A mutant promoter and its uses

Abstract

The present invention provides a mutant promoter and its uses. Specifically, the present invention constructs a variant promoter library using error-prone PCR technology. After multiple rounds of screening and enrichment, a promoter variant with significantly improved expression efficiency compared to the parental promoter is obtained. The transcriptional activity of the promoter variant of the present invention is greatly enhanced and can maintain high transcriptional activity for a long time in various tissues and cells. The promoter of the present invention provides a better choice for the development of gene therapy drug expression cassettes.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine. Specifically, the present invention relates to a mutant promoter and its uses. Background Art

[0002] As an important regulatory element on the DNA sequence, the promoter contains the most core regulatory information for gene expression and is an important component of the expression vector. Therefore, the development and utilization of efficient and specific promoters have important research significance and application value for gene therapy. Promoters can be classified into three categories according to their action modes and functions: constitutive promoters, tissue-specific promoters, and inducible promoters.

[0003] Among them, constitutive promoters can be divided into strong broad-spectrum promoters and weak broad-spectrum promoters. A strong broad-spectrum promoter refers to a promoter that can drive the transcription process and has a wide range of gene regulatory capabilities. It can not only produce efficient gene expression in different cell types but also regulate the expression of multiple related genes. Strong broad-spectrum promoters can be used in the field of gene therapy to help patients restore or enhance the expression of specific genes, thereby treating some genetic diseases. In gene editing technology, strong broad-spectrum promoters can be used as regulatory sequences to help achieve precise editing and modification of specific genes. In biomedical research, strong broad-spectrum promoters can be used to study the functions and regulatory mechanisms of genes, providing important bases for new drug development and disease treatment.

[0004] Currently, strong broad-spectrum promoters include CMV, CAG, CBH, etc., all of which are used in gene therapy clinical research. Among them, since CMV is derived from the HCMV virus, the strong immunogenicity of the promoter and its easy silencing have gradually withdrawn from the field of vision. The expression intensities of CAG and CBH are close to that of CMV, but the immune responses caused by high GC have not been significantly alleviated, and at the same time, there is a risk of recombination and loss of the core sequence of the promoter. Therefore, it is necessary to mutate and transform the existing promoters to meet the requirements of gene therapy drug development.

[0005] The prior art provides improved promoters, which are composed of an enhancer sDTS and a promoter (preferably the EF1a promoter) operably linked to the enhancer. It is known that gene expression mediated by the EF1α core promoter is relatively stable and not significantly affected by changes in the intracellular and extracellular environments, and can provide a relatively long-lasting effect for gene therapy. For example, in gene therapy for chronic diseases, long-term stable gene expression is crucial for maintaining the therapeutic effect. The EF1α promoter can achieve a high level of gene transcription and translation, ensuring that the therapeutic gene can produce a sufficient amount of protein products to play a role. Taking tumor gene therapy as an example, a high level of gene expression helps to enhance the therapeutic effect, such as inhibiting tumor growth or promoting tumor cell apoptosis. The sequence of the EF1α human promoter itself is relatively less likely to cause an immune response in the host, reducing the risk of treatment failure due to immune rejection. The chimeric promoters formed by the prior art can efficiently express foreign proteins in T cells.

[0006] However, the prior art only improves the transcriptional activity of chimeric promoters through the combination of enhancers and promoters, and there is still a need in the art to screen promoters with stronger transcriptional activity. Summary of the Invention

[0007] An object of the present invention is to provide a mutant promoter and its use.

[0008] In a first aspect of the present invention, there is provided an isolated promoter, characterized in that the promoter has nucleotide mutations selected from the group consisting of with respect to the sequence shown in SEQ ID NO: 1:

[0009] 1) At position 61: G → A;

[0010] 2) At position 365: A → G;

[0011] 3) At position 512: A → T;

[0012] 4) At position 744: C → T;

[0013] 5) At position 745: T → C;

[0014] 6) At position 877: C → A;

[0015] 7) At position 1024: T → C;

[0016] 8) At position 1124: A → G;

[0017] 9) Any combination of 1)-8) above.

[0018] In another preferred embodiment, with respect to the sequence shown in SEQ ID NO: 1, the A at position 365 of the promoter is mutated to G.

[0019] In another preferred embodiment, the promoter has the following nucleotide mutations relative to the sequence shown in SEQ ID NO: 1:

[0020] Position 365: A→G;

[0021] Position 877: C→A;

[0022] Position 1024: T→C; and

[0023] Position 1124: A→G.

[0024] In another preferred embodiment, the promoter has the following nucleotide mutations relative to the sequence shown in SEQ ID NO: 1:

[0025] Position 61: G→A;

[0026] Position 365: A→G;

[0027] Position 512: A→T;

[0028] Position 744: C→T;

[0029] Position 745: T→C;

[0030] Position 877: C→A;

[0031] Position 1024: T→C; and

[0032] Position 1124: A→G.

[0033] In another preferred embodiment, the promoter has the following nucleotide mutations relative to the sequence shown in SEQ ID NO: 1:

[0034] Position 61: G→A;

[0035] Position 365: A→G;

[0036] Position 512: A→T;

[0037] Position 877: C→A;

[0038] Position 1024: T→C; and

[0039] Position 1124: A→G.

[0040] In another preferred embodiment, the promoter has the following nucleotide mutations relative to the sequence shown in SEQ ID NO: 1:

[0041] Position 61: G → A;

[0042] Position 365: A → G;

[0043] Position 744: C → T;

[0044] Position 745: T → C;

[0045] Position 877: C → A;

[0046] Position 1024: T → C; and

[0047] Position 1124: A → G.

[0048] In another preferred example, the promoter has the following nucleotide mutations relative to the sequence shown in SEQ ID NO: 1:

[0049] Position 365: A → G;

[0050] Position 512: A → T;

[0051] Position 744: C → T;

[0052] Position 745: T → C;

[0053] Position 877: C → A;

[0054] Position 1024: T → C; and

[0055] Position 1124: A → G.

[0056] In another preferred example, in addition to the above mutations, the enhancer, core promoter, and intron region nucleotides of the promoter are the same as the sequence shown in SEQ ID NO: 1.

[0057] In another preferred example, in addition to the above mutations, the remaining nucleotides of the promoter are the same as the sequence shown in SEQ ID NO: 1.

[0058] In another preferred example, the promoter has a nucleotide sequence selected from the following group:

[0059] (a) The nucleotide sequence shown in SEQ ID NO.:3;

[0060] (b) A nucleotide sequence having a homology ≥ 95% (preferably ≥ 98%, more preferably ≥ 99%) with the sequence shown in SEQ ID NO.:3 and having transcriptional up / downstream DNA fragment activity;

[0061] (c) adding and / or deleting 1 - 50 (preferably 1 - 10, more preferably 1 - 5) nucleotides at the 5' end and / or 3' end of SEQ ID NO.: 3, and having transcriptional upstream / downstream DNA fragment activity nucleotide sequence.

[0062] In another preferred embodiment, the ratio (E1 / E0) of the gene expression efficiency (E1) mediated by the promoter to the gene expression efficiency (E0) mediated by the promoter shown in SEQ ID NO: 1 is ≥ 1.5, preferably ≥ 2, more preferably ≥ 5.

[0063] In another preferred embodiment, the gene expression efficiency is the expression efficiency in brain, liver, lung, heart, spleen, and kidney tissues.

[0064] In the second aspect of the present invention, there is provided an expression cassette, which contains the promoter as described in the first aspect of the present invention, and a target gene operably linked to the promoter element.

[0065] In another preferred embodiment, the target gene is a selection marker gene, a protein gene, an RNAi gene, a microRNA gene, or a combination thereof.

[0066] In another preferred embodiment, the target gene is a gene related to ophthalmic diseases.

[0067] In another preferred embodiment, the target gene encodes a protein for treating ophthalmic diseases.

[0068] In another preferred embodiment, the expression cassette further comprises one or more elements selected from the group consisting of: poly(A) element, transport element, gene targeting element.

[0069] In the third aspect of the present invention, there is provided a vector, which contains the expression cassette as described in the second aspect of the present invention.

[0070] In another preferred embodiment, the vector is selected from the group consisting of: DNA, RNA, plasmid, lentiviral vector, adenoviral vector, adeno-associated viral vector, retroviral vector, transposon, or a combination thereof.

[0071] In another preferred embodiment, the vector is an adeno-associated viral vector.

[0072] In the fourth aspect of the present invention, there is provided a host cell, which contains the vector as described in the third aspect of the present invention, or its chromosome integrates an exogenous promoter as described in the first aspect of the present invention, or its chromosome integrates an expression cassette as described in the second aspect of the present invention.

[0073] In another preferred embodiment, the chromosome of the host cell has one or more (such as 1 - 50, preferably 2 - 6) copies of the expression cassette as described in the second aspect of the present invention.

[0074] In the fifth aspect of the present invention, there is provided a pharmaceutical composition, which contains the vector as described in the third aspect of the present invention, or the host cell as described in the fourth aspect of the present invention, and a pharmaceutically acceptable carrier, diluent or excipient.

[0075] In another preferred embodiment, the preparation is a liquid preparation.

[0076] In another preferred embodiment, the dosage form of the preparation is an injection.

[0077] In the sixth aspect of the present invention, there is provided the use of the vector as described in the third aspect of the present invention, or the host cell as described in the fourth aspect of the present invention, for preparing a drug or preparation for preventing and / or treating a disease.

[0078] In the seventh aspect of the present invention, there is provided a method for treating a disease, which includes administering an effective amount of the vector as described in the third aspect of the present invention, or the host cell as described in the fourth aspect of the present invention, or the pharmaceutical composition as described in the fifth aspect of the present invention to an object in need of treatment.

[0079] It should be understood that within the scope of the present invention, the above-mentioned various technical features of the present invention and the various technical features specifically described below (such as in the examples) can be combined with each other, so as to form new or preferred technical solutions. Due to space limitations, they will not be elaborated one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] The following drawings are used to illustrate the specific implementation manners of the present invention, rather than to limit the scope of the present invention defined by the claims.

[0081] Figure 1 Shows the ratio of cDNA to DNA counts calculated by sequencing after transfection of 293T cells with promoter library plasmids.

[0082] Figure 2 Shows the structure of the rAAV vector expression cassette with the mScarlet transgene (a), the expression intensities of the promoters C84 - S1 and C84 detected after vector transfection of cells (b), and fluorescence imaging (c).

[0083] Figure 3 Shows the expression intensities of the target genes of the promoters C84 - S1 and C84 in RGC5 cells, ARPE19 cells, and SY5Y cells.

[0084] Figure 4Shows the comparison of the transduction activities of promoters C84-S1 and C84 in human retinal organoids.

[0085] Figure 5 Shows the expression intensity of fluorescence signals of promoters C84-S1 and C84 in mice and in various organs.

[0086] Figure 6 Shows the mutation positions of the C84-S1 promoter variant compared to the C84 promoter.

[0087] Figure 7 Shows the structures (a), fluorescence images after transfection of the corresponding plasmids (b), and average fluorescence intensities (c) of promoters C84-S2, C84-S3, C84-S4, and C84-S5 obtained by performing back mutations on the C84-S1 promoter.

[0088] Figure 8 Shows the structure of promoter C84-S6 containing a single-point mutation at position 365.

[0089] Figure 9 Shows the results of fluorescence microscopy observations after transduction of cells with promoters C84-S6 and C84.

[0090] Figure 10 Shows the comparison of the fluorescence intensities after transduction of cells with promoters C84-S6 and C84. Detailed implementation

[0091] The inventors of the present invention have, through extensive and in-depth research, developed for the first time a mutant promoter and its uses. Specifically, the present invention constructed a random mutant library of promoters with a diversity of up to 5E7 by performing error-prone PCR on the full-length promoter sequence, and combined drug screening (puromycin) and flow sorting methods to perform directed evolution on the promoter library, respectively screening out promoter variants with increased and decreased expression intensities compared to the parental strain, and then evaluating and identifying them in vitro and in vivo. Finally, candidate mutants with a significantly upregulated mRNA transcription activity by dozens of times and a decreased transcription activity were obtained. The strong promoters of the present invention have been verified for the effectiveness of transcription activity in different cell lines, retinal organoids, and model animal tissues. On this basis, the present invention was completed.

[0092] Terms

[0093] To facilitate a better understanding of the present invention, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, as such methods and conditions may vary. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to be limiting, and the scope of the present invention will be limited only by the appended claims.

[0094] As used herein, when referring to a specifically recited numerical value, the term "about" means that the value can vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0095] As used herein, the terms "comprising", "including", "containing" are used interchangeably and include not only closed definitions but also semi - closed and open definitions. In other words, the said terms include "consisting of" and "consisting essentially of".

[0096] As used herein, the terms "transduction", "transfection", "transformation" are processes by which an exogenous polynucleotide is delivered into a host cell and transcribed and translated to produce a polypeptide product, including introducing an exogenous polynucleotide into a host cell (e.g., Escherichia coli) using a plasmid molecule.

[0097] As used herein, the term "gene expression" or "expression" refers to the process by which a gene is transcribed, translated, and post - translationally modified to produce an RNA or protein product of the gene.

[0098] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxynucleotides (DNA), ribonucleotides (RNA), their hybrid sequences, and analogs. Polynucleotides may include modified nucleotides, such as methylated or capped nucleotides or nucleotide analogs. The term polynucleotide as used herein refers interchangeably to single - stranded and double - stranded molecules. Unless otherwise specified, the polynucleotides in any of the embodiments described herein include double - stranded forms and the two complementary single - strands that are known or predictable to form the double - stranded form.

[0099] As used herein, the components of the term "pharmaceutically acceptable carrier" refer to substances that are suitable for use in humans and / or animals without undue adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., substances having a reasonable benefit / risk ratio.

[0100] As used herein, the term "therapeutically effective amount" refers to an amount that produces a function or activity in a human and / or animal and is acceptable to the human and / or animal. Those of ordinary skill in the art should understand that the "therapeutically effective amount" may vary depending on factors such as the form of the pharmaceutical composition, the route of administration, the excipients of the drug used, the severity of the disease, and the combination with other drugs.

[0101] Promoter

[0102] As used herein, the term "promoter" refers to a nucleic acid sequence that accurately and effectively initiates gene transcription, which guides the transcription of the gene nucleic acid sequence into mRNA and is usually present upstream (end) of the coding sequence of the target gene. The promoter or promoter region generally provides recognition sites for RNA polymerase and other factors necessary for correct initiation of transcription.

[0103] As used herein, the term "constitutive promoter" refers to a promoter under the control of which the expression of the structural gene is generally constant at a certain level and there is no significant difference in the expression level in different tissues and parts.

[0104] As used herein, the term "inducible promoter" refers to a promoter that can significantly increase the transcription level of a gene under the stimulation of certain specific physical or chemical signals.

[0105] In the present invention, a mutant library of the EF1a promoter was constructed by random mutagenesis technology, and highly active mutants were screened through a directed evolution process. Specifically, the error-prone PCR (EP-PCR) technology was used to introduce random mutations into the promoter to construct a promoter library containing numerous different mutations. After these mutant promoters were transfected into cells, the cells were screened according to the strength of the fluorescence protein expression driven by them, and the dominant mutant promoters were enriched through multiple rounds of screening. By sequencing and analyzing the mutants obtained by screening, calculating the counts ratio of mRNA to DNA, the mutant with the strongest positive screening expression intensity (C84-S1, with a 36-fold increase in transcription level) was determined.

[0106] Furthermore, the present invention analyzed the mutation sites of the mutant promoter C84-S1 with a significantly increased expression intensity and found that the mutation at position 61 was located in the CMV enhancer region, the mutations at positions 365 and 512 were located in the EF-1α core promoter region, and the mutations at positions 744 and 745 were located in the intron region. It was predicted that these sites generated new cis-acting elements, which might have a positive impact on the expression ability of the promoter. Through reverse mutation, the influence law of the mutations of different elements of the promoter on the transcriptional activity was evaluated.

[0107] Based on the above screening, the enhanced promoter described in the first aspect of the present invention is provided.

[0108] Expression cassette

[0109] The present invention provides an expression cassette having the promoter element and the target gene ORF sequence as described in the first aspect of the present invention.

[0110] The promoter of the present invention can be used to express any target gene. In one embodiment, the promoter of the present invention is ligated to the target gene downstream.

[0111] Expression vector and cell

[0112] The present invention also relates to a vector comprising the promoter of the present invention, and a host cell genetically engineered with the vector of the present invention. The above-mentioned promoter, vector or host cell can be isolated.

[0113] As used herein, "isolated" means that a substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment). Polynucleotides and polypeptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if separated from other substances present in the natural state.

[0114] The method of amplifying DNA / RNA using PCR technology is preferably used to obtain the promoter of the present invention. Primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein and can be synthesized by conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

[0115] The present invention also relates to a vector comprising the promoter of the present invention, and a host cell genetically engineered with the vector or protein coding sequence of the present invention, and a method for expressing a target protein using the host cell by recombinant technology.

[0116] Based on the provided sequence information, a skilled technician can use available cloning techniques to generate nucleic acid sequences or vectors suitable for transduction into cells.

[0117] The vector can be viral or non-viral (e.g., plasmid). Viral vectors include those derived from the following viruses: adenovirus, adeno-associated virus (AAV) including mutant forms, retrovirus, lentivirus, herpesvirus, vaccinia virus, MMLV, GaLV, simian immunodeficiency virus (SIV), HIV, poxvirus, and SV40. Preferably, the viral vector is replication defective, although it is contemplated that it can be replication deficient, capable of replication or conditionally replicating. Viral vectors can generally remain episomal without integrating into the genome of the target cell. A preferred viral vector is the AAV vector.

[0118] In addition to the promoter of the present invention, the vector preferably further comprises one or more regulatory sequences to direct the expression of the nucleic acid sequence in the target cell. The regulatory sequences may include introns, enhancers, transcription termination signals, polyadenylation sequences, replication origins, nucleic acid restriction sites, and homologous recombination sites operably linked to the nucleic acid sequence. The vector may also include selectable markers, such as to determine the expression of the vector in a growth system (such as bacterial cells) or in the target cell.

[0119] "Operably linked" means that the nucleic acid sequence is functionally related to the sequence to which it is operably linked such that they are linked in a manner that affects the expression or function of each other. For example, a nucleic acid sequence operably linked to a promoter will have an expression pattern affected by the promoter.

[0120] Methods well known to those skilled in the art can be used to construct expression vectors containing the promoter of the present invention. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, etc. The DNA sequence of interest can be effectively ligated to the promoter of the present invention in the expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0121] Vectors containing the above-described promoter, DNA sequence of interest, and control sequences can be used to transform appropriate host cells to enable them to express polypeptides.

[0122] The host cell can be a prokaryotic cell, a lower eukaryotic cell, or a higher eukaryotic cell, such as a mammalian cell (including human and non-human mammals). Representative examples include animal cells such as CHO, NS0, COS7, or 293 cells. In a preferred embodiment of the present invention, 293T cells, photoreceptor cells (including cone cells and / or rod cells), other visual cells (such as bipolar cells), and nerve cells are selected as the host cells. In another preferred example, the host cell is selected from the group consisting of rod cells, cone cells, ON bipolar cells, OFF bipolar cells, horizontal cells, ganglion cells, amacrine cells, or a combination thereof.

[0123] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as Escherichia coli, competent cells capable of taking up DNA can be harvested after the exponential growth phase, treated with the CaCl2 method, and the steps used are well known in the art. Another method is to use MgCl2. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0124] The obtained transformants can be cultured by conventional methods to express the protein encoded by the target gene. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional media. The culture is carried out under conditions suitable for the growth of the host cell. When the host cell grows to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature shift or chemical induction), and the cells are cultured for a further period of time.

[0125] The polypeptide in the above method can be expressed intracellularly, or on the cell membrane, or secreted extracellularly. If desired, the protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting-out method), centrifugation, osmotic lysis, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

[0126] Composition, medicament or preparation

[0127] The present invention provides a preparation, composition or medicament, which contains the vector or host cell of the present invention, and a pharmaceutically acceptable carrier, diluent or excipient.

[0128] The preparation, composition or medicament of the present invention can be liquid or solid, such as powder, gel or paste. Preferably, the preparation, composition or medicament of the present invention is liquid, preferably an injectable liquid. Preferably, the injectable liquid is provided as a capsule or in a syringe.

[0129] The vector of the present invention or the preparation, composition or medicament containing the same can be administered intravenously, intramuscularly, subcutaneously, orally, by mucosal contact, intraperitoneally and intralesionally. In any mode of administration, preferably, the preparation, composition or medicament of the present invention is provided as an injectable liquid.

[0130] The composition, preparation or medicament may comprise a physiologically acceptable sterile aqueous or non-aqueous solution, dispersion, suspension or emulsion, and a sterile powder for reconstitution into a sterile injectable solution or dispersion. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0131] In the composition of the present invention, such as a pharmaceutical composition or pharmaceutical preparation, other active ingredients may also be included, such as one or more other therapeutic agents.

[0132] Therapeutic method

[0133] In one embodiment, the vector, formulation or composition or drug of the present invention is used for treating eye diseases.

[0134] In some embodiments, the eye diseases include but are not limited to: dry age-related macular degeneration (dAMD), geographic atrophy, Bietti crystalline dystrophy (BCD), wet age-related macular degeneration (wAMD), retinitis pigmentosa (RP), Fabry disease, choroideremia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis and X-linked retinitis pigmentosa, Leber congenital amaurosis, inherited retinal dystrophy (IRD), congenital cataract, glaucoma, congenital retinal, iris or choroid defect, retinoblastoma, pathologic myopia, congenital optic neuropathy, strabismus, keratoconus, etc.

[0135] The main advantages of the present invention include:

[0136] 1) The present invention uses error-prone PCR (mutant frequency controllable) technology to construct a variant promoter library. After multiple rounds of screening and enrichment, a promoter variant with significantly improved expression efficiency compared to the parental promoter C84 is obtained. The promoter variant of the present invention has strong transcriptional activity and can maintain high transcriptional activity in various tissues and cells, providing a better choice for the development of gene therapy drug expression cassettes.

[0137] 2) The present invention analyzes and performs back mutations on the mutation sites in the promoter variant, and discovers key mutation sites that have a greater impact on the effect of the promoter variant.

[0138] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and weight parts.

[0139] Example 1 Construction of EF1a Promoter Mutation Library

[0140] Using plasmid LX-GOI-C84 as a template, EP-PCR amplification was performed with primers EF1a 5' (5'TCACTAGGGGTTCCTATCGATATCAAG3', SEQ ID NO: 6) and EF1a 3' (5' TCACAGGGATGCCACCCGTG3', SEQ ID NO: 7). The reaction system contained 1×EP-PCR buffer, 200 μM dNTPs, 3 mM Mg²⁺, 0.3 mM Mn²⁺, 1 U Taq polymerase, approximately 100 ng of template, and 0.5 μM of primers, with a total volume of 50 μL. The reaction was carried out in a PCR machine with a pre-denaturation at 95°C for 2 min, followed by 30 cycles (95°C for 30 s, 57°C for 30 s, 72°C for 60 s), and a final extension at 72°C for 10 min.

[0141] The amplified product was ligated to the GOI-C85 vector backbone digested with HindIII-HF and KpnI-HF. The ligation system contained T4 ligase, 1× ligation buffer, approximately 50 ng of digested vector, and an appropriate amount of mutant fragment (molar ratio approximately 3:1), and was incubated overnight at 16°C. DH10B competent cells were transformed, and the cells were spread on an LB plate containing kanamycin and cultured overnight at 37°C to obtain mutant library plasmids with a capacity of 5×10 7 This mutant library was named C85.

[0142] Example 2 Library Screening of Strong Promoters and Vector Construction

[0143] The library plasmid C85 was transfected into HEK 293T cells at 80% confluence. Before transfection, the cells were cultured in DMEM containing 10% fetal bovine serum. At the time of transfection, the cells were changed to basal medium DMEM without additives. For 80% confluent HEK 293T cells in a 15 cm culture dish, 800 ng of plasmid DNA and 1.5 μL of PEI-pro transfection reagent were added. After mixing, the cells were cultured in an incubator at 37°C and 5% CO2.

[0144] Twenty-four hours after transfection of the library plasmid, 20 μg / mL puromycin was added for screening for 24 h. The cells were collected, washed with PBS, digested with trypsin, centrifuged, resuspended, and filtered. Cells with strong mScarlet expression in the top 10%-1% were sorted by flow cytometry and seeded into new plates for culture. Using a commercial genomic DNA extraction kit (DNeasy Blood Tissue Kit 250), genomic DNA of the sorted cells was extracted according to the kit instructions. Using the extracted genomic DNA as a template, PCR amplification was performed with the above-mentioned EF1a promoter-specific primers to obtain the full-length promoter fragment for constructing the next round of library. The above transfection, screening, and amplification steps were repeated for a total of four rounds of screening.

[0145] After 48 hours of transfection of the promoter library plasmid into 293T cells in the fourth round, the cells were collected. The collected cells were divided into two parts. One part was used for genomic DNA extraction. Using a commercial DNA extraction kit (such as DNeasy Blood & Tissue Kit 250), following the kit instructions, after extracting the genomic DNA, specific primers targeting the EF1a promoter were used for PCR amplification to obtain the promoter DNA fragment. The other part was used for total RNA extraction. Using an RNA extraction kit (RNeasy Mini Kit 250), after extracting the total RNA, its quality and concentration were detected by a spectrophotometer (NanoPhotometer N50) and agarose gel electrophoresis, and then the RNA was reverse transcribed into cDNA using a reverse transcription kit (SuperScript), with the reaction condition of constant temperature reaction at 50°C.

[0146] The obtained promoter DNA fragment and cDNA were respectively subjected to next-generation sequencing (NGS sequencing). After the sequencing was completed, the counts of the mRNA transcribed from each EF1a promoter mutant were divided by the counts of the corresponding DNA to calculate the ratio ( Figure 1 ). According to the ratio size, the promoter mutants were sorted, and the promoter mutant with the largest ratio (i.e., the strongest expression intensity) was selected.

[0147] Construct an rAAV vector with the mScarlet transgene for subsequent experiments.

[0148] (1) Construction of the GOI-C84-S1 plasmid: The GOI-C85 vector was used as the backbone. The plasmid backbone was obtained by digesting LX-GOI-C85 with HindIII-HF and KpnI-HF enzymes. The promoter mutant was obtained by PCR amplification with primers EF1a 5' (5'TCACTAGGGGTTCCTATCGATATCAAG3', SEQ ID NO: 6) and EF1a 3' (5'TCACAGGGATGCCACCCGTG3', SEQ ID NO: 7) and performing a point mutation at position 8.

[0149] (2) Packaging and purification of AAV

[0150] Dilute 293F cells to 1E+6 / ml with 300 ml of suspension medium (SMM 293-CD1, Sino Biological), and culture them in a shaker at 37 °C, 120 rpm, and 5% CO2. Add 300 μg of plasmid into 15 ml of SMM 293-TII without antibiotics and GlutaMax for triple plasmid packaging, with the molar ratio of LX-GOI-C84 (EF1a-mScarlet reporter gene plasmid), GOI-C84-S1 (EF1a-S1-mScarle reporter gene plasmid), and pHelper (helper packaging plasmid) being 1:1:1. Add 300 μl of Fecto VIR-AAV to the dilution, vortex, and let it stand at room temperature for 30 min. Dropwise add the transfection mixture to the suspended cells and culture them in a shaker at 37 °C, 120 rpm, and 5% CO2. At 24 h and 48 h after packaging, feed the cells according to the ratio of adding 35 ml / L of SMS 293-SUPI (Sino Biological) per liter of cell suspension. After 72 h, centrifuge the cells at 1500 rpm for 10 min using a horizontal rotor, discard the supernatant, resuspend the cells with PBS, add the universal enzyme at 50 U / ml of the sample, and digest at 37 °C in a shaker for 1 h. Centrifuge at 4000 rpm for 15 min using a horizontal rotor, collect the supernatant, and perform iodixanol ultracentrifugation. Take the 40% iodixanol layer, replace PBS using a 50 ml Millipore 100KD ultrafiltration tube, and store the virus at -80 °C.

[0151] Example 3 Virus Silver Staining Detection

[0152] Silver Staining is a staining technique commonly used in biomedical research, mainly for the detection and visualization of proteins or nucleic acids, and is often used for the detection of AAV capsid proteins.

[0153] Specific steps: Dilute RCC63V1-C84 and RCC63V1-C84-S1 viruses uniformly to 1E12 vg / ml. Take 5E9 (5 ul) of the virus and place it in an EP tube. Add 5 ul of 4X LDS sample buffer (Thermo NP0007) and 2 ul of 10X Reducing agent (Thermo NP0009), and make up to 20 ul with ddH2O. Mix the prepared system well, denature at 95 °C for 10 min, and after completion, centrifuge to centrifuge all the liquid to the bottom of the tube. Store at 4 °C for later use. Take a 10% SDS-PAGE precast gel, place the short side of the gel block inside and the long side outside, and clamp it tightly in the electrophoresis tank. If there is only one gel, a flat plate needs to be prepared. Pour 1* electrophoresis buffer into the vertical electrophoresis tank. Take protein marker (Thermo 26616), load 1 ul, and add other samples in sequence. Run at 80 V until reaching the boundary between the separating gel and the stacking gel, about 20 min, then adjust the voltage to 120 V until the loading reaches the bottom of the gel, about 70 min. End the electrophoresis. Take out the gel in the electrophoresis tank and put it into a container containing ddH2O, and shake it on a shaker at a speed of 60 - 70 rpm for 30 s to wash away the electrophoresis solution. Finally, perform silver staining according to the instructions of the PierceTM Silver Staining Kit (thermo 24612). The silver staining test results show that RCC63V1-C84 and RCC63V1-C84-S1 viruses are pure and can be used for subsequent in vivo experiments in mice.

[0154] Example 4 Experiment on Measuring the Expression Intensity of Promoters in 293T Cells In Vitro

[0155] C84 promoter: The promoter itself, containing CMV enhancer + EF1a core promoter + Intron

[0156] C84-S1 promoter: The screened promoter variant, which is obtained by mutation screening based on the C84 promoter.

[0157] C84-V1: Remove the CMV enhancer from the C84 promoter.

[0158] C84-V2: Further remove the Intron from C84-V1, that is, the wild-type EF1a promoter.

[0159] Transfect 293T cells with plasmids GOI-C84, GOI-C84-S1, GOI-C84-V1, and GOI-C84-V2.

[0160] HEK293T cells were cultured in Dulbecco's minimum essential medium (DMEM) containing 10% fetal bovine serum and 1% penicillin / streptomycin in 96-well plates coated with poly-l-lysine (10 μg / ml, Sigma-Aldrich) until 80% confluence. Then, the medium was changed to DMEM (without additives). All cells were transfected with the same reagent PEI-pro (polyplus). Specifically, 80 ng of plasmid DNA per well was transfected with 1 μl of PEI-pro. After transfection, the cells were incubated at 37 °C for 48 h. Subsequently, flow cytometry and fluorescence imaging were performed. The results showed that the expression intensity of the screened promoter variant C84-S1 promoter was 1.95 times that of the C84 native promoter ( Figure 2 ).

[0161] In related studies on gene expression regulation, in order to explore the differences in the expression characteristics of different promoters in cells, the following experiments were carried out. RCC07V5-C84 and RCC07V5-C84-S1 viruses were prepared respectively, and the promoters carried by these two viruses were different. The multiplicity of infection (MOI) was set to 500 and 2500 respectively. The setting of the MOI value was aimed at simulating different intensities of virus infection states in order to more comprehensively observe the performance of the promoter under different infection conditions. Then, these two viruses were used to infect RGC5 cells, ARPE19 cells, and SY5Y cells respectively. These three cell lines are representative in the related field, and the differences in their cell characteristics and functions may affect the expression of the promoter.

[0162] After 72 hours of infection, flow cytometry was used to measure the mean fluorescence intensity. The detection results showed that in the above three different cell lines, the expression intensity of the C84-S1 promoter was significantly higher than that of the C84 promoter ( Figure 3 ). This result indicates that under the selected cell lines and the set experimental conditions, the C84-S1 promoter has stronger activity than the C84 promoter in driving gene expression.

[0163] Example 5 Testing the expression level of promoter C84-S1 in retinal organoids

[0164] Retinal organoids (optic cups) are differentiated from human iPSC cells and can form a three-dimensional structure containing all retinal cell types. The optic cup is highly similar to the human retinal structure.

[0165] (1) Optic cup differentiation

[0166] Wild-type H9 cells were used for retinal organoid differentiation. On Day 0, human embryonic stem cell line H9 cells were gently digested at 37°C and embryoid bodies (EBs) were established in ultra-low attachment 6-well plates. From Day 1 to Day 5, the medium was changed every two days to NIM medium (DMEM / F12 + 1x N2 + MEM-NEAA + Heparin). From Day 7 to Day 15, the EBs were transferred to Matrigel-coated 6-well plates using a Pasteur pipette, and NIM medium was replaced semi-quantitatively on D9, D12, and D15. From Day 16 to Day 25, the medium was changed every two days with 3:1 Medium (DMEM / F12 + 1x B27 + MEM-NEAA); the optic cups were separated. The cells were scraped off using a pipette tip cross method and transferred to a low-attachment 6-well plate using a Pasteur pipette. After separating the optic cups, the medium was changed to 3D-RDM (DMEM / F12 + 10% FBS + MEM-NEAA + 1x B27 + 100 μM Taurine + CDLS). From Day 30 to Day 40, the optic cups with obvious structures were picked under a stereomicroscope for long-term culture. The first stage of optic cup differentiation lasted until the 6th week after separation, and the characteristic of this stage was the appearance of a black core in the center. Between 17 - 24 weeks after separating the optic cups, most iPSC-derived optic cups developed to the second stage, which was characterized by the appearance of obvious surface hairy appendages and the reappearance of a thin outer edge. At the beginning of the 3rd stage of differentiation (after 148 - 196 days), the optic cups reached an advanced state of photoreceptor cell development, including the formation of inner and outer segments, outer nuclear layer, and outer plexiform layer, and could be tested for AAV infection.

[0167] (2)Optic cup infection

[0168] Viruses RCC01-C84 and RCC01-C84-S1 were uniformly diluted to 1E11 vg / μl. Differentiated and mature retinal organoids were infected at 1E9 vg, and the 3D-RDM medium was changed every three days during the infection. Photos were taken on Day 7 and Day 14 of the infection. Fluorescence intensity quantification was performed using Image J. The transduction activities of promoter C84 (CMV enhancer + EF1a core promoter + Intron) and promoter mutant C84-S1 in human retinal organoids were detected. As Figure 4 shown in a of Figure 4 , at the injection dose of 1E9 vg, it could be seen that the red fluorescence of retinal organoids in the experimental group RCC01-C84-S1 was significantly stronger than the average fluorescence intensity of the control group RCC01-C84. The average fluorescence intensity MFI ( Figure 4In b), quantification was performed, and the analysis of statistical results showed that the expression intensity of the promoter mutant C84-S1 was significantly higher than that of C84 (CMV enhacer + EF1a core promoter + Intron).

[0169] Example 6 Evaluation Experiment in Mice

[0170] C57BL mice aged 6 - 8 weeks were selected as the experimental model. The virus was introduced into the mice by tail vein injection. The injection dose was precisely controlled at 5E10 vg, and the injection volume was 10 μL. One week, two weeks, and three weeks after injection, the mice were photographed under fluorescence using an in vivo imager. After the photographing was completed, these fluorescence images were quantitatively analyzed using Image J software.

[0171] After the in vivo imaging observation was completed, the mice were sacrificed and their organs were dissected. During the dissection, the brain, lungs, liver, heart, and other organs were carefully obtained. Fluorescence photographs of all organs were taken under strictly the same exposure conditions, and parameters such as exposure time, aperture, and gain were strictly controlled. Then, the average fluorescence intensity of the fluorescence images of these organs was measured again using Image J software.

[0172] In vivo imaging results of mice ( Figure 5 In a) showed that the fluorescence intensity of the mice carrying RCC63V1-C84-S1 was significantly higher than that of the mice carrying RCC63V1-C84. This clearly indicates that at the overall level of the mice, the activity of the promoter C84-S1 is significantly stronger than that of C84, and it can drive gene transcription and expression more effectively, generating a stronger fluorescence signal ( Figure 5 In b). From the results of the fluorescence quantitative analysis of mouse tissues and organs, among the four organs of the brain, lungs, liver, and heart, the fluorescence intensity differences were significant, and the fluorescence intensity corresponding to C84-S1 was significantly higher than that of C84 ( Figure 5 In c). This result further verified the activity advantage of the C84-S1 promoter in different tissue environments. No fluorescence signal was detected in other organs. Based on the understanding of the infection characteristics of adeno-associated virus and factors such as the injection dose, infection route, and time of the virus in this experiment, it is speculated that it is due to the failure of adeno-associated virus (AAV) to successfully infect these organs.

[0173] In summary, the activity of the promoter C84-S1 is significantly stronger than that of C84.

[0174] Eight base mutations occurred in the C84-S1 promoter variant compared to the C84 promoter, which occurred in the enhancer (CMV enhancer), core promoter (core promoter), and intron (Intron) regions respectively ( Figure 6 )

[0175] Mutation site analysis was performed on the mutant promoter C84-S1 with significantly increased expression intensity. Through prediction, it was found that new cis-acting elements were generated at four mutation sites (positions 61, 365, 512, and 744-745), and these elements may have a positive impact on the expression ability of the promoter.

[0176] To find the most important key sites that determine the significant improvement in the expression ability of the mutant promoter, the positions of these four cis-acting elements (positions 61, 365, 512, and 744-745) were respectively mutated back to the original base sequences, and the schematic diagrams of the four constructed plasmids are as Figure 7 shown in a below.

[0177] Among them, LX-GOI-C84-S2 was subjected to a reverse mutation at position 61 relative to the C84-S1 promoter;

[0178] LX-GOI-C84-S3 was subjected to a reverse mutation at position 365 relative to the C84-S1 promoter;

[0179] LX-GOI-C84-S4 was subjected to a reverse mutation at position 512 relative to the C84-S1 promoter;

[0180] LX-GOI-C84-S5 was subjected to a reverse mutation at positions 744-745 relative to the C84-S1 promoter.

[0181] The four plasmids LX-GOI-C84-S2, LX-GOI-C84-S3, LX-GOI-C84-S4, and LX-GOI-C84-S5 were respectively transfected into 293T cells. After 48 hours, the average fluorescence intensity was detected by flow cytometry. By comparing the decrease in the average fluorescence intensity compared to C84-S1, the key element that determines the significant increase in the expression intensity of the promoter variant C84-S1 was found ( Figure 7 shown in a below). Fluorescence photography was performed using a fluorescence microscope 48 hours after plasmid transfection ( Figure 7 shown in b below). The average fluorescence intensity of the cells was detected by flow cytometry, and plotting and significant difference analysis were performed using prism software. The results showed that the mutation sites S2, S3, and S4 all played a role in enhancing the expression intensity of the promoter, and among them, the role of S3 was the most critical ( Figure 7 shown in c below), proving that the base at position 365 of the wtEF1a core promoter mutated from A to G, significantly enhancing the transcriptional activity of the promoter.

[0182] Example 7 Influence of the S3 site of the core promoter on transcriptional activity

[0183] To verify the effect of the S3 site (position 365) on the transcriptional activity of the EF1α promoter, based on the GOI-C84 plasmid, only a single-point mutation (A→G) was introduced at position 365 of the composite promoter to construct the plasmid GOI-C84-S6 ( Figure 8 ). To evaluate the transcriptional activity of the GOI-C84-S6 plasmid, an in vitro activity comparison experiment was conducted with the GOI-C84 plasmid. The GOI-C84 and GOI-C84-S6 plasmids were transfected into 293T cells respectively, and the fluorescence intensity was detected 48 hours later. Observation under a fluorescence microscope ( Figure 9 ) showed that the fluorescence intensity of the cells transfected with the GOI-C84-S6 plasmid was significantly higher than that of the parental GOI-C84. The results of flow cytometry further confirmed that the average transcriptional activity of single cells of the GOI-C84-S6 plasmid was significantly enhanced, and the expression intensity of the red fluorescent protein increased by about one-fold ( Figure 10 ), approaching that of GOI-C84-S1 (8-base mutation). The transcriptional activity of the GOI-C84-S6 plasmid was significantly stronger than that of the GOI-C84 parental, indicating that the mutation (A→G) at position 365 of the EF1a core promoter had a very significant effect on enhancing the transcriptional activity of the promoter.

[0184] C84:

[0185]

[0186] C84-V1:

[0187] gggggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagctgaagcttcgaggggctcgcatctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgttacagatccaagctgtgaccggcgcctacgatatccgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagagtctataggcccacccccttggcttcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactatagaataacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcacctcggttctaagcttctgcaggtcgactctagaggatccaccggtctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattccacc (SEQ ID NO:2).

[0188] C84-S1:

[0189]

[0190] C84-S6 combined promoter sequence:

[0191]

[0192] Full length of GOI-C85 plasmid:

[0193]

[0194] All documents mentioned in this invention are incorporated herein by reference as if each individual document was specifically and individually incorporated by reference. In addition, it should be understood that after reading the above teachings of this invention, those skilled in the art can make various changes or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

Claims

1. An isolated promoter, characterized in that, The promoter has the following nucleotide mutations shown in (a), (b), (c), (d) or (e) based on the sequence shown in SEQ ID NO: 1: (a) Position 61: G → A; Position 365: A → G; Position 512: A → T; Position 744: C → T; Position 745: T → C; Position 877: C → A; Position 1024: T → C; and Position 1124: A → G; (b) Position 61: G → A; Position 365: A → G; Position 512: A → T; Position 877: C → A; Position 1024: T → C; and Position 1124: A → G; (c) Position 61: G → A; Position 365: A → G; Position 744: C → T; Position 745: T → C; Position 877: C → A; Position 1024: T → C; and Position 1124: A → G; (d) Position 365: A → G; Position 512: A → T; Position 744: C → T; Position 745: T → C; Position 877: C → A; Position 1024: T → C; and Position 1124: A → G; (e) Position 365: A → G.

2. The promoter according to claim 1, wherein The nucleotide sequence of the promoter is shown in SEQ ID NO:

3.

3. An expression cassette, the expression cassette containing the promoter as described in claim 1, and a gene of interest operably linked to the promoter element.

4. The expression cassette according to claim 3, wherein The gene of interest encodes a protein for treating ophthalmic diseases.

5. A vector, the vector containing the expression cassette as described in claim 3.

6. The carrier according to claim 5, wherein The vector is selected from the group consisting of: plasmid, adenovirus vector, adeno-associated virus vector, retrovirus vector, or a combination thereof.

7. The carrier according to claim 5, wherein The vector is an adeno-associated virus vector.

8. A host cell, the host cell containing the vector as described in claim 5, or having the exogenous promoter as described in claim 1 integrated into its chromosome, or having the expression cassette as described in claim 3 integrated into its chromosome.

9. A pharmaceutical composition, the pharmaceutical composition containing the vector as described in claim 5, or the host cell as described in claim 8, and a pharmaceutically acceptable carrier.

Images