Method for creating high-dimensional E rape new germplasm by using brassica napus BnaCHL double mutants

Abstract

The invention relates to a method for creating a high-dimensional E rape new germplasm by using brassica napus BnaCHL double mutants. A cabbage type rape chlorophyll synthase gene double-copy mutant BnaCHL.a1c1 is selected as an experimental material, AtHPT and TyrA genes are successfully overexpressed by utilizing a plant genetic transformation technology, and the tocopherol content in rape seeds can be remarkably improved through the gene overexpression strategy, so that the vitamin E content in the rape seeds is increased. The novel high-vitamin E rape germplasm successfully created by the invention not only provides an important experimental material for subsequent research, but also provides a new theoretical basis and practical guidance for genetic improvement of rape, and is beneficial to promoting the development of the rape industry and enhancing the application potential of the rape industry in the fields of foods and nutritional supplements.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular breeding, and particularly relates to a method for creating new germplasms of high-vitamin E rapeseed by using a Brassica napus BnaCHL double mutant. Background Art

[0002] Vitamin E is a crucial fat-soluble antioxidant that plays an important role in protecting animal cells from free radicals. Its presence not only reduces the damage of free radicals to cells but also significantly reduces the risk of various diseases such as cancer and heart disease, injecting vitality into the life activities of animals and plants. In the vitamin E family, according to the number of double bonds on the side chain, it is divided into two major categories: tocopherols and tocotrienols. Among them, tocopherols have no double bonds on the side chain, while tocotrienols have three double bonds on the side chain. They are further differentiated into four forms: α, β, γ, and δ according to the number and position of methyl groups on the cyclic structure, each with its unique biological activity. In higher plants, the biosynthesis process of vitamin E mainly occurs in plastids such as chloroplasts and chromoplasts. The synthesis of vitamin E involves three key precursor substances: HGA (homogentisic acid), PDP (phytyl diphosphate), and GGDP (geranylgeranyl diphosphate).

[0003] In plants, chlorophyll synthase (CHLSYN) plays a key role in the biosynthesis of chlorophyll. In Arabidopsis thaliana, by using a specific promoter to interfere with the expression of the CHLSYN gene, it was found that the tocopherol content in seeds increased significantly, up to 33.69%. This finding indicates that the expression level of CHLSYN has a significant regulatory effect on the tocopherol content in seeds. Further experiments showed that when CHLSYN was specifically overexpressed in Arabidopsis thaliana seeds, the tocopherol content could be reduced by up to 44.73%, further confirming the negative correlation between the CHLSYN expression level and the tocopherol content. In Brassica napus, through genome-wide association analysis (GWAS), it was found that the BnA9CHLSYN locus has a significant impact on the tocopherol content in seeds. This may mean that during the synthesis of tocopherols in rapeseed seeds, chlorophyll synthase binds to the precursor substance PDP (phytyl diphosphate) of tocopherol synthesis and resynthesizes chlorophyll, resulting in a decrease in the concentration of PDP, thereby affecting the synthesis amount of tocopherol. Therefore, the expression level of chlorophyll synthase may significantly affect the utilization efficiency of the substrate PDP. When the expression level of chlorophyll synthase in plants increases, its ability to recycle and utilize PDP enhances, leading to a decrease in tocopherol synthesis and thus a decrease in the tocopherol content. On the contrary, when the expression level of chlorophyll synthase decreases, the recycling efficiency of PDP decreases, promoting the synthesis of tocopherols and increasing the tocopherol content.

[0004] Unlike Arabidopsis thaliana, rapeseed is the oil crop with the largest planting area in China. Rapeseed does not compete with staple grains for land and is mostly planted on winter fallow fields that are not suitable for growing wheat, making it the oil crop with the greatest development potential. Therefore, increasing the concentration of tocopherols in transgenic rapeseed can provide a new approach for the industrial production of vitamin E. Summary of the Invention

[0005] The object of the present invention is to provide a new and innovative germplasm capable of producing high levels of tocopherols to solve the problems existing in the above-mentioned prior art. The present invention uses Brassica napus cv. Jia 9707 (J9707) as the transformation receptor, genetically transforms to obtain the double-copy mutant BnaCHL.a1c1 of the BnaCHL.A1 and BnaCHL.C1 loci, and overexpressing the AtHPT and / or TyrA genes can significantly increase the tocopherol content, providing a new method for increasing the tocopherols in rapeseed by genetic engineering methods.

[0006] The present invention provides a method for creating a new germplasm of high-vitamin E rapeseed using a Brassica napus BnaCHL double mutant. The construction steps of the Brassica napus BnaCHL double mutant are as follows: using BnaCHL.A1 and BnaCHL.C1 as targets, the rapeseed chlorophyll synthase gene BnaCHL is edited using the CRISPR / Cas9 gene editing technology to obtain the double-copy mutant BnaCHL.a1c1, and the AtHPT and / or TyrA genes are overexpressed in the double-copy mutant BnaCHL.a1c1.

[0007] Furthermore, the CDS sequence of the AtHPT gene is as shown in SEQ ID NO.1, and the CDS sequence of the TyrA gene is as shown in SEQ ID NO.2.

[0008] Furthermore, construct an AtHPT overexpression vector and / or a TyrA overexpression vector, and introduce it into the double-copy mutant BnaCHL.a1c1 to obtain a new germplasm of high-vitamin E rapeseed.

[0009] Furthermore, the obtained new germplasm of high-vitamin E rapeseed exhibits some or all of the following:

[0010] A1) The total tocopherol content is significantly increased;

[0011] A2) The γ-tocopherol content is significantly increased;

[0012] A3) The α-tocopherol content is significantly increased;

[0013] A4) Both the γ-tocopherol and α-tocopherol contents are significantly increased.

[0014] The present invention also provides the application of the above method in cultivating high-vitamin E rapeseed varieties.

[0015] Furthermore, the high-vitamin E rapeseed varieties exhibit some or all of the following:

[0016] A1) The total tocopherol content is significantly increased;

[0017] A2) The γ-tocopherol content is significantly increased;

[0018] A3) The α-tocopherol content is significantly increased;

[0019] A4) Both the γ-tocopherol and α-tocopherol contents are significantly increased.

[0020] The present invention also provides the application of any one of the above methods in cultivating rapeseed varieties with high γ-tocopherol content.

[0021] Beneficial effects: The present invention uses Brassica napus J9707 as the transformation receptor, genetically transforms to obtain the double-copy mutant BnaCHL.a1c1 of BnaCHL.A1 and BnaCHL.C1 loci, and on the basis of increasing the tocopherol content in rapeseed, further significantly increases the tocopherol content in rapeseed by overexpressing the AtHPT and / or TyrA genes, especially the contents of α-tocopherol and γ-tocopherol. The newly created rapeseed germplasm with high vitamin E provides a new method for increasing the tocopherol content in rapeseed by genetic engineering methods, and also provides important experimental materials for subsequent research, which helps to promote the development of the rapeseed industry and enhance its application potential in the fields of food and nutritional supplements. Brief Description of the Drawings

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.

[0023] Figure 1 : Comparison of CHLSYN gene sequences between Arabidopsis thaliana and rapeseed;

[0024] Figure 2 : Vector maps used in the experiment: A. AtHPT overexpression vector, B. TyrA overexpression vector;

[0025] Figure 3 : PCR identification of transgenic plants;

[0026] Figure 4 : Tocopherol content in transgenic positive rapeseed seeds overexpressing AtHPT-OE;

[0027] Figure 5 : Average content of tocopherols in transgenic TyrA-positive rapeseed and negative control;

[0028] Figure 6 : Average content of tocopherols in rapeseed of HT line and negative control;

[0029] Figure 7 : High performance liquid chromatography (HPLC) chromatogram. Specific embodiments

[0030] The following examples are only used to more clearly illustrate the technical solutions of the present invention, so they are only used as examples and cannot be used to limit the protection scope of the present invention. It should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should be the commonly understood meanings by those skilled in the art to which the present invention belongs. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0031] Example 1

[0032] The CHLSYN gene of Brassica napus has two copies on the A chromosome genome, namely BnaCHL.A9 and BnaCHL.A1, and two copies on the C chromosome genome, namely BnaCHL.C1 and BnaCHL.C8. The CRISPR / Cas9 gene editing technology is used to edit two copies, BnaCHL.A1 and BnaCHL.C1, of the rapeseed chlorophyll synthase gene (BnaCHL) to obtain the double-copy mutant BnaCHL.a1c1. Although the AtCHLSYN gene also exists in Arabidopsis thaliana, there are certain differences in its gene sequences compared with BnaCHL.A1 and BnaCHL.C1 of Brassica napus. For example Figure 1 as shown, there is an insertion of three bases in BnaCHL.C1 at positions 96-98, and insertions of three bases in both BnaCHL.A1 and BnaCHL.C1 at positions 228-229. Single-base mutations exist at multiple sites such as 28, 35, 49, 72, 82, 125, 603, 637, 663, 1027, 1061, 1064, etc.

[0033] Example 2

[0034] 1. Agrobacterium-mediated genetic transformation of Brassica napus BnaCHL.a1c1 double mutant material

[0035] 1.1 Construction of two overexpression vectors:

[0036] (1) AtHPT overexpression vector: pmd83-napin-HPT( Figure 2 A)

[0037] (2) TyrA overexpression vector: pCAMBIA2300( Figure 2 B)

[0038] Take out the Agrobacterium tumefaciens GV3101 strain stored at -80 °C and perform Agrobacterium transformation on the constructed vector to obtain an Agrobacterium infection solution.

[0039] CDS sequence of the TyrA gene (SEQ ID NO.1):

[0040]

[0041] CDS sequence of AtHPT gene (SEQ ID NO.2):

[0042]

[0043] 1.2 Agrobacterium strains infecting rapeseed hypocotyls

[0044] a) Sterilization: Soak the seeds in 75% alcohol for 1 minute, and then soak in an appropriate amount of 50% 84 solution for 5 minutes. After that, rinse the seeds with sterile water for 4 to 5 times.

[0045] b) Sowing. Sow the sterilized seeds onto the M medium using sterile tweezers. Place the culture medium in a culture box and culture under dim light for 6 days.

[0046] c) Shake the Agrobacterium. Shake the Agrobacterium tumefaciens 5-6 days after sowing. Measure the OD value of the bacterial solution to about 0.4 for infection.

[0047] d) Preparation and infection of explants. Prepare bacterial solution, draw 2 mL of cultured bacterial solution, centrifuge to remove supernatant, add DM solution (with AS) to resuspend. Repeat this step twice and dilute the suspended bacterial solution with 18 mL of DM solution. Cut the explants and cut the hypocotyls of the seedlings with sterile scissors. Put the cut explants into the diluted bacterial solution, immerse for 15 minutes, and absorb the bacterial solution. It is appropriate to have 150 to 200 explants per dish (20 mL bacterial solution) for infection.

[0048] e) Dedifferentiation and redifferentiation of explants. After infection, the explants were blotted dry with sterilized filter paper and transferred to M1 medium. After 2 days of dark light culture, they were transferred to M medium (16 hours of light and 8 hours of dark light culture). After 20 days, they were transferred to M3 medium (16 hours of light / 8 hours of dark light culture). Subculture was performed every 20 days until green buds appeared. The green buds were transferred to M4 medium (16 hours of light / 8 hours of dark light culture) for rooting.

[0049] 2. Identification of transgenic positive plants

[0050] 2.1 Experimental Procedure

[0051] The DNA of transgenic rapeseed was extracted using a rapid leaf DNA extraction method, and two sets of primers were used for PCR identification, and positive plants were selected for phenotypic verification. The two sets of primers were Group A: TyrA-1F and M13-48R; Group B: PMDC 83-T and AtHPT-yz-F. The primers for the control of each transgenic line were as follows: TyrA: Group A primers, AtHPT: Group B primers, HT: Group A primers and Group B primers were used in combination.

[0052] Group A: TyrA-1F: gttactataagcgtttcggcg, M13-48R: AGCGGATAACAATTTC ACACAGGA

[0053] Group B: PMDC83-T: tgagcgcaacgcaattaatgtg, AtHPT-YZ-F: atggagtctctgctctctag

[0054] PCR procedure: Primers in Group A: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 2 min, 34 cycles; final extension at 72°C for 5 min. Primers in Group B: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec, extension at 72°C for 1 min, 34 cycles; final extension at 72°C for 5 min.

[0055] After the PCR products were electrophoresed on 1% agarose gel at 140 V for 15 min, and after detection and identification, the positive single plants and a small number of negative single plants were retained as controls, managed normally in the later stage, and the seeds were harvested for subsequent experiments.

[0056] 2.2 Result statistics

[0057] The identification results are shown in Table 1 and Figure 3 as follows. The total number of plants with AtHPT as the target gene was 82, the number of positive plants was 31, and the positive rate was 37.80%; the total number of plants with TyrA as the target gene was 59, the number of positive plants was 35, and the positive rate was 59.32%; the total number of plants with two copies of AtHPT and TyrA as the target gene was 67, the number of positive plants was 16, and the positive rate was 23.88%.

[0058] Table 1 Identification of transgenic positive plants

[0059]

[0060] 3. Determination of tocopherol content in seeds

[0061] 3.1 Reagent preparation

[0062] A) Extraction solution: Methanol:dichlorobutane (9:1, V:V), both are chromatographically pure grade reagents, and 0.01% BHT (2,6-di-tert-butyl-p-cresol, an antioxidant) is added to the solution

[0063] B) Internal standard: Accurately pipette 50 μL of the standard sample (5,7-dimethyltocol, 50 mg / μL) with a standard syringe, and make up the volume to 500 mL with chromatographically pure n-hexane.

[0064] 3.2 Extraction of rapeseed tocopherol

[0065] a) Weigh about 50 mg of rapeseed (lyophilized rapeseed cotyledons) with an analytical balance accurate to one ten-thousandth into a 2.0 mL centrifuge tube;

[0066] b) Add 1 mL of extraction solution into the tube, then add 1 steel bead, and accurately add 60 μL of internal standard.

[0067] c) Place all samples on the operation board and grind them with a high-throughput tissue grinder for 3 min.

[0068] d) Place the samples on a small shaker and mix them at a frequency of 50 r / min at room temperature for 3 h; centrifuge at 12000 r / min for 20 min, and pipette 400 μL of the supernatant into a special injection vial for measurement.

[0069] e) Samples that cannot be detected on the same day can be stored in a 4 °C refrigerator for one week. For long-term storage, it is necessary to store them at -20 °C.

[0070] (3) Determination of tocopherol content by HPLC

[0071] Use an Agilent 1260 high-performance liquid chromatograph to detect the tocopherol content in Arabidopsis seeds. The chromatographic column is an Agilent Eclipse XBD-C18 column (4.6 mm ID x 15.0 cm, 5 μm); the excitation wavelength of the fluorescence detector is 292 nm, and the emission wavelength is 330 nm. Measure each sample with an Agilent 1260 high-performance liquid chromatograph: the injection volume is 20 μL; the mobile phase is chromatographic-grade methanol and water; 0 - 4 min: methanol: water = 95:5, 4 - 20 min: methanol: water = 100:0; the flow rate is 1.5 mL / min; the column temperature is 40 °C; use ChemStation software to process the measurement results; use the internal standard method to calculate the contents of α, β, γ, and δ tocopherols respectively using the peak areas, and the tocopherol content is the sum of the contents of α, β, γ, and δ tocopherols.

[0072] 3.3 Tocopherol content in each transgenic line

[0073] 1) Detect the tocopherol content in mature and dry seeds by HPLC. The average tocopherol content in AtHPT transgenic positive rapeseed seeds is 443.65 μg / g, the average tocopherol content in transgenic negative seeds is 348.44 μg / g, and the average tocopherol content in wild-type seeds is 289.16 μg / g. The highest tocopherol content in transgenic positive seeds can reach 512.64 μg / g, which is 1.47 times that of the negative control and 1.77 times that of the wild type. The average content is 1.27 times that of the negative control and 1.53 times that of the wild type ( Figure 4 ).

[0074] 2) The average content of tocopherols in TyrA transgenic positive rapeseed seeds was 464.53 μg / g, the average content of tocopherols in transgenic negative seeds was 328.40 μg / g, and the average content of tocopherols in wild-type seeds was 289.16 μg / g. The highest content of tocopherols in transgenic positive seeds could reach 513.77 μg / g, which was 1.56 times that of the negative control and 1.78 times that of the wild-type. The average content was 1.41 times that of the negative control and 1.60 times that of the wild-type ( Figure 5 ).

[0075] 3) The HT line is a transgenic line in which AtHPT and TyrA genes are overexpressed in the background of the BnaCHL.a1c1 double mutant. The average content of tocopherols in the rapeseed seeds of the HT line was 563.66 μg / g, the average content of tocopherols in the control negative seeds was 359.02 μg / g, and the average content of tocopherols in the wild-type seeds was 289.16 μg / g. The content of tocopherols in transgenic positive seeds was 1.57 times that of the negative control and 1.95 times that of the wild-type. The highest content of tocopherols in transgenic positive seeds could reach 591.06 μg / g, which was 1.65 times that of the negative control line and 2.04 times that of the wild-type ( Figure 6 ).

[0076] 3.4 Effects of Transgenes on Tocopherol Components

[0077] According to the HPLC detection results, the detection time for each sample was 20 min. Since the number and position of methyl groups on the cyclic structure of tocopherols with different configurations were different, the peak elution times in the chromatogram were different. Specifically, as Figure 7 shown, the peak around 10 min after injection was δ-tocopherol, the peak around 11 min was the internal standard, the peak around 11.5 min was γ-tocopherol, and the peak around 13 min was α-tocopherol.

[0078] The contents of various tocopherols in different lines are shown in Table 2. The results showed that compared with the wild-type, the AtHPT line and TyrA line overexpressing AtHPT and TyrA respectively slightly increased the contents of γ-tocopherol and α-tocopherol compared with the wild-type, and the change in the content of δ-tocopherol was very small; the co-expression of the two genes in the HT line significantly increased the contents of δ-tocopherol, γ-tocopherol and α-tocopherol.

[0079] Table 2 Contents of Various Tocopherols in Transgenic Lines

[0080]

[0081] In summary, the present invention constructs a double-copy mutant BnaCHL.a1c1 of the BnaCHL.A1 and BnaCHL.C1 loci, and significantly improves the tocopherol content in rapeseed by overexpressing the AtHPT and / or TyrA genes, especially significantly increasing the contents of γ-tocopherol and α-tocopherol therein. The newly created rapeseed germplasm with high vitamin E provides a new method for improving rapeseed tocopherol by genetic engineering methods, and also provides important experimental materials for subsequent research, which helps to promote the development of the rapeseed industry and enhance its application potential in the fields of food and nutritional supplements.

[0082] The above specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solutions of the present invention, and these simple variations all belong to the protection scope of the present invention.

Claims

1. A method for creating a new high-dimensional E rapeseed germplasm using the BnaCHL double mutant of Brassica napus, characterized in that: The steps for constructing the Brassica napus BnaCHL double mutant are as follows: using BnaCHL.A1 and BnaCHL.C1 as targets, editing the rapeseed chlorophyll synthase gene BnaCHL using CRISPR / Cas9 gene editing technology to obtain a double copy mutant BnaCHL.a1c1, and overexpressing AtHPT and / or TyrA genes in the double copy mutant BnaCHL.a1c1.

2. The method according to claim 1, characterized in that The CDS sequence of the AtHPT gene is shown in SEQ ID NO.1, and the CDS sequence of the TyrA gene is shown in SEQ ID NO.

2.

3. The method according to any one of claims 1 to 2, characterized in that: An AtHPT overexpression vector and / or a TyrA overexpression vector were constructed and introduced into the double copy mutant BnaCHL.a1c1 to obtain new high-dimensional E rapeseed germplasm.

4. The method according to any one of claims 1-2, characterized in that: The obtained high-dimensional E rapeseed new germplasm exhibits some or all of the following: A1) Total tocopherol content increased significantly; A2) γ-tocopherol content increased significantly; A3) α-tocopherol content increased significantly; A4) The levels of γ-tocopherol and α-tocopherol were significantly increased.

5. Application of the method according to any one of claims 1 to 4 in breeding high dimensional E rapeseed varieties.

6. The use according to claim 5, characterized in that: High-dimensional E rapeseed varieties exhibit some or all of the following: A1) Total tocopherol content increased significantly; A2) γ-tocopherol content increased significantly; A3) α-tocopherol content increased significantly; A4) The levels of γ-tocopherol and α-tocopherol were significantly increased.

7. Use of the method according to any one of claims 1 to 5 in cultivating rapeseed varieties with high γ-tocopherol content.

Images