A method for increasing tomato fruit yield and / or lycopene content
By knocking out or silencing the SlXLG2 gene in tomato using CRISPR/Cas9 gene editing technology, the problem of increasing tomato fruit yield and lycopene content in existing technologies has been solved, resulting in a significant improvement in tomato fruit yield and quality.
Patent Information
- Application Number
- CN202510050083.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-13
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2045-01-13
AI Technical Summary
Existing technologies cannot simultaneously increase tomato fruit yield and lycopene content. Poor environmental controllability in greenhouse tomato cultivation leads to quality fluctuations, and existing gene editing technologies cannot improve both at the same time.
By knocking out or silencing the SlXLG2 gene in tomatoes using CRISPR/Cas9 gene editing technology, and then using specific sgRNA to target the protein-coding region of the SlXLG2 gene, a CRISPR/Cas9 vector was constructed to obtain homozygous mutants without exogenous genes, which promoted tomato growth and increased lycopene content.
It significantly increased tomato fruit yield and lycopene content, promoted tomato plant growth and fruit quality, and provided a basis for the breeding of high-yield and high-quality tomato germplasm.
Smart Images

Figure CN120041463B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically to a method for increasing tomato fruit yield and / or lycopene content. Background Technology
[0002] Tomatoes (Solanum lycopersicum L.) are an important vegetable crop in my country and the world, widely loved for their rich nutrition and delicious taste. The greenhouse tomato industry utilizes facilities such as greenhouses to cultivate tomatoes. Currently, the planting area of greenhouse tomatoes in my country is continuously expanding, and yields have significantly increased, but problems such as low yield per unit area still exist. At the same time, greenhouse tomatoes in my country are mainly grown in solar greenhouses and plastic tunnels, which have poor environmental control and are greatly affected by external climate changes, resulting in reduced yield and quality of tomato plants. Therefore, how to increase the yield of tomato plants is a crucial issue currently facing the tomato cultivation industry.
[0003] With the improvement of living standards, people have increasingly higher requirements for the quality of natural and healthy foods such as vegetables and fruits. Tomatoes have excellent nutritional value, rich in vitamins, minerals, and carotenoids. Carotenoids, as powerful antioxidants, can effectively scavenge oxygen free radicals in the body and reduce oxidative stress, making them one of the key indicators of tomato nutritional quality. Carotenoids include various natural pigments, such as lycopene, beta-carotene, and lutein. Among them, lycopene is one of the strongest antioxidants found in nature, with multiple effects such as cancer prevention, anti-oxidation, lowering blood lipids, lowering blood pressure, and beauty enhancement. However, external climate changes often lead to fluctuations in tomato quality and a decrease in lycopene content. Therefore, how to improve the quality of tomatoes, especially to increase the lycopene content, has become an important issue that urgently needs to be addressed in the current agricultural production field.
[0004] Breeding high-quality tomato varieties that can simultaneously improve yield and fruit quality through gene editing technology is an effective way to solve the above problems and has important practical production significance. Chinese patent document CN119082137A discloses silencing or knocking out the SlMADS1 gene to increase lycopene content, and Chinese patent document CN117778458A discloses that knocking out the Solyc10g084600 gene in tomatoes can effectively increase fruit yield. However, the above gene editing technologies cannot simultaneously increase tomato fruit yield and lycopene content in tomato fruits. G proteins are widely found in both plants and animals. Plant G protein subunits are relatively few in number, mainly classified into α, β, and γ subunits. In recent years, G proteins have been extensively studied as proteins that can enhance the resistance of various crops to pathogens (Jiao Wang et al., “Glucose sensing by regulator of G protein signaling 1 (RGS1) plays a crucial role in coordinating defense in response to environmental variation into tomato”, New Phytologist, 2022, 236, 561-575). However, research on their effects on yield and quality is limited. SlXLG2 belongs to the α subunit of the tomato G protein, and its effects on tomato fruit yield and lycopene content in tomato fruit have not yet been reported. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a method for increasing tomato fruit yield and / or lycopene content using G protein genes, aiming to provide a basis for breeding high-yield and high-quality tomato varieties.
[0006] The specific technical solution adopted is as follows:
[0007] This invention provides the application of the SlXLG2 gene in increasing tomato fruit yield and / or lycopene content. The nucleotide sequence of the protein coding region of the SlXLG2 gene is shown in SEQ ID NO.1, and its protein coding region length is 2922 bp. The whole gene DNA sequence is shown in SEQ ID NO.6.
[0008] This invention also provides the application of the protein encoded by the SlXLG2 gene in increasing tomato fruit yield and / or lycopene content. The amino acid sequence of the protein encoded by the SlXLG2 gene is shown in SEQ ID NO.2. The protein encoded by the SlXLG2 gene belongs to the α subunit of the G protein family and consists of 974 amino acids.
[0009] Furthermore, knocking out or silencing the SlXLG2 gene can increase tomato fruit yield and / or lycopene content.
[0010] The present invention also provides a method for increasing tomato fruit yield and / or lycopene content, comprising: knocking out or silencing the SlXLG2 gene, a negative regulatory factor in tomatoes; the nucleotide sequence of the protein coding region of the SlXLG2 gene is shown in SEQ ID NO. 1.
[0011] Optionally, a gene editing vector can be constructed to knock out or silence the SlXLG2 gene, a negative regulator in tomatoes, thereby increasing tomato fruit yield and / or lycopene content.
[0012] CRISPR / Cas9 gene editing technology can precisely identify target sites and achieve specific gene editing, thereby accurately altering crop traits and rapidly obtaining ideal germplasm. Through self-pollination and selection, target gene-edited lines without Cas9 can be obtained, avoiding the need to introduce foreign genes in transgenic technology.
[0013] Specifically, the method includes the following steps:
[0014] (1) Select target fragments (target fragments containing PAM structure) for gene knockout or silencing in the protein coding region of SlXLG2 gene, design primers, and construct a CRISPR / Cas9 vector for knocking out or silencing SlXLG2 gene.
[0015] (2) Construct Agrobacterium genetically engineered bacteria containing the CRISPR / Cas9 vector described in step (1);
[0016] (3) Transform the genetically engineered bacteria obtained in step (2) into tomato cotyledons and culture them to obtain a homozygous mutant strain that does not contain exogenous protein and is stably inherited.
[0017] Sequence analysis of the SlXLG2 gene (gene ID: XM_004232023.4, NCBI website: https: / / www.ncbi.nlm.nih.gov / ) was performed using the CRISPR P2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). PAM sequences were identified, with the structure NGG, where N represents any base. The 20 bp preceding NGG were defined as sgRNA. Highly specific sgRNA sequences targeting the protein-coding region of the SlXLG2 gene were selected, and the DNA sequence of this sgRNA specifically targeting the protein-coding region of the SlXLG2 gene is shown in SEQ ID NO. 3.
[0018] Further, in step (1), the nucleotide sequence of the upstream primer for constructing the CRISPR / Cas9 vector is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.5.
[0019] Furthermore, in step (2), the Agrobacterium genetically engineered strain is Agrobacterium GV3101.
[0020] By measuring the plant height of tomato plants and statistically analyzing the number of carpels, single fruit weight, number of fruits per plant, and yield per plant, it was found that the Slxlg2 gene mutant plants had stronger growth vigor, more carpels, and significantly higher yields than wild-type plants.
[0021] By measuring relevant quality indicators of tomato fruits, it was found that the fruits of Slxlg2 gene mutant plants had increased lycopene content and improved fruit quality compared to wild-type plants.
[0022] The present invention also provides the application of the method for increasing tomato fruit yield and / or lycopene content in tomato breeding.
[0023] The present invention also provides a tomato breeding method that obtains plants with increased tomato fruit yield and / or lycopene content by inhibiting the expression of the SlXLG2 gene in tomatoes.
[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0025] (1) This invention utilizes CRISPR / Cas9 gene editing technology to provide a method for increasing tomato fruit yield and / or lycopene content, resulting in a tomato SlXLG2 gene-edited mutant with high yield and high lycopene content, which has broad application prospects in the cultivation of high-yield and high-quality tomato germplasm.
[0026] (2) Compared with wild-type WT, the SlXLG2 gene-edited mutant obtained in this invention can promote the growth of tomato plants, significantly increase the yield of tomato plants and the lycopene content of fruits, proving that knocking out or silencing the SlXLG2 gene can increase the yield of tomato fruits and / or the lycopene content. Attached Figure Description
[0027] Figure 1 This is a map of gene editing sites in the T1 generation mutant plants obtained in Example 2; among them, Slxlg2#1 has 4 bases missing compared to the control without gene editing, and Slxlg2#2 has 49 bases missing compared to the control without gene editing.
[0028] Figure 2The images show the plant height statistics and optical images of the control and Slxlg2 gene mutant tomatoes in Example 3. a and b represent significant differences between different plants at the 5% level.
[0029] Figure 3 The images show the statistical diagram and optical images of the number of carpels in the first crop of tomatoes from the control and Slxlg2 gene mutant varieties in Example 3. a and b represent significant differences between different plants at the 5% level.
[0030] Figure 4 The images show the statistical chart and optical images of the single fruit weight of the control and Slxlg2 gene mutant tomatoes in Example 3. a and b represent significant differences between different plants at the 5% level.
[0031] Figure 5 The graph shows the yield statistics of the control and Slxlg2 gene mutant tomatoes in Example 3. a and b represent significant differences between different plants at the 5% level.
[0032] Figure 6 The results show the lycopene content in the control and Slxlg2 mutant tomato fruits in Example 4, as well as the gene expression of the lycopene degradation gene LCYB1 in the control and Slxlg2 mutant tomato fruits. a and b represent significant differences at the 5% level. Detailed Implementation
[0033] The present invention will be further illustrated below with reference to the embodiments and accompanying drawings. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Operating methods not specifically described in the following embodiments are generally performed under conventional conditions or as recommended by the manufacturer. Contents not described in detail in this specification are prior art known to those skilled in the art. Unless otherwise specified, the experimental materials used in the embodiments below can be purchased from conventional biochemical reagent companies.
[0034] The tomato variety used in the following examples is the conventional wild-type tomato variety CR (Condine Red), and ordinary tomatoes that have not undergone gene editing are used as a control.
[0035] Example 1: Construction of a CRISPR / Cas9 vector containing specific sgRNA
[0036] The DNA sequence of SlXLG2 (XM_004232023.4) was found on the NCBI website https: / / www.ncbi.nlm.nih.gov / . Its sequence is shown in SEQ ID NO.6. Enter... http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPRThe website identified a 20bp base sequence (sgRNA, SEQ ID NO.3) located in the protein coding region before a PAM structure, which had a high onscore score and GC content >40%.
[0037] Design CRISPR primers as follows:
[0038] CRISPR preprimer:
[0039] GATTGATTAGGCAGATCATGAAAG(SEQ ID NO.4);
[0040] CRISPR post-primer:
[0041] AAACCTTTCATGATCTGCCTAATC (SEQ ID NO. 5).
[0042] Take 5 μL each of the above CRISPR pre-primer and post-primer, mix well, and anneal to double strands using a PCR instrument. Digest the intermediate vector pMD18-T with BBSI, purify using a standard DNA purification kit, and ligate the double strands to the vector using T4 ligase at 16°C overnight. Transform and plate at 42°C with ampicillin as the antibiotic.
[0043] Single colonies were selected and verified by PCR using the CRISPR pre-primer (SEQ ID NO.4): GATTGATAGGCAGATCATGAAAG and the vector post-primer (SEQ ID NO.7): CTACTTATCGTCATCGTCTTTG.
[0044] Bacterial culture with the correct band size was sent to the company for sequencing. The sequencing results showed that the vector contained the sgRNA sequence. The plasmid was extracted, digested with Hind III and Kpn I, and ligated into the binary expression vector pCAMBIA1301. The sequencing results showed that the final vector contained sgRNA. The obtained final plasmid was electroporated into GV3101 Agrobacterium competent cells, incubated at 28°C for two days, and then the plaques were picked for PCR verification, obtaining an Agrobacterium strain that can be used to construct its CRISPR / Cas9 gene editing material.
[0045] Example 2: Preparation and Identification of Slxlg2 Gene Mutant Materials
[0046] Take an appropriate amount of tomato CR seeds, shake them at 28℃ for 6-8 hours, disinfect them with 70% alcohol for 20-30 seconds, and then sterilize them with 10% sodium hypochlorite solution for 15 minutes before sowing them into sterilized 1 / 2 MS sowing medium. After 3 days of darkness treatment, place them under normal light, and after 7 days, cut the cotyledons onto KC medium. Transform the final plasmid prepared in Example 1 into the cotyledons using the Agrobacterium infection method, and utilize the totipotency of plant cells to obtain T0 generation gene-edited tomatoes.
[0047] Detection of T0 generation gene-edited tomato seedlings. Genomic DNA was extracted from T0 generation plants using a rapid extraction method and used as a template. Primers were designed approximately 200 bp before and after the DNA sequence containing sgRNA for PCR amplification and sequencing verification:
[0048] Pre-validation primer (SEQ ID NO.8): AGGGGTGTGTTATCGTTGTTGT;
[0049] Validation primer (SEQ ID NO.9): GCTTCGGTGGATTTATGC;
[0050] The obtained PCR products were sent to the company for sequencing. The sequencing results were compared with the original gene sequence using DNAMAN software. Plants with base deletions in the sgRNA sequence and single-peak sequencing were selected for self-pollination to obtain seeds of generation T0.
[0051] The aforementioned T0 generation seeds were planted in a plant factory to obtain T1 generation plants. The sgRNA sequence editing status of the T1 generation plants was detected using the same method described above. Simultaneously, PCR amplification of the DNA of the T1 generation plants was performed using the CRISPR pre-primer (SEQ ID NO.4) and vector post-primer (SEQ ID NO.7) to detect the presence of the Cas9 sequence. Two lines of T1 generation plants with mutated sgRNA and lacking the Cas9 protein were selected as gene-edited plants and named Slxlg2#1 and Slxlg2#2, respectively. Their gene editing sites are as follows: Figure 1 As shown, Slxlg2#1 lacks 4 bases compared to the control plant, and Slxlg2#2 lacks 49 bases compared to the control plant. After self-pollination of the T1 generation seeds of these two lines, stable T2 generation plants without the exogenous Cas9 gene and with mutated sgRNA were obtained.
[0052] The following examples all use T2 generation plants of the two homozygous lines mentioned above as materials for the experiment.
[0053] Example 3: Yield Study of Slxlg2 Gene Editing Mutant
[0054] Two lines, Slxlg2#1 and Slxlg2#2, were sown as control plants (CR) and mutant plants and cultured in the same suitable environment, with the temperature controlled at approximately 25℃, relative humidity at approximately 75%, and light intensity at approximately 400 μmol / m². -2 s -1 Two weeks after the first flush of flowers bloomed, the plant height of the control and mutant plants was measured, photographed, and recorded. The results are as follows: Figure 2 As shown, the Slxlg2 gene mutant tomato significantly increased plant height and promoted plant growth. After the first fruit set, the number of carpels in the fruit of the control and mutant plants was counted, photographed, and recorded. The results are as follows. Figure 3 As shown, the Slxlg2 mutant can significantly increase the number of carpels in tomato fruits (generally, for large-fruited tomato varieties, when the number of ovary locules is 6 to 8, the single fruit weight can reach about 200g, and the incidence of deformed fruits is also low (Li Tianlai. Comprehensive prevention measures for multi-locule deformed tomatoes in greenhouses [J]. Rural Practical Engineering Technology, 1999, (05): 12-13.)). After the fruit matures, the fruit weight is measured, photographs are taken and recorded, and the results are as follows. Figure 4 As shown, the Slxlg2 mutant plants have larger fruits and increased fruit weight.
[0055] Two lines of control and mutant plants were selected and planted in a greenhouse. After most of the tomato fruits had turned color, the number of fruits per plant and the yield per plant were counted and recorded by photograph. The results are as follows: Figure 5 As shown, the yield of Slxlg2 mutant plants is significantly increased.
[0056] Example 4: Determination of lycopene content and expression analysis of key genes in the lycopene synthesis pathway in Slxlg2 mutant and control tomatoes.
[0057] Record the flowering date and fruit color-breaking time of the control plant CR and the mutant plant Slxlg2. Eight days after color breaking (Break+8), collect the pericarp sample, grind it, and weigh 0.1g of the sample for carotenoid content determination. Add 350μL methanol, 700μL chloroform, and 350μL ddH2O sequentially, vortex, centrifuge at 10000rpm for 15min, and collect the chloroform phase into a new tube. Add 700μL chloroform to the remaining liquid, vortex, and centrifuge. Combine the two chloroform phases and blow with nitrogen. Add 350μL methanol containing 6% KOH, vortex, and derivatize at 60℃ for 30min. Add another 700μL chloroform, vortex, centrifuge at 10000rpm at 4℃ for 10min, collect the chloroform phase, and add 700μL... Chlorophyll was removed by ddH2O, followed by vortexing and centrifugation. The chloroform phase was dried with N2 and stored at -80℃. Before analysis, the chloroform phase was reconstituted with a 1:1 mixture of dimethyl sulfoxide and isopropanol and then analyzed by high performance liquid chromatography.
[0058] Weigh 100 mg of fruit peel powder sample, add 500 μL of RCL buffer, vortex, incubate at 55℃ for 1-3 min, centrifuge at 10000g for 5 min at room temperature, transfer the supernatant to a gDNA filter column, centrifuge at 14000g for 3 min at room temperature; add an equal volume of RCB buffer, vortex for 30 s, transfer the mixture to the column, centrifuge at 12000g for 1 min, add 400 μL of LRWF buffer, centrifuge at 10000g for 30 s, wash the column twice with RNA washing buffer II, and perform one empty centrifugation. Add 50 μL of DEPC water to the center of the filter membrane. The obtained RNA can be stored at -80℃. Reverse transcription of RNA from the fruits of control plant CR and mutant plant Slxlg2 yielded cDNA. The expression of key genes in the lycopene synthesis pathway, such as the lycopene synthesis gene PSY and the lycopene degradation gene LCYB1, was detected using SYBR enzyme.
[0059] The results are as follows Figure 6 As shown, the lycopene content in the fruits of both lines of the Slxlg2 mutant plant was significantly higher than that in the fruits of the control plant, indicating improved fruit quality in the mutant plant. Meanwhile, the expression of the lycopene degradation gene LCYB1 in the fruits of the Slxlg2 mutant plant was significantly lower than that in the fruits of the control plant.
[0060] The embodiments described above provide a detailed explanation of the technical solutions of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, or similar substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Knocking out or silencing SlXLG2 the use of a gene in increasing the yield and / or lycopene content of tomato fruits, characterized in that, SlXLG2 The nucleotide sequence of the protein coding region of the gene is shown in SEQ ID NO.
1.
2. SlXLG2 Use of the absence of expression of a protein encoded by a gene in increasing the yield and / or the lycopene content of tomato fruits, characterized in that, SlXLG2 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
2.
3. A method for increasing the yield and / or the lycopene content of tomato fruits, characterized in that, comprising: Modulation of tomato ripening SlXLG2 gene knockout or silencing, SlXLG2 The nucleotide sequence of the protein coding region of the gene is shown in SEQ ID NO.
1.
4. The method for increasing the yield and / or the lycopene content of tomato fruits according to claim 3, characterized in that, Constructing a gene editing vector, using the action of the gene editing vector to knock out or silence the negative regulatory factor in the tomato SlXLG2 gene knockout or silencing.
5. The method for increasing the yield and / or the lycopene content of tomato fruits according to claim 3, characterized in that, The method specifically comprises the following steps: (1) In SlXLG2 The target fragment for gene knockout or silencing is selected from the protein coding region of the gene, and primers are designed to construct a CRISPR / Cas9 vector for knockout or silencing of the gene. SlXLG2 The target fragment for gene knockout or silencing is selected from the protein coding region of the gene, and primers are designed to construct a CRISPR / Cas9 vector for knockout or silencing of the gene. (2) constructing an agrobacterium genetic engineering bacterium containing the CRISPR / Cas9 vector of step (1); (3) transforming the cotyledon of tomato with the genetic engineering bacterium obtained in step (2) to obtain a homozygous mutant strain line without foreign protein and stable heredity.
6. The method for increasing the yield and / or the lycopene content of tomato fruits according to claim 5, characterized in that, In step (1), the nucleotide sequence of the upstream primer for constructing the CRISPR / Cas9 vector is shown in SEQ ID NO. 4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.
5.
7. The method for increasing the yield and / or the lycopene content of tomato fruits according to claim 5, characterized in that, In step (2), the agrobacterium genetic engineering bacterium is agrobacterium GV3101 strain.
8. The use of the method for improving the yield and / or lycopene content of tomato fruits according to any one of claims 3-7 in tomato breeding.
9. A method for breeding tomatoes, characterized in that, By knocking out or silencing a gene in tomato SlXLG2 Plants with increased fruit yield and / or lycopene content are obtained.
Citation Information
Patent Citations
Gene for increasing tomato yield and application thereof
CN117778458A
Application of G protein α subunit in regulating cucumber seed germination, seedling growth, and plant cold resistance
CN109354618B
Application of SlMADS1 gene in regulating lycopene content
CN119082137A