Gene Idh1 conditional knockout mouse model and construction method and application of preeclampsia-induced heart injury animal model

Abstract

The invention provides a construction method and application of a gene Idh1 conditional knockout mouse model and a preeclampsia heart injury animal model, and relates to the technical field of biology. According to the preeclampsia heart injury animal model, flox mice with conditional gene Idh1 knockout and mice with placental trophoblast specific expression Cre recombinase comate, PE-related phenotypes and typical symptoms of heart injury spontaneously appear in the double-positive pregnant mouse model, and the double-positive pregnant mouse model can be used for research of disease causes, diagnosis methods and drug research and development.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a method for constructing a conditional knockout mouse model of gene Idh1 and an animal model of heart injury induced by preeclampsia, and applications thereof. Background Art

[0002] Preeclampsia (PE) is defined as new-onset hypertension and new-onset end-organ damage, including proteinuria, in pregnant women after 20 weeks of gestation. When the condition is severe, there may be lesions in multiple organs of the whole body, such as headache, blurred vision, etc. The incidence of PE worldwide is 2-8%, and the incidence in China is about 4.5%. The prevalence of PE accounts for about 2-15% of all pregnancies, and it is one of the important causes of maternal death, preterm birth and neonatal death. PE not only affects the pregnancy outcome, but also causes a high incidence of cardiovascular diseases in pregnant women and their offspring, with an incidence 2-5 times that of normal people. Clinical ultrasound imaging analysis shows that PE patients often have left ventricular hypertrophy during pregnancy, with systolic and diastolic dysfunction with preserved ejection fraction. According to the American Heart Association guidelines, most pregnant women with PE develop class B heart failure. The pathological changes of the heart caused by PE are more severe in preterm PE patients, and about 20% have severe hypertrophic cardiomyopathy, and this proportion increases to 56% one year after delivery. The American Heart Association has listed PE as one of the risk factors for cardiovascular diseases.

[0003] Due to the limitations of medical ethics, animal models are important tools for studying the occurrence and development of PE and exploring preventive and therapeutic measures. The prior art discloses PE animal construction models, including: PE surgical induction models, PE drug induction models, PE gene editing models, and PE spontaneous models, etc.

[0004] The PE surgical induction model reduces uterine blood perfusion by ligating the abdominal aorta or uterine artery of pregnant animals, causing ischemia and hypoxia in the uterine placenta. However, the surgical difficulty is high, the animal survival rate is low, and it is difficult to simulate the phenotype of heart injury caused by PE.

[0005] The PE drug induction model generally gives L-NAME by intraperitoneal injection or drinking water to inhibit nitric oxide synthesis and induce hypertension; and lipopolysaccharide (LPS) is injected intravenously or intraperitoneally to activate the systemic inflammatory response and simulate symptoms similar to PE. However, the above drug induction models can only simulate some PE symptoms, lack the key factors of placental lesions, and also cannot cause heart lesions.

[0006] The PE spontaneous model uses certain strains of animals to spontaneously develop hypertension and proteinuria during pregnancy. However, the incidence is low, the test cycle is long, and the phenotypic individual differences are difficult to control. Moreover, the existing PE spontaneous models have not induced the phenotype of PE with heart injury.

[0007] Currently, there are publicly available gene-edited animal models. For example, by overexpressing sFLT1, overexpressing or knocking out VEGF (vascular endothelial growth factor), etc., the induced phenotypes have problems such as poor pregnancy correlation and insufficient specificity.

[0008] Therefore, the prior art has not truly established a heart injury model caused by PE. Summary of the Invention

[0009] Based on this, it is necessary to provide a method for constructing a conditional knockout mouse model of gene Idh1 and an animal model of preeclampsia (PE) heart injury and its application.

[0010] First of all, it is worth noting that isocitrate dehydrogenase 1 (Idh1 or IDH1) is a key metabolic enzyme mainly present in the cytoplasm and peroxisomes. It can catalyze the oxidative decarboxylation of isocitrate to α-ketoglutaric acid (α-KG), while reducing NADP+ to NADPH. Among them, α-KG, as an intermediate of the TCA cycle, is an important intermediate for generating energy and is also an essential cofactor for dioxygenases (such as histone demethylases and DNA demethylases), regulating epigenetic modifications. NADPH, on the other hand, acts as an antioxidant to maintain the level of reduced glutathione (GSH), resist oxidative stress, and is also involved in the synthesis of fatty acids and cholesterol. At present, there is no literature reporting a substantial association between the deletion or defect of the Idh1 gene and PE.

[0011] The present invention adopts the following technical solutions:

[0012] Through transcriptome analysis of the placentas of PE pregnant women and the placentas of PE pregnant women complicated with heart injury, the present invention screened the significantly down-regulated Idh1 gene and found that by mating flox mice with conditional knockout of the Idh1 gene and mice with specific expression of Cre recombinase in placental trophoblasts, a pregnant mouse model with conditional knockout of the Idh1 gene in the placenta was constructed, and the pregnant mice of the model spontaneously showed PE-related phenotypes and heart injury symptoms. The method for constructing the preeclampsia heart injury animal model of the present invention screens for conditional knockout of exon 3 of the Idh1 gene.

[0013] The present invention specifically provides a method for constructing a conditional knockout mouse model of gene Idh1, including the following steps: obtaining mouse fertilized eggs; constructing a targeting vector for conditional knockout of gene Idh1; injecting Cas9 mRNA, gRNA, and the targeting vector into the nucleus of mouse fertilized eggs to obtain fertilized eggs containing the targeting sequence; transplanting the fertilized eggs containing the targeting sequence into pseudopregnant mice to obtain mice containing the targeting sequence; crossing the mice containing the targeting sequence with wild-type mice to screen positive heterozygous mice containing the targeting sequence, and thus obtaining a conditional knockout mouse model of gene Idh1.

[0014] Preferably, the targeting vector targets the gene Idh1 exon 3. The targeting vector includes a 5' homologous arm, a flox region, and a 3' homologous arm. The sequence of the 5' homologous arm is as shown in SEQ ID NO.4. The sequence of the cko region in the flox region is as shown in SEQ ID NO.5. The sequence of the 3' homologous arm is as shown in SEQ ID NO.6. The gRNA sequences are as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] The present invention also provides a method for constructing an animal model of preeclampsia (PE) heart injury, which includes the following steps: constructing a pregnant mouse model with conditional knockout of the gene Idh1 in the placenta by using a gene Idh1 conditional knockout mouse model and a tool mouse with specific expression of Cre recombinase in placental trophoblasts.

[0016] Preferably, female mice with conditional knockout of the gene Idh1 are hybridized with Cyp19a1-IRES-Cre positive male mice to screen and obtain a pregnant mouse model with conditional knockout of the gene Idh1 in the placenta.

[0017] Use of the above method for constructing an animal model of preeclampsia heart injury in evaluating the efficacy of drugs for preeclampsia heart injury or studying the disease mechanism of preeclampsia heart injury.

[0018] Compared with the prior art, the core technical contribution of the present invention lies in:

[0019] (1) The present invention first discovers and verifies that the gene Idh1 can be used as a target for the diagnosis of PE heart injury.

[0020] (2) The present invention uses the CRISPR / Cas9 technology to construct an animal model with conditional knockout (cKO) of the placental Idh1 gene by mating flox mice with conditional knockout of the gene Idh1 and mice with specific expression of Cre recombinase in placental trophoblasts. The pregnant mice of the model develop typical PE phenotypes such as hypertension, proteinuria, and kidney damage in the middle and late stages, and at the same time, heart injury symptoms such as left ventricular myocardial hypertrophy, heart function damage, increased heart weight, and increased lung weight occur in the heart, indicating that the present invention obtains an animal model of heart injury caused by PE.

[0021] (3) The pregnant mouse model with conditional knockout of the gene Idh1 in the placenta constructed by the present invention can provide a more convenient, reliable, and economical animal model for the pathogenesis of PE heart injury, and can be used to evaluate the efficacy of drugs for preeclampsia heart injury and discover diagnostic targets, etc. Description of the Drawings

[0022] Figure 1Results of transcriptome analysis of placentas from pregnant women with preeclampsia and placentas from pregnant women with preeclampsia complicated with heart injury. Among them, Figure A is a protein interaction network analysis diagram of differentially expressed genes, showing that IDH1 is a key protein among them; Figure B is a heat map of the top 5 differentially expressed genes related to metabolic pathways in GO analysis, showing that IDH1 is one of them.

[0023] Figure 2 Schematic diagram for the construction of placenta-specific single-allele knockout Idh1 mice; among them, Figure A is a schematic diagram for constructing an Idh1 mutant by targeting the wild-type C57BL / 6 gene mouse Idh1 exon 3 to cause single-allele knockout of Idh1; Figure B is the construction strategy for constructing a mouse model with placenta-specific knockout of Idh1 exon 3; Figure C is Cyp19 Cre / + (Cre / +) and Cyp19 Cre / + / Idh1 fl / + Genotype identification results of (cKO) placentas, WT: wild type, without insertion of Loxp site, PCR product size is 140bp; Mut: mutant with insertion of Loxp1 site, PCR product size is 208bp; the desired Idh1 mouse is one with both 208bp band and 140bp band; fl / + Figure D is the WB detection results of Idh1 protein expression in Cre / + and cKO genotype placentas (pl), fetal mice (fetal), and maternal mouse hearts (heart); Figure E is the immunohistochemical staining results of Cre / + and cKO genotype placentas, and brownish-yellow staining shows the expression of IDH1 protein in the placenta. fl / + Figure D is the WB detection results of Idh1 protein expression in Cre / + and cKO genotype placentas (pl), fetal mice (fetal), and maternal mouse hearts (heart); Figure E is the immunohistochemical staining results of Cre / + and cKO genotype placentas, and brownish-yellow staining shows the expression of IDH1 protein in the placenta.

[0024] Figure 3 Statistical results of PE-related phenotypes in pregnant mice caused by specifically knocking out a single allele of Idh1 in the placenta; among them, Figure A is a schematic diagram for constructing the breeding models of the experimental group and the experimental control group; Figure B is the statistical chart of the monitoring results of the systolic blood pressure of Idh1 fl / + (×Cyp19 Cre / Cre ) and Idh1 fl / + (×Idh1 fl / + ) in two groups of mice during pregnancy; Figure C is the statistical chart of the placental, fetal images, placenta weight, and fetal weight of Idh1 fl / fl , Cyp19 Cre / + and cKO genotypes at E17.5 days of pregnancy; Figure D is the HE staining results of cKO and Cyp19 Cre / + placentas; Figure E is the Idh1 fl / + (baseline), Idh1 fl / +(×Idh1 fl / + ) and Idh1 fl / + (×Cyp19 Cre / Cre ) Statistical charts of urinary protein levels and kidney HE staining results of three groups of mice.

[0025] Figure 4 Statistics on the changes in the cardiac phenotypes of pregnant mice after specific single-allele knockout of Idh1 in the placenta. Among them, Figure A is the representative HE staining of the heart and the echocardiogram; Figure B is the statistical chart of the left ventricular posterior wall thickness (LVPW), left ventricular volume (LVvol), left ventricular internal diameter (LVID), ejection fraction, and fractional shortening of the left ventricle during systole and diastole of three groups of mice; Figure C is the statistical chart of the heart weight, heart weight / tibial length ratio, and lung weight of three groups of mice; Figure D is Idh1 fl / + (×Cyp19 Cre / Cre ) and Idh1 fl / + (×Idh1 fl / + ) WGA staining results of cardiac tissue sections of two groups of pregnant mice. The green fluorescence is the cell membrane labeled by WGA, and the blue fluorescence is DAPI; Figure E is the Sirius red staining result of mouse cardiac tissue sections.

[0026] Figure 5 Plasmid map of the vector containing the targeting sequence. Detailed implementation manners

[0027] The present invention will be further described in detail below in conjunction with specific embodiments, so that those skilled in the art can understand the present invention more clearly. The following embodiments are only used to illustrate the present invention, but not to limit the scope of the present invention. Based on the specific embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. In the embodiments of the present invention, unless otherwise specified, all raw material components are commercially available products well-known to those skilled in the art; in the embodiments of the present invention, unless specifically specified, the technical means used are all conventional means well-known to those skilled in the art.

[0028] See Figure 1 , the inventor team found through transcriptome analysis of the placentas of PE pregnant women and the placentas of PE pregnant women with cardiac injury that: in the protein-protein interaction network analysis diagram of differentially expressed genes, IDH1 (Idh1) is shown as a key protein; in the heat map of the top 5 differentially expressed genes related to metabolic pathways in the GO analysis, the gene Idh1 is one of them.

[0029] The inventor team further analyzed the Idh1 gene and determined that the mouse Idh1 gene is located on chromosome 1, and 12 exons were identified. Among them, the ATG start codon is located in exon 2, and the TAA stop codon is located in exon 9. Through a large number of analysis and research, exon 3 with a coding sequence of 292bp was locked for conditional knockout.

[0030] The following experiments were carried out for the transcript Idh1-203: ENSMUST00000169032. For further reference, see Figure 2 Figure A in [reference], and the partial intron 2 region, exon 3 region and partial intron 3 region of the Idh1 gene were selected for knockout. The total knockout region (ckoregion) is 1103bp. The knockout of exon 3 will cause gene frameshift and cover 23.51% of the coding region.

[0031] The specific nucleotide sequence is as follows:

[0032]

[0033]

[0034] Among them, the bold part is the loxP region, and the underlined part is the exon 3 coding sequence.

[0035] Example 1

[0036] This example provides a method for constructing a conditional knockout mouse model of the Idh1 gene, which includes the following steps:

[0037] (1) Design gRNA

[0038] Design gRNA for the target gene sequence (mainly using http: / / crispr.mit.edu / and http: / / www.rgenome.net / cas-designer / for design):

[0039] gRNA-B1: TTATGATGGGACAATAAGGTTGG (SEQ ID NO.2);

[0040] gRNA-B2: AAATTTCACTGGCTCTATGGTGG (SEQ ID NO.3).

[0041] (2) Entrust to construct the targeting sequence and homologous recombination vector (donor vector):

[0042] Construct the targeting sequence, including the 5' homologous arm (5'arm), flox region and 3' homologous arm (3'arm). The plasmid map is shown inFigure 5 。

[0043] The targeting vector, together with gRNA and Cas9 mRNA, was constructed to obtain the homologous recombination vector by the method of In-Fusion cloning.

[0044] Among them, the sequence of the 5' homologous arm is:

[0045]

[0046] GAAAATGTTGTCCACATTCCCTGTGGAGTTGAGATTGTTATATCTATAGA

[0047] TATTCAGCATTCCCTAGGCACAAAGGACAAGAAAGTGCGTGGCTCTGT

[0048] TATGTGCATATGAATTCTCTAAAGCTGAAGCAGAAAATAGTTTTGTTTG

[0049] GAAACACAAAGCCCCTCTCCCTGTGTTTGCACCAGCGGTTGGGATAGG

[0050] TCAGGACAGGAAGACAAACCCTGAGAAGAGAAAGGCAGCTTAGTTAT

[0051] TAGCTAGTGTGGAGAGCTGAGGCTTTCCTGTAAGGCCATGGAGAGCAA

[0052] AGTAAATCGCTTAGTGATTTTGTGTATGTTTAAGATGTTTAAGGATTTTG

[0053] TGTATGTTTAAGGTATTTTTTTTTTTTTTTTGGCTGGGGAGTATCTGGTTT

[0054] GGTTTTTGTTTTGTGTTTTGGTTTGTTTGTTTGTTTGTTTGTTTTCTGGC

[0055] TTTTTCAAAACAGCTGTGGGTGTCTGAGTATGTCTGTGTGTGAGTAGCC

[0056] CTGGCTGCCCTGGAACTTGCTCTGTAACTCAGGCTGGCCTCACACTCA

[0057] AGAGATTTTCCCCCTGCCTCTGCCTTCCAAGTGCTGAGATTAAAGAAA

[0058] AGGTGTGCACCAGCACCTCCCAACTTGTATTACTTTTAGTAAACCATTA

[0059] TGTACTTAAGCTTTCCCATGATTTTCTATGCTCTGTGGACAGCCAGCATC

[0060] CATTCATTCCTCTGTGAATAGTCTGGACCATGGGAGCTGTGCTAAATAC

[0061] TGTGTATACAAGATGGTTGGTGGATTCCATTGCTTATCCAATAAACTACA

[0062] GGCTTGGTTCGAGAACAAAGAGACTTACCAAGATGTAGGGGAAGGTT

[0063] CACCCTATGACTAACTGGCTCTAACAAAAGAGTTCTCAGCTCTTTTGGC

[0064] ACGGATCGGCAAGAGCTAACCTTCCCACCACTTGAGTACCAGAAATAC

[0065] AAACCAGCCCTTTAATCCTTTCACCTTACCGCCTCATTACTTACAGAGTATAAAACTTATGATGG(SEQ ID NO.4).

[0066] Loxp site sequence: ATAACTTCGTATAATGTATGCTATACGAAGTTAT.

[0067] Sequence of the cko region:

[0068]

[0069] The sequence of the 3' homologous arm is:

[0070]

[0071] (3) Microinjection

[0072] Under an inverted microscope with magnification of 200-400, Cas9 mRNA, gRNA, and targeting vector injection solution were injected into the nucleus of mouse fertilized eggs by microinjection, transferred to M16 culture medium, and placed in a 37°C constant temperature 5% CO 2 In the incubator, fertilized eggs containing the targeting sequence are obtained.

[0073] In this step, the method for obtaining mouse fertilized eggs is as follows: 3-4 week old C57BL / 6 female mice (Guangzhou Jinwei Biotechnology Co., Ltd.) are selected, and pregnant mare serum (PMSG) and human chorionic gonadotropin (HCG) are injected respectively, with an interval of 46-48 hours between the two; after the injection of HCG, the female mice are mated with adult fertile male mice (Guangzhou Jinwei Biotechnology Co., Ltd.) to fertilize the female mice; the fertilized female mice are euthanized the next day, and the mouse fertilized egg samples are collected from the oviducts and placed in a constant temperature of 37°C and 5% CO 2 Keep in the incubator for later use. For microinjection experiments, select fertilized eggs with normal morphology and place them in the injection dish.

[0074] (4) Transplantation

[0075] The fertilized eggs containing the targeting sequence are selected and transplanted into the oviducts of pseudo-pregnant mice on the day of thrombosis to obtain mice containing the targeting sequence.

[0076] In this step, the preparation method of pseudo-pregnant female mice is as follows: fertile female mice of appropriate age are selected to mate with male mice that have been sterilized after vasectomy, so as to stimulate a series of pregnancy changes in the female mice and obtain pseudo-pregnant female mice, which serve as surrogate mice for the genetically modified fertilized eggs.

[0077] (5) Screening of heterozygous F0 mice containing positive targeting sequences

[0078] The above-mentioned mice containing the targeting sequence were caged with wild-type mice (Guangzhou Jinwei Biotechnology Co., Ltd.) at a male-to-female ratio of 1:2. The mice were 10 weeks old and mated to obtain F0 generation homozygous mice. The F0 generation homozygous mice were identified and positive heterozygous mice containing the targeting sequence were screened to obtain the Idh1 gene conditional knockout mouse model.

[0079] Identification primers include:

[0080] LoxP-1 identification primers:

[0081] Region1 F: 5'-CCCACCACTTGAGTACCAGAAATA-3' (SEQ ID NO. 7); Region 1 R: 5'-CTGTCCACACAACTAGCAAACAAA-3 (SEQ ID NO. 8).

[0082] LoxP-2 identification primers:

[0083] Region2 F: 5’-ACTTCTAGTATTTGAGTCCCACCA-3’ (SEQ ID NO.9); Region2 R: 5’-ACTGGGTGACTTTCTCTTTATCCA-3’ (SEQ ID NO.10).

[0084] System preparation (using Premix Taq Polymerase: Vazyme, P222)

[0085] Component Dosage (μL) Mouse tail genomic DNA 1 Forward primer (10μM) 1 Reverse primer (10μM) 1 Premix Taq Polymerase 12.5 <![CDATA[ddH 2 O]]> 9.5 Total 25

[0086] Amplification program:

[0087]

[0088] Use the region1 primer pair to screen for the insertion of the loxp1 site in the Idh1 of F0 generation mice. The identification results are as shown in Figure 2 Figure C in.

[0089] Wild type (WT): No Loxp site is inserted, and the size of the PCR product is 140bp;

[0090] Mutant (Mut): Mutant with the insertion of the Loxp1 site, and the size of the PCR product is 208bp.

[0091] Having both the 208bp band and the 140bp band means the flox mice with the conditional knockout of the Idh1 gene are constructed, denoted as Idh1 fl+ / - mice.

[0092] Example 2

[0093] This example provides a method for constructing a mouse model of heart injury induced by preeclampsia. The Idh1 fl / + female mice prepared in Example 1 are caged and mated with male mice of the C57BL / 6 strain that are homozygous positive for the Cyp19a1-IRES-Cre recombinase (Cyp19 Cre / Cre male mice, mice with homozygous expression of the Cre recombinase driven by the Cyp19a1 promoter specifically expressed in placental trophoblast cells, Cyagen Biosciences Inc.). This will produce placentas and fetal mice of two genotypes, Cyp19 Cre / + (Cre / +) and Cyp19 Cre / + Idh1 fl / + (cKO).

[0094] By synchronously monitoring Idh1fl / + During pregnancy in female mice, hypertension, proteinuria, myocardium, and cardiac function occur. For E17.5 Idh1 fl / + Genotyping was performed on the fetal mice of female mice, and the genotyping results showed both IDH1 flox / + and Cre positive, indicating conditional single-allele knockout of the gene Idh1 in the placenta. For details, see Figure 2 Strategy for obtaining a mouse model of PE heart injury in Figure B.

[0095] In this example, a control experiment was also set up. Specifically, Idh1 fl / + female mice were divided into three groups:

[0096] The first group was designated as the control group Idh1 fl / + (baseline): Idh1 fl / + female mice were not treated and were included in the baseline control group;

[0097] The second group was designated as the experimental group Idh1 fl / + (×Idh1 fl / + ): Idh1 fl / + female mice and Idh1 fl / + male mice were caged together as the pregnant control group;

[0098] The third group was designated as the experimental group Idh1 fl / + (×Cyp19 Cre / Cre ) [which can also be simply referred to as cKO]: Idh1 fl / + female mice and Cyp19 Cre / Cre male mice were caged together as the experimental group.

[0099] For the latter two groups, the cohabitation ratio was 1:2 for male and female mice, with a mouse age of 10 - 12 weeks. The vaginal plug was examined the next morning and recorded as E0.5 days of pregnancy. In the two groups, the pregnant mice were continuously monitored for blood pressure and urine collection every two days during pregnancy. On E17.5 days of pregnancy, the late pregnancy blood pressure and ultrasound data were recorded, the mice were sacrificed, and the heart weight, lung weight, and tibia length of the mother mice were recorded; the number and weight of the placentas of the fetal mice were recorded and photographed. The heart, kidney, urine, placenta, and fetal pups of the mother mice were collected. Genotyping was performed on the fetal pup tissues. The paraffin sections of the mother mice's hearts were subsequently stained with HE, WGA, isolectin B4, and Sirius red respectively; the kidney sections and placenta sections of the mother mice were stained with HE to observe the morphology; immunofluorescence staining experiments were performed on the placenta sections to verify the specific single-allele knockout of Idh1 exon 3 in placental trophoblast cells. The placenta and fetal pup tissues were collected, and proteins were extracted for Western Blot experiments to verify the specific single-allele knockout of Idh1 exon 3 in the placenta.

[0100] Among them, the method for genotyping Cre recombinase-positive mice:

[0101] Primers for Region1 PCR: (Annealing Temperature 62.0℃; Taq for P222-C2);

[0102] P1: 5’-TACACTTTTGAGACGATTCCAGGT-3’ (SEQ ID NO.11);

[0103] P2: 5’-CTAGGAATGCTCGTCAAGAAGACAG-3 (SEQ ID NO.12).

[0104] The system and amplification program are the same as the above table.

[0105] The annealing temperature is 62℃ for all. The region1 primers are used to screen whether mice carry the Cre element. WT: does not contain Cyp19a1-IRES-Cre, and PCR amplification cannot be carried out; MT: contains Cyp19a1-IRES-Cre, and the size of the PCR product is 337bp. The identification results are as Figure 2 shown.

[0106] As can be seen from Figure 2 Figure D in: The IDH1 protein level in the placenta of cKO pregnant mice is significantly lower than that in the placenta of Cre / +. The expression level of IDH1 in the maternal heart is not affected by the knockout.

[0107] As can be seen from Figure 2 Figure E in: Compared with the placenta of Cre / + pregnant mice, the expression of IDH1 protein level is down-regulated in the trophoblast cells of the labyrinth zone in the placenta of cKO pregnant mice.

[0108] Idh1 in different groups fl / + The detection results of physiological and biochemical indexes of female mice are shown in Figure 3 and Figure 4 .

[0109] As can be seen from Figure 3 Figure B in: In the experimental group Idh1 fl / + (×Cyp19 Cre / Cre ) the blood pressure of Idh1 fl / + pregnant mice increases in the middle and late stages. Specifically, the blood pressure of Idh1 fl / + (×Cyp19 Cre / Cre ) group mice starts to increase significantly from E11.5 of pregnancy and remains hypertensive in the late pregnancy.

[0110] As can be seen from Figure 3As can be seen from Figure C: In terms of placental and fetal morphology, the placentas and fetuses produced by the cKO experimental group were smaller in size and significantly lower in weight, indicating a problem of growth restriction.

[0111] From Figure 3 Figure D, it can be seen that the cKO placenta was thinner, and the spongiotrophoblast in the junctional zone (JZ) invaded the labyrinth zone (LZ).

[0112] From Figure 3 Figure E, it can be seen that compared with the control group of Idh1 fl / + (baseline), the urinary protein content in the experimental group of Idh1 fl / + (×dh1 fl / + ) decreased in the late pregnancy. The urinary protein content in the experimental group of Idh1 fl / + (×Cyp19 Cre / Cre ) increased significantly in the late pregnancy, and the HE staining results of the kidneys showed morphological abnormalities (indicated by arrows), with a narrowing of the Bowman's capsule space and occlusion of the capillary lumen.

[0113] From Figure 4 Figure A, it can be seen that compared with the control group of Idh1 fl / + (baseline), the left ventricular wall and interventricular septum of pregnant mice in the cKO experimental group were thickened. The B-ultrasound images showed an increase in the thickness and inner diameter of the posterior wall of the left ventricle during systole and diastole of the heart, as well as an increase in volume, resulting in pathological hypertrophy of the mouse heart.

[0114] From Figure 4 Figure B, it can be further seen that the ejection fraction and fractional shortening rate of the hearts of pregnant mice in the cKO experimental group decreased, causing damage to cardiac function during pregnancy.

[0115] From Figure 4 Figure C, it can be seen that the heart and lung weights and the ratio of heart weight to tibia length of pregnant mice in the cKO experimental group increased, further verifying myocardial hypertrophy and impaired cardiac function during pregnancy.

[0116] From Figure 4 Figure D, it can be seen that by staining the cardiac tissue sections with WGA to show the outlines of cardiomyocytes, it was found that the single-allele knockout of Idh1 led to an increase in the volume of cardiomyocytes in the hearts of pregnant mice.

[0117] Staining with Sirius red showed that myocardial fibrosis occurred in the hearts of pregnant mice in the cKO experimental group, and the fibrotic area increased relative to the experimental group of Idh1 fl / + (×dh1 fl / + ). The red-stained part is collagen fiber precipitation, and the yellow-stained part is other tissues of the heart.

[0118] The above experimental results indicate that Idh1 fl / + (×Cyp19 Cre / Cre)Mice simultaneously exhibit elevated blood pressure and elevated urinary protein during pregnancy, and also show kidney damage, myocardial hypertrophy, and cardiac function impairment.

[0119] Furthermore, the following conclusions can also be drawn: Idh1 can be used as a target for PE, for the diagnosis, treatment, or prevention of PE, for the development of drugs for preventing and treating PE, and for constructing animal models of PE-induced heart injury.

[0120] It is worth emphasizing that the essence of the present invention lies in providing a method for constructing a conditional knockout mouse model of the gene Idh1 and a mouse animal model of PE-induced heart injury, to more stably obtain PE-related phenotypes and heart injury phenotypes. Specifically, Cas9 mRNA, gRNA, and a homologous recombination vector containing the targeting sequence are microinjected into the fertilized eggs of C57BL / 6J mice, and the fertilized eggs are transplanted into pseudopregnant mice to obtain mice containing the IDH1 targeting sequence; the mice containing the IDH1 targeting sequence are crossed with wild-type mice to obtain heterozygous mice F0 generation containing the targeting sequence; the obtained heterozygous mice F0 generation containing the IDH1 targeting sequence (conditional knockout mouse model of the gene Idh1) are crossed with Cyp19a1-IRES-Cre positive mice. By mating flox mice with conditional knockout of the Idh1 exon 3 gene and mice specifically expressing Cre recombinase in placental trophoblasts, a single allelic knockout of the Idh1 exon 3 gene occurs in the trophoblasts of the placenta of pregnant mice. By detecting various physiological indicators, it is found that the pregnant mouse model with conditional knockout of the gene Idh1 in the placenta exhibits typical PE phenotypes such as hypertension, proteinuria, and kidney damage, and at the same time, myocardial hypertrophy and cardiac function impairment occur in the heart, that is, an animal model of PE-induced heart injury is obtained. The present invention constructs a conditional knockout (cKO) pregnant mouse model of the IDH1 gene, and uses this cKO pregnant mouse to provide a convenient, reliable, and economical animal model for the pathogenesis of PE-induced heart injury.

[0121] The above-mentioned conditional knockout pregnant mouse model of the gene Idh1 is an animal model of PE-induced cardiac function impairment, and its applications include but are not limited to drug screening, evaluation of treatment effects, discovery of diagnostic targets, etc.

[0122] It is necessary to point out here that the above embodiments are only for further elaboration and explanation of the technical solution of the present invention, and do not further limit the technical solution of the present invention. The method of the present invention is only a preferred implementation, and is not used to limit the protection scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for constructing a gene Idh1 conditional knockout mouse model, characterized in that: The steps include: Obtain mouse fertilized eggs; Construct a targeting vector for conditional knockout of the gene Idh1; Inject Cas9 mRNA, gRNA, and targeting vector into the nucleus of mouse fertilized eggs to obtain fertilized eggs containing the targeting sequence; Transplanting the fertilized eggs containing the targeting sequence into pseudo-pregnant mice to obtain mice containing the targeting sequence; The mice containing the targeting sequence are hybridized with wild-type mice, and the heterozygous mice containing the targeting sequence are screened to obtain the Idh1 conditional knockout mouse model.

2. The method for constructing the Idh1 conditional knockout mouse model according to claim 1, characterized in that: The targeting vector targets gene Idh1 exon 3.

3. The method for constructing the Idh1 conditional knockout mouse model according to claim 2, characterized in that: The gRNA sequences are shown as SEQ ID NO.2 and SEQ ID NO.

3.

4. The method for constructing the Idh1 conditional knockout mouse model according to claim 2, characterized in that: The targeting vector comprises a 5' homology arm, a flox region and a 3' homology arm, the sequence of the 5' homology arm is shown in SEQ ID NO.4, the sequence of the cko region in the flox region is shown in SEQ ID NO.5, and the sequence of the 3' homology arm is shown in SEQ ID NO.

6.

5. The method for constructing the Idh1 conditional knockout mouse model according to claim 4, characterized in that: The identification primers used to screen positive heterozygous mice containing the target sequence include: The sequences of the primers for LoxP-1 identification are shown in SEQ ID NO.7 and SEQ ID NO.8; The sequences of the LoxP-2 identification primers are shown in SEQ ID NO.9 and SEQ ID NO.

10.

6. A method for constructing an animal model of preeclampsia with cardiac damage, characterized in that: The steps include: Using the method for constructing a gene Idh1 conditional knockout mouse model according to any one of claims 1 to 5, screening and obtaining heterozygous mice that positively contain the targeting sequence; The positive heterozygous female mice containing the targeting sequence were crossed with the positive Cyp19a1-IRES-Cre male mice, and the placental conditional knockout gene Idh1 pregnant mouse model was screened based on whether PE-related phenotypes and cardiac injury symptoms spontaneously appeared.

7. The method for constructing an animal model of preeclampsia heart damage according to claim 6, characterized in that: The positive identification primer sequences of the placental conditional knockout gene Idh1 pregnant mouse model are shown in SEQ ID NO.11 and SEQ ID NO.

12.

8. Use of the method for constructing an animal model of cardiac injury in preeclampsia according to any one of claims 6 or 7 in evaluating the efficacy of drugs for cardiac injury in preeclampsia or studying the disease mechanism of cardiac injury in preeclampsia.

Images