQ ID NO:11, homology arm sequence B is SEQ ID NO:24, homology arm sequence C is SEQ ID NO:28, and homology arm sequence D is SEQ ID NO:16. This allows for the cyclization of a longer target fragment (SEQ ID NO:34). IVT represents the in vitro transcription product, Re-circ represents the cyclization reaction product, and the RNase R group represents the cyclization reaction product after RNase R treatment. DETAILED DESCRIPTION

[0104] In order to make the technical means, creative features, purpose and efficacy of the present invention easy to understand, the present invention is further illustrated below in conjunction with specific examples, but the following examples are only preferred embodiments of the present invention, not all. Based on the examples in the implementation manner, other embodiments obtained by those skilled in the art without making creative work are all within the scope of protection of the present invention. In the following examples, unless otherwise specified, the operating methods used are all conventional operating methods, the equipment used are all conventional equipment, and the equipment and materials used in each embodiment are all the same.

[0105] Example 1

[0106] 1. Design transcription vector sequence

[0107] Schematic diagram of the design of DNA transcription vector sequence elements of circRNA Figure 1 shown.

[0108] 1) The intron and exon sequences were truncated and modified based on the original sequence of the thymidylate synthase (td) gene of T4 phage.

[0109] Partial original sequence of the thymidylate synthase (td) gene of T4 phage (SEQ ID NO: 31):

[0110]

[0111] The original sequence was split and truncated into 3' intron-exon and 5' intron-exon sequences:

[0112] Cyclization sequence-3' intron / exon SEQ ID NO: 1:

[0113] Tgattgtgcagcagatgcagctagacattttaaaatttcgtctggattagttactttcgtgtaaaatctgataaatggaattggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaa gttggagatatagtctgctctgcatggtgacatgcagctggatataattccggggtaagattaacgaccttatctgaacataatgctaccgtttaatattgcgtcatatgctacgttagttcatattgtagctaagatgtgtaatcttattccaggggatttgat.

[0114] Cyclization sequence-3' intron / exon SEQ ID NO: 2:

[0115] Ggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacatgcagctgga tataattccggggtaagattaacgaccttatctgaacataatgctaccgtttaatattgcgtcatatgctacgttagttcatattgtagctaagatgtgtaatcttattccaggggatttgat.

[0116] Cyclization sequence-3' intron / exon SEQ ID NO: 3:

[0117] Ggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacatgcagctggatataattccggggtaagattaacgaccttatctgaacataatgctac。

[0118] Circularization sequence - 5' intron / exon SEQ ID NO:4:

[0119] Atatgttctatcagtttaatgtgcgtaatggctatttggatttgcagtggtatcaacgctcagtagatgttttcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggacttgccctttaataaatacttctatatttaaagaggtatttatgaaaagcggaatttatcagattaaaaatactttaaacaataaagtatatgtaggaagtgctaaagattttgaaaagagatggaagaggcattttaaagatttagaaaaaggatgcc。

[0120] Circularization sequence - 5' intron / exon SEQ ID NO:5:

[0121] Atatgttctatcagtttaatgtgcgtaatggctatttggatttgcagtggtatcaacgctcagtagatgttttcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggact。

[0122] Circularization sequence - 5' intron / exon SEQ ID NO:6:

[0123] Atatgttctcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggact.

[0124] Based on the above truncated sequence cyclization sequence-3' intron / exon SEQ ID NO: 3 and cyclization sequence-5' intron / exon SEQ ID NO: 6, auxiliary element sequences are added in the middle of the sequences, and the auxiliary sequences are shown in capital letters.

[0125] Cyclization sequence-3' intron / exon SEQ ID NO:7:

[0126] ggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacatgcagctggatataattccggggtaagattaacgaccttatctGGAGGCTGCGAGCTTATACTCgaacataatgctac.

[0127] Cyclization sequence-3' intron / exon SEQ ID NO:8:

[0128] ggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacatgcagctggatataattccggggtaagattaacgaccttatctGGAGGCTGCGAGC.

[0129] Cyclization sequence-5' intron / exon SEQ ID NO:9:

[0130] tatgttcGAGTATAAGCTCGCAGCCTCCtcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggact.

[0131] Cyclization sequence-5' intron / exon SEQ ID NO: 10:

[0132] GCTCGCAGCCTCCtcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggact.

[0133] The above different 3' intron / exon and 5' intron / exon sequences are arranged in different pairs according to Figure 1 It is indicated that they are placed on both sides of the target sequence.

[0134] 2) Design outer homology arm sequences A and D

[0135] Design different homology arm sequences to assist circularization:

[0136] Homology arm sequence A SEQ ID NO: 11: GGAGGCTGCGAGCTTATACTC.

[0137] Homology arm sequence A SEQ ID NO: 12: GGAATTGCTGGTTGAAA.

[0138] Homology arm sequence A SEQ ID NO: 13: ATCCTTATGCACGGGAATTGCTGGTTGAAA.

[0139] Homology arm sequence A SEQ ID NO: 14:

[0140] AAGCCTCCAAGCTGTGCCTTGGGGGCTTTGGGGCATGGACA.

[0141] Homology arm sequence A SEQ ID NO: 15: GGAGGCTTTGGGGCATGGACA.

[0142] Homology arm sequence D SEQ ID NO: 16: GAGTATAAGCTCGCAGCCTCC.

[0143] Homology arm sequence D SEQ ID NO: 17:

[0144] TGATCAGCAGTTCCCCTGCATAAGGATGAACCGATCCTTATGCAC.

[0145] Homology arm sequence D SEQ ID NO: 18: TGATCAGCAGTTCCCC.

[0146] Homology arm sequence D SEQ ID NO: 19: TGATCAGCAGTTCCCCTGCATAAGGATG.

[0147] Homology arm sequence D SEQ ID NO: 20: TGTTCATGTCCTA.

[0148] Homology arm sequence D SEQ ID NO: 21: TGTTCATGTCCTACTGTTCAAGCCTCC.

[0149] The above-mentioned different homology arm sequences A and homology arm sequences D are paired in different combinations. Figure 1 Schematically placed upstream of the 3' intron / exon and downstream of the 5' intron / exon respectively.

[0150] 3) Design of medial homology arm sequences B and C

[0151] Homology arm sequence B SEQ ID NO:22:

[0152] AAGCCTCCAAGCTGTGCCTTGGGGGCTTTGGGGCATGGACA.

[0153] Homology arm sequence B SEQ ID NO: 23: CTTGGGGGCTTTGGGGCATGGACA.

[0154] Homology arm sequence B SEQ ID NO: 24: ATCCTTATGCACGGGAATTGCTGGTTGAAA.

[0155] Homology arm sequence B SEQ ID NO: 25: CGGGAATTGCTGGTTGAAA.

[0156] Homology arm sequence C SEQ ID NO: 26: TGTTCATGTCCTA.

[0157] Homology arm sequence C SEQ ID NO: 27: TGTTCATGTCCTACTGTTCAAGCCTCCAAG.

[0158] Homology arm sequence C SEQ ID NO: 28: TGATCAGCAGTTCCCCTGCATAAGGATG.

[0159] Homology arm sequence C SEQ ID NO: 29: TGATCAGCAGTTCCCC.

[0160] Homology arm sequence C SEQ ID NO:30:

[0161] TGATCAGCAGTTCCCCTGCATAAGGATGAACCGATCCTTATGCAC.

[0162] The above-mentioned different homology arm sequences B and homology arm sequences C are paired in different combinations. Figure 1 It is indicated that they are placed immediately upstream and downstream of the target sequence, respectively.

[0163] The target sequence CVB3 IRES-EGFP is shown in SEQ ID NO: 32:

[0164]

[0165] The target sequence CVB3 IRES-Fluc is shown in SEQ ID NO: 33:

[0166]

[0167] The target sequence CVB3 IRES-Fluc-P2A-EGFP is shown in SEQ ID NO: 34:

[0168]

[0169] The target sequence CVB3 IRES-Rluc is shown in SEQ ID NO: 35:

[0170]

[0171] 4) The cyclization sequence-3' intron / exon and cyclization sequence-5' intron / exon in the above sequence are necessary functional elements and must be placed upstream and downstream of the target sequence.

[0172] The outer homology arms A and D and the inner homology arms B and C are non-essential auxiliary elements and are selected and placed in pairs according to the specific situation. Figure 1 The positions shown may have only lateral or medial, or both medial and lateral auxiliary sequences placed.

[0173] 5) Prepare and synthesize the corresponding transcription vector plasmid based on the designed sequence, transform it into E. coli cells, amplify the cells, and extract the plasmid. The vector is pUC57. The following fragments are amplified and then digested and inserted between the EcoRI and HindIII restriction sites of the pUC57 vector.

[0174] The target sequence of V1-V7 is CVB3 IRES-EGFP SEQ ID NO: 32, the target sequence of V9-V13 is CVB3IRES-Fluc SEQ ID NO: 33, the target sequence of V14-V19 is CVB3 IRES-Rluc SEQ ID NO: 35, and the target sequence of V20 is CVB3 IRES-Fluc-P2A-EGFP SEQ ID NO: 34.

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192] The insert sequences of V1-V20 were all inserted into the same site of the pUC57 vector.

[0193] 2. Preparation of DNA template

[0194] 1) The correctly sequenced E. coli single clone was inoculated into 15-20 ml LB medium, and the plasmid DNA was extracted and purified using an endotoxin-free plasmid miniprep kit (Tiangen Bio, DP118).

[0195] 2) Pre-designed restriction enzyme sites should be unique on the plasmid. Incubate 15-25 μg of purified plasmid DNA with 1.5 μl of XbaI (NEB) restriction enzyme in 1x rCutsmart buffer at 37°C for 1 to 16 hours. This step can be performed with more than just XbaI restriction enzymes.

[0196] 3) After the enzyme digestion time is reached, take 0.1 μg of the digested plasmid and use a standard agarose gel to test the linearization ratio of the DNA after digestion. When the linearization ratio is close to 90-100%, purify the digested product using the EZNA® Gel Extraction Kit (Omega-Biotek, D2500-02) DNA purification spin column.

[0197] 3. Preparation of linear RNA by in vitro transcription

[0198] 1) Prepare a 20-ul reaction system by mixing 1 μg of purified, linearized plasmid DNA template with 2 μl of T7 polymerase (Novagen), 2 μl of 10x transcription buffer (Novagen), 1.5 μl of 100 mM GTP, 1.5 μl of 100 mM ATP, 1.5 μl of 100 mM CTP, 1.5 μl of 100 mM UTP, 0.5 μl of RNAse inhibitor (40 U / μl, Novagen), 0.04 μl of pyrophosphatase (0.1 U / μl, Novagen), and enzyme-free deionized water (Tiangen Biotechnology). Incubate the system at 37°C for 1.5 to 3 hours. The reaction volume in this step is not limited to 20 μl and can be scaled up from 20 μl to 1 ml depending on specific needs.

[0199] 2) At the end of the reaction, add 1 μl of DNase I (Novozymes) to the 20 μl reaction volume, mix, and incubate at 37°C for 15 to 30 minutes. Increase the volume of DNase I proportionally to the size of the reaction.

[0200] 3) After the reaction is complete, add 10.5 μl of 8 M LiCl solution (Coolex) to the 21 μl reaction volume. Mix thoroughly and place in a -20°C refrigerator to settle for 1 to 24 hours. The time for settling at -20°C can be adjusted from 1 to 96 hours depending on the specific needs. Increase the volume of 8 M LiCl solution proportionally based on the reaction system.

[0201] 4) Remove the RNA pellet from the -20°C precipitate and centrifuge at 13,000 rpm at 4°C for 30 to 60 minutes. Remove the tube, discard the supernatant, and rinse the RNA pellet with a 75% ethanol-water solution. Centrifuge again at 13,000 rpm at 4°C for 10 minutes.

[0202] 5) Discard the supernatant, aspirate any remaining solution, air-dry the precipitate, and dissolve the RNA in enzyme-free deionized water. Assess RNA concentration and purity using a spectrophotometer.

[0203] 6) Prepare a 1-1.2% formaldehyde agarose gel to detect RNA size and integrity.

[0204] 4. CircRNA Preparation

[0205] 1) Prepare 25 μg of purified linear RNA by adding enzyme-free deionized water to a 35 μl aliquot. Incubate in a 75°C metal bath for 5 minutes, then quickly transfer to ice and incubate for 5 minutes.

[0206] 2) Add 10 μl of 10 mM GTP solution and 5 μl of 10x cyclization buffer (500 mM Tris-HCl, 100 mM MgCl2, pH 7.5) to the above system, mix well, and transfer to a 55°C metal bath for incubation for 8 to 15 minutes.

[0207] 3) Remove the centrifuge tube and return to room temperature. Add 25 μl of 8M LiCl solution (Cooler) to the system, mix well, and place in a -20°C refrigerator to precipitate for 1 to 24 hours.

[0208] 4) Remove the RNA pellet from the -20°C precipitate and centrifuge at 13,000 rpm at 4°C for 30 to 60 minutes. Remove the tube, discard the supernatant, and rinse the RNA pellet with a 75% ethanol-water solution. Centrifuge again at 13,000 rpm at 4°C for 10 minutes.

[0209] 5) Discard the supernatant, aspirate any remaining solution, air-dry the precipitate, and dissolve the RNA in enzyme-free deionized water. Assess RNA concentration and purity using a spectrophotometer.

[0210] 6) Mix 1-2 μg of purified circRNA with 0.5-1U RNase R (Biyuntian), 1 μl of 10x RNase R reaction buffer (0.2 M Tris-HCl pH 8.0, 1 M KCl, and 1 mM MgCl2), and enzyme-free deionized water to create a 10 μl reaction volume. Incubate the reaction at 37°C for 10-30 minutes, then remove and place on ice.

[0211] 7) Prepare 1-1.2% formaldehyde agarose gel to detect the size and ratio of purified circRNA and circRNA after RNase R treatment, and estimate the circularization ratio.

[0212] 5 Experimental Results

[0213] By appropriately truncating and optimizing the 3'-intron / exon and 5'-intron / exon sequences of the original circularization sequence, the circularization ratio of circular RNA was significantly improved. At the same time, because the exon sequence was greatly shortened, the residual exon sequence in the final circRNA was also significantly shortened ( Figure 2-Figure 4 ).

[0214] from Figure 2 As can be seen, when the circRNA prepared by using the transcription vector closest to the original cyclization sequence, the insertion fragment CVB3 IRES-EGFP CDS, and the cyclization sequence are cyclization sequence-3' intron / exon SEQ ID NO: 1 and cyclization sequence-5' intron / exon SEQ ID NO: 4, the cyclization sequence closest to the original cyclization sequence and with the least truncation is used to cyclize the target sequence, and the proportion of circRNA in the product is low.

[0215] from Figure 3 As can be seen, the linear RNA and circRNA bands of V2 (cyclization sequence-3' intron / exon SEQ ID NO: 2 and cyclization sequence-5' intron / exon SEQ ID NO: 5) are of similar brightness, indicating that the cyclization rate has increased; in V4 (cyclization sequence-3' intron / exon SEQ ID NO: 3 and cyclization sequence-5' intron / exon SEQ ID NO: 6), only circRNA bands are visible, indicating that the main product in the reaction has become circular RNA.

[0216] from Figure 4As can be seen from the figure, the circularization rate of V5 (circularization sequence-3' intron / exon SEQ ID NO:7 and circularization sequence-5' intron / exon SEQ ID NO:9) is basically the same as that of V4; while V7 (circularization sequence-3' intron / exon SEQ ID NO:8 and circularization sequence-5' intron / exon SEQ ID NO:10) has no obvious circRNA bands.

[0217] from Figure 5 It can be seen that when the circularization target fragment is replaced with a longer fragment, the circularization effect of the V4 vector decreases, and the proportion of circular RNA is about 50%.

[0218] from Figure 6 It can be seen that increasing the inner homology arm sequence (B / C) can significantly increase the circularization ratio of long fragments.

[0219] from Figure 7 It can be seen that increasing the outer homology arm sequence (A / D) can also significantly increase the circularization ratio of long fragments.

[0220] from Figure 8 It can be seen that by adding both inner and outer homology arm sequences (A / B / C / D) at the same time, longer target fragments can be circularized.

[0221] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for preparing circular RNA, characterized in that: The invention relates to a transcription vector for preparing circular RNA, wherein the transcription vector comprises the following structural elements: Promoter, homology arm sequence A, cyclization sequence-3' intron / exon, homology arm sequence B, target sequence, homology arm sequence C, cyclization sequence-5' intron / exon, homology arm sequence D, linearization restriction site; The cyclization sequence-3' intron / exon sequence is shown in SEQ ID NO: 3, and the cyclization sequence-5' intron / exon sequence is shown in SEQ ID NO: 6; The homology arm sequence A is shown as SEQ ID NO: 11, the homology arm sequence D is shown as SEQ ID NO: 16, the homology arm sequence B is shown as SEQ ID NO: 24, and the homology arm sequence C is shown as SEQ ID NO:

28.

2. The preparation method according to claim 1, characterized in that The target sequence is selected from the sequence shown in any one of SEQ ID NO:32-SEQ ID NO:

35.

3. The preparation method according to claim 1, characterized in that The circular RNA transcription vector according to claim 1 is subjected to an in vitro circularization reaction to obtain the circular RNA.

4. The preparation method according to claim 3, characterized in that The following steps are involved: (1) Prepare a circular RNA transcription vector, transform the transcription vector into E. coli cells, amplify the E. coli cells, and extract the plasmid; (2) Preparation of DNA template; (3) Preparation of linear RNA by in vitro transcription; (4) Incubate the linear RNA at 60-80°C, add GTP solution and cyclization buffer, mix well, incubate at 40-60°C, add LiCl solution and precipitate, take the precipitated RNA, centrifuge and discard the supernatant, and purify the circular RNA.

5. The preparation method according to claim 4, characterized in that The vector described in step (1) is the pUC57 plasmid.

6. The preparation method according to claim 4, characterized in that Step (1) further comprises amplifying the sequence shown in SEQ ID NO: 52 and then enzymatically cutting and inserting it between the EcoRI and HindIII restriction sites of the pUC57 vector.

7. The preparation method according to claim 4, characterized in that Step (2) preparing the DNA template includes the following steps: 1) Inoculate a single E. coli colony into the culture medium and extract and purify the plasmid DNA; 2) Incubate the purified plasmid DNA with restriction endonucleases in a buffered solution at 35-38°C for 1-16 hours. 3) When the linearization ratio is 90%-100%, use DNA purification spin columns to purify the enzyme digestion product.

8. The preparation method according to claim 4, characterized in that Step (3) in vitro transcription to prepare linear RNA includes the following steps: 1) Prepare a reaction system with purified linearized plasmid DNA template, polymerase, transcription buffer, GTP, ATP, CTP, UTP, RNAse inhibitor, pyrophosphatase, and water. Incubate the reaction system at 35-38°C for 1.5-3 hours. 2) After the reaction is complete, add DNase I, mix, and incubate at 35-38°C for 15-30 minutes. 3) After the reaction is completed, add LiCl solution, mix well and let it settle for 1-24 hours; 4) Remove the precipitated RNA, centrifuge and discard the supernatant, wash the precipitate, and centrifuge again; 5) Discard the supernatant, dry the precipitate, and add water to dissolve the RNA precipitate.

9. The circular RNA prepared by the preparation method according to any one of claims 1 to 8.

10. Use of the circular RNA according to claim 9 in preparing a medicine.

Images