Application of preparation for overexpressing SIX2 gene in preparation of reagent for promoting phenotypic transformation of microglial cells

Abstract

The invention belongs to the technical field of biological pharmacy, and particularly relates to application of a preparation of an overexpressed SIX2 gene in preparation of a reagent for promoting phenotypic transformation of microglial cells, and the nucleotide sequence of the SIX2 gene is as shown in SEQ ID NO.1; the phenotypic transformation refers to phenotypic polarization from a pro-inflammatory M1 type to an anti-inflammatory M2 type. In-vivo and in-vitro experiments prove that when Six2 is knocked down, the expression of M1 type microglial cell markers is increased, and the expression of M2 type markers is reduced; the expression of an overexpressed Six2M1 type microglial cell marker is reduced, and the expression of an M2 type marker is increased, so that the overexpressed SIX2 can promote the phenotype polarization of the microglial cell from a pro-inflammatory M1 type to an anti-inflammatory M2 type, thereby protecting DA cells. The invention proves the neuroinflammation inhibition effect of SIX2 as an endogenous anti-inflammatory factor by regulating microglial cell polarization for the first time, and can provide a new thought for research and development of central inflammation inhibition drugs and discovery of PD treatment targets.

Description

Technical Field

[0001] The present invention relates to the technical field of biopharmaceuticals, and particularly relates to the application of a preparation overexpressing the SIX2 gene in the preparation of a reagent for promoting the phenotypic transformation of microglia. Background Art

[0002] Parkinson's disease, with the English name Parkinson’s disease and abbreviated as PD, is a common neurodegenerative disease. The incidence of PD in people over 65 years old is about 1% - 3%. The main pathological feature of PD is the progressive degeneration and death of dopamine (abbreviated as DA) - producing neurons in the substantia nigra pars compacta of the midbrain. As a result, the dopamine content in the striatum is significantly reduced, leading to motor disorders mainly characterized by resting tremor and bradykinesia, combined with non - motor symptoms such as olfactory loss, sleep and cognitive impairment. So far, drugs mainly based on levodopa and surgical therapies only temporarily relieve symptoms and have significant side effects, and cannot slow down or reverse the progressive death of DA - producing neurons. The pathogenic mechanism of PD is complex and diverse. A large number of studies have shown that neuroinflammation plays an important role in the onset and progression of PD.

[0003] Microglia are the main immune cells in the central nervous system. Under physiological conditions, microglia monitor the brain parenchyma by continuously stretching and retracting cell processes to maintain the homeostasis of the central nervous system. Once stimulated, microglia are activated and exhibit two phenotypes: pro - inflammatory M1 and anti - inflammatory M2. M1 - type microglia activate signal pathways such as NF - κB through the Toll - like receptor family, interferon - γ, granulocyte - macrophage colony - stimulating factor receptor, promote the expression of specific differentiation markers CD16 / 32 and major histocompatibility complex class II, and release factors such as TNF - α, IL - 6 and iNOS to trigger an inflammatory response, thus leading to the damage and degeneration of neurons. Moreover, damage - associated molecules released by dead neurons also induce the production of reactive oxygen species and reactive nitrogen species, further amplifying the inflammatory response. M2 - type microglia produce high levels of Arg - 1, IL - 10 and CD206, and simultaneously secrete vascular endothelial growth factor and brain - derived neurotrophic factor to promote the repair of surrounding cells and tissues.

[0004] Autopsy results of PD patients showed that microglia in the brain tissue were abnormally activated, and the expression levels of inflammatory mediators such as IL-1β, IL-6, and TNF-α were significantly increased. These pathological results were reproduced in model mice induced by 6-OHDA, MPTP, and α-synuclein. Another study showed that the severity of PD was positively correlated with the degree of glial cell activation, suggesting that DAergic neurons could be protected by inhibiting microglial activation. However, clinical trials found that simply inhibiting the inflammatory response caused by the activation of M1 microglia was not sufficient to exert neuroprotective effects. Some studies showed that there was a phenotypic transformation of microglia during the progression of PD. In the early stage of PD model mice induced by long-term injection of MPTP, the number of M2 microglia was significantly more than that of M1 microglia. As the drug was gradually injected, the number of M1 cells increased significantly, while the number of M2 cells decreased significantly. This phenotypic transformation may be due to the negative effect of continuous cell damage exceeding the endogenous anti-inflammatory ability of the cells. Another study showed that culturing DAergic neurons with the conditioned medium of M1 microglia would lead to a large number of cell deaths, while the conditioned medium from the mixture of M1 and M2 microglia partially reversed the neurotoxicity produced by M1 microglia.

[0005] In summary, it is necessary to develop a preparation that promotes the polarization of microglia from the M1 to the M2 phenotype for the treatment of Parkinson's disease. Summary of the Invention

[0006] To solve the above problems, the present invention provides the application of a preparation overexpressing the SIX2 gene in the preparation of a reagent for promoting the phenotypic transformation of microglia for the treatment of Parkinson's disease.

[0007] The present invention is achieved by the following technical solutions:

[0008] The application of a preparation overexpressing the SIX2 gene in the preparation of a reagent for promoting the phenotypic transformation of microglia, wherein the nucleotide sequence of the SIX2 gene is as shown in SEQ ID NO.1; the phenotypic transformation refers to the polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype.

[0009] Preferably, the preparation includes a recombinant lentiviral vector overexpressing the SIX2 gene.

[0010] Preferably, the specific construction method of the recombinant lentiviral vector overexpressing the SIX2 gene is: performing PCR amplification on the SIX2 gene fragment using specific primer pairs, ligating the gel product after recovery with the lentiviral vector to form a recombinant plasmid; transforming the recombinant plasmid into a host cell for amplification; screening and identifying to obtain the recombinant lentiviral vector overexpressing the SIX2 gene.

[0011] Preferably, the upstream primer of the specific primer pair is as shown in SEQ ID NO.2, and the downstream primer is as shown in SEQ ID NO.3.

[0012] Preferably, the host cell is UltraStable competent cell.

[0013] Preferably, the preparation further comprises pharmaceutically acceptable excipients.

[0014] Preferably, the pharmaceutically acceptable excipients are one or more of diluents, disintegrants, precipitation inhibitors, glidants, binders, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives and stabilizers.

[0015] Preferably, the acceptable dosage forms of the preparation include tablets, capsules, granules, injections, pills, powders or ointments.

[0016] Preferably, the microglia are mouse microglial cell line BV-2 cells.

[0017] A drug for treating Parkinson's disease by promoting the polarization of microglia from pro-inflammatory M1 type to anti-inflammatory M2 phenotype, the drug comprising the said preparation and pharmaceutically acceptable excipients.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] Application of a preparation overexpressing SIX2 gene in the preparation of a reagent for promoting microglial phenotype transformation, the nucleotide sequence of the SIX2 gene being as shown in SEQ ID NO.1; the phenotype transformation refers to polarization from pro-inflammatory M1 type to anti-inflammatory M2 phenotype. The present invention proves through in vivo and in vitro experiments that knocking down Six2 increases the expression of M1-type microglial markers and decreases the expression of M2-type markers; while overexpressing Six2 decreases the expression of M1-type microglial markers and increases the expression of M2-type markers, indicating that overexpressing SIX2 can protect DA cells by promoting the polarization of microglia from pro-inflammatory M1 type to anti-inflammatory M2 phenotype. The present invention for the first time confirms the role of SIX2 as an endogenous anti-inflammatory factor in inhibiting neuroinflammation by regulating microglial polarization, which can provide new ideas for the research and development of central anti-inflammatory drugs and the discovery of PD treatment targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0021] Figure 1 In the present invention, SIX2 is highly expressed in microglia under inflammatory stimulation.

[0022] Figure 1 In (the figure), A is the strip diagram of the protein expression level of SIX2 in BV-2 cells under LPS stimulation detected by Western blot; B is the statistical chart of the protein expression level of SIX2 in BV-2 cells under LPS stimulation detected by Western blot; C is the immunofluorescence detection of the Iba-1 staining of primary microglia, the green is the Iba-1 positive cells, and the blue is the DAPI-stained nucleus; D is the statistical chart of the immunofluorescence detection of the Iba-1 staining of primary microglia, the proportion of Iba-1 positive cells reaches 98.5%, Bar = 100μm; E is the immunofluorescence detection of the staining of SIX2 protein in primary microglia, Bar = 100μm; F is the statistical chart of the immunofluorescence detection of the staining of SIX2 protein in primary microglia, the fluorescence intensity is analyzed using Image J, PMM, primary murine microglia, *P<0.05, **P<0.01.

[0023] Figure 2 In the present invention, knocking down SIX2 promotes the polarization of inflammatory-induced microglia to the M1 phenotype.

[0024] Figure 2In it, A is the Western blot detection chart of the expression level of SIX2 protein after knocking down Six2; B is the statistical chart corresponding to the expression level of SIX2 protein after knocking down Six2 detected by Western blot; C is the immunofluorescence detection of the staining of F-actin after knocking down Six2 under inflammatory stimulation, Bar = 10μm; D is the statistical chart corresponding to the immunofluorescence detection of the staining of F-actin after knocking down Six2 under inflammatory stimulation, using Image J to quantify the cell body size; E is the Real-time PCR detection of the mRNA expression of M1 microglial cell molecular markers TNF-α, CD16, IL-6 and iNOS after knocking down Six2 under inflammatory stimulation; F is the Real-time PCR detection of the mRNA expression of M2 microglial cell molecular markers Arg-1, CD206 and IL-10 after knocking down Six2 under inflammatory stimulation; G is the Western blot detection of the protein expression of iNOS and Arg-1 after knocking down Six2 under inflammatory stimulation; H is the statistical chart of the protein expression of iNOS after knocking down Six2 detected by Western blot under inflammatory stimulation; I is the statistical chart of the protein expression of Arg-1 after knocking down Six2 detected by Western blot under inflammatory stimulation; J is the ELISA detection of the secretion of TNF-α after knocking down Six2 under inflammatory stimulation; K is the ELISA detection of the secretion of IL-10 after knocking down Six2 under inflammatory stimulation. n = 3, *P<0.05, **P<0.01.

[0025] Figure 3 Overexpression of SIX2 in the present invention promotes the polarization of inflammatory-induced microglia from the M1 type to the M2 type.

[0026] Figure 3In it, A is the expression level of SIX2 protein detected by Western blot after overexpression of Six2; B is the statistical chart corresponding to the expression level of SIX2 protein detected by Western blot after overexpression of Six2. C is the staining of F-actin detected by immunofluorescence after overexpression of Six2 under inflammatory stimulation, Bar = 10 μm. Image J was used to quantify the cell body size; D is the statistical chart corresponding to the staining of F-actin detected by immunofluorescence after overexpression of Six2 under inflammatory stimulation; E is the mRNA expression of M1 microglia molecular markers TNF-α, CD16, IL-6 and iNOS detected by Real-time PCR after overexpression of Six2 under inflammatory stimulation; F is the mRNA expression of M2 microglia molecular markers Arg-1, CD206 and IL-10 detected by Real-time PCR after overexpression of Six2 under inflammatory stimulation; G is the protein expression map of iNOS and Arg-1 detected by Western blot after overexpression of Six2 under inflammatory stimulation; H is the statistical chart of iNOS protein expression detected by Western blot after overexpression of Six2 under inflammatory stimulation; I is the statistical chart of Arg-1 protein expression detected by Western blot after overexpression of Six2 under inflammatory stimulation; J is the detection of TNF-α secretion by ELISA after overexpression of Six2 under inflammatory stimulation; K is the detection of IL-10 secretion by ELISA after overexpression of Six2 under inflammatory stimulation, n = 3, *P<0.05, **P<0.01.

[0027] Figure 4 This is the effect of knocking down / overexpressing SIX2 in microglia on co-cultured MES23.5 cells in the present invention.

[0028] Figure 4In (the figure), A shows co - culturing MES23.5 cells with the supernatant of BV - 2 cells with Six2 knocked down, and detecting the apoptosis of MES23.5 cells by TUNEL, Bar = 50μm; B is the statistical chart of detecting the apoptosis of MES23.5 cells by TUNEL after co - culturing MES23.5 cells with the supernatant of BV - 2 cells with Six2 knocked down; C shows co - culturing MES23.5 cells with the supernatant of BV - 2 cells with Six2 knocked down, and detecting the cell viability of MES23.5 cells by CCK8; D shows co - culturing MES23.5 cells with the supernatant of BV - 2 cells with Six2 overexpressed, and detecting the apoptosis of MES23.5 cells by TUNEL, Bar = 50μm; E is the statistical chart of detecting the apoptosis of MES23.5 cells by TUNEL after co - culturing MES23.5 cells with the supernatant of BV - 2 cells with Six2 overexpressed; F is the statistical chart of detecting the cell viability of MES23.5 cells by CCK8 after co - culturing MES23.5 cells with the supernatant of BV - 2 cells with Six2 overexpressed, n = 3, *P<0.05, **P<0.01.

[0029] Figure 5 In the LPS - induced mouse model of the present invention, the high expression of SIX2 in microglia can inhibit the activation of microglia in the substantia nigra pars compacta.

[0030] Figure 5 In (the figure), A is the flow chart of the animal experiment; in B, top: construction of the SIX2 - overexpressing virus, bottom: co - labeling of the microglia marker Iba - 1 and the virus fluorescence; C shows the staining of TH - positive cells and Iba - 1 - positive cells observed by immunofluorescence, Bar = 200μm; D is the statistical chart of the staining of TH - positive cells and Iba - 1 - positive cells observed by immunofluorescence. The number of Iba - 1 - positive microglia in the substantia nigra pars compacta was quantitatively analyzed using ImageJ, n = 3, *P<0.05, **P<0.01.

[0031] Figure 6 In the LPS - induced mouse model of the present invention, the high expression of SIX2 in microglia can promote the polarization of microglia from the M1 type to the M2 type.

[0032] Figure 6In it, A shows the staining of TNF-α and Iba-1 in microglia of the substantia nigra of mice observed by immunofluorescence, Bar = 100μm; B is the statistical chart of the staining of TNF-α and Iba-1 in microglia of the substantia nigra of mice observed by immunofluorescence, and Image J is used to quantitatively analyze the ratio of TNF-α and Iba-1 positive microglia in the substantia nigra; C is the detection of the mRNA expression of TNF-α in microglia of the midbrain by Real-time PCR; D shows the staining of CD206 and Iba-1 in microglia of the substantia nigra of mice observed by immunofluorescence, Bar = 100μm; E is the statistical chart of the staining of CD206 and Iba-1 in microglia of the substantia nigra of mice observed by immunofluorescence, and Image J is used to quantitatively analyze the ratio of CD206 and Iba-1 positive microglia in the substantia nigra; F is the detection of the mRNA expression of CD206 in microglia of the midbrain by Real-time PCR, n = 3, *P<0.05, **P<0.01.

[0033] Figure 7 In the LPS-induced mouse model of the present invention, the high expression of SIX2 in microglia can slow down the loss of DA neurons in the substantia nigra.

[0034] Figure 7 In it, A shows the staining of TH in the substantia nigra of mice detected by immunofluorescence; B is the statistical chart of the staining of TH in the substantia nigra of mice detected by immunofluorescence, and Image J is used to quantitatively analyze the number of TH positive cells in the substantia nigra of mice; C is the protein expression band diagram of TH in the midbrain detected by Western blot; D is the statistical chart of the protein expression of TH in the midbrain detected by Western blot, n = 3, *P<0.05; E is the score of the horizontal pole climbing to record the falling time of mice; F is the record of the falling time of mice from the rotating rod in the rotating rod experiment; n = 9, *P<0.05, **P<0.01. Detailed implementation manners

[0035] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below, and preferred embodiments of the present invention are given. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0036] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the description of the present invention in this specification are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0037] The beneficial effects of the present invention are illustrated by the following specific embodiments.

[0038] Example 1: High expression of SIX2 in microglia under inflammatory stimulation

[0039] To clarify whether SIX2 in microglia is highly expressed under inflammatory stimulation, BV-2 cells were treated with LPS for different times. The results of Western blot experiments showed that the expression of SIX2 in microglia began to increase significantly at 24 h after LPS treatment, as shown in A and B of Figure 1 Meanwhile, the primary microglia of neonatal SD rats were extracted in the present invention, and immunofluorescence detection was performed using an antibody against ionized calcium-binding adapter molecule-1 (Iba-1). The results showed that the proportion of Iba-1 positive cells reached 98.5%, that is, the purity of primary microglia reached 98.5%, as shown in C and D of Figure 1 and could be used for subsequent experiments; compared with the control group, the fluorescence intensity of SIX2 in primary microglia treated with LPS for 24 h was significantly enhanced, as shown in E and F of Figure 1 These results indicate that SIX2 is highly expressed in LPS-stimulated microglia.

[0040] Example 2: High-expressed SIX2 protects DA by promoting the polarization of inflammatory-induced microglia from M1 to M2 phenotype

[0041] 1. Knocking down SIX2 promotes the polarization of inflammatory-induced microglia to the M1 phenotype

[0042] The transformation of microglia from a resting state to an activated state is accompanied by significant morphological changes and changes in molecular markers. To clarify the effect of high-expressed SIX2 on the phenotypic polarization of inflammatory-induced microglia, the present invention detected the morphological changes of microglia and the expression and secretion of different polarization phenotypic markers after knocking down SIX2 under inflammatory stimulation. First, Six2 in BV-2 microglia was knocked down by lentivirus carrying shRNA(Six2). The results of Western blot experiments showed that the protein expression of SIX2 in the Six2 knockdown group was significantly lower than that in the NC group, as shown in A and B of Figure 2 After LPS treatment of BV-2 cells with knocked-down Six2, the immunofluorescence results showed that the cell body increased after LPS treatment, and knocking down Six2 exacerbated this phenomenon, as shown in C and D of Figure 2 The results of real-time PCR showed that in LPS-treated microglia, the mRNA expressions of M1 microglia molecular markers TNF-α, IL-6, CD16, and iNOS in the Six2 knockdown group were significantly increased compared with those in the NC group, as shown in E of Figure 2 while the mRNA expressions of M2 microglia molecular markers Arg-1, IL-10, and CD206 were significantly decreased compared with those in the NC group, as shown inFigure 2 as shown by F in Figure 2 as shown by G, H, and I in Figure 2 as shown by J and K in

[0043] 2. Overexpression of SIX2 promotes the polarization of inflammatory-induced microglia from the M1 type to the M2 type

[0044] The SIX2 gene sequence was downloaded using the NCBI database. The SIX2 gene sequence is shown in SEQ ID NO.1, and the gene version number is Gene ID: NM_011380.2. Using primer design software, a pair of PCR primers specific to the SIX2 gene was designed. The upstream primer is shown in SEQ ID NO.2, which is 5‘-atcgGG TCTCGCGCTATGTCCATGCTGCCCACCTTCGCCAGCC-3’, and the downstream primer is shown in SEQ ID NO.3, which is 5‘-atcgGGTCTCGGGGTCTACTTGTCGTCATCGTCTTTGTAGTCGGAGCCCAGGTCCACAAGGTTG-3’. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0045] SEQ ID NO.1:

[0046] ATGTCCATGCTGCCCACCTTCGGCTTCACGCAGGAGCAAGTGGCGTGCGTGTGCGAGGTGCTGCAGCAGGGCGGCAACATCGAGCGGCTGGGTCGCTTCCTGTGGTCGCTGCCCGCCTGCGAGCACCTCCACAAGAATGAAAGCGTGCTCAAGGCCAAGGCCGTGGTGGCCTTCCACCGGGGCAACTTCCGCGAGCTCTACAAAATCCTGGAGAGCCACCAGTTCTCGCCGCACAACCACGCCAAGCTGCAGCAGTTGTGGCTCAAGGCGCACTACATCGAGGCGGAGAAGCTGCGCGGCCGGCCGCTGGGCGCCGTGGGCAAGTACCGCGTGCGGCGCAAGTTCCCGCTGCCCCGCTCCATCTGGGACGGCGAGGAGACCAGCTACTGCTTCAAGGAGAAGAGCCGCAGCGTGCTGCGCGAGTGGTACGCTCACAACCCCTACCCGTCGCCACGAGAGAAGCGCGAGCTGGCCGAGGCCACCGGCCTCACCACCACGCAAGTCAGCAACTGGTTCAAGAACCGGCGGCAGCGCGACAGGGCGGCCGAGGCCAAGGAAAGGGAGAACAGCGAGAACTCCAATTCCAGCAGCCACAACCCGCTGGCTTCCTCGCTCAATGGCAGTGGCAAGTCGGTGCTAGGCAGTTCCGAGGATGAGAAGACGCCGTCGGGGACTCCAGACCACTCGTCGTCCAGTCCCGCTCTGTTGCTCAGCCCGCCGCCGCCCCCTGGGCTGCCTTCCCTGCACAGCCTGGGCCACCCTCCGGGCCCGAGCGCAGTACCCGTACCAGTGCCCGGTGGAGGCGGCGCGGACCCACTGCAGCATCACCACAGCCTGCAGGACTCCATACTCAACCCCATGTCGGCCAACCTTGTGGACCTGGGCTCCTAG。

[0047] The SIX2 gene fragment was amplified using specific primer pairs. After recovering the gel product, it was ligated with a lentiviral vector to form a recombinant plasmid. The recombinant plasmid was transformed into host cells for amplification. A recombinant lentiviral vector capable of stably overexpressing the SIX2 gene was obtained through screening and identification.

[0048] To further clarify the effect of highly expressed SIX2 on the phenotypic polarization of microglia induced by inflammation, a recombinant lentiviral vector overexpressing the SIX2 gene was transfected into BV-2 microglia to overexpress the Six2 gene. The results of western blot experiments showed that the expression of the SIX2 protein in the overexpressed Six2 group was significantly increased compared with that in the NC group, as shown in Figure 3 A and B in. LPS-treated microglia overexpressing Six2, and the immunofluorescence results showed that the cell body increased after LPS treatment, and overexpressing Six2 reversed this phenomenon, as shown in Figure 3 C and D in; the results of real-time PCR showed that in LPS-treated microglia, the mRNA expressions of M1 microglia molecular markers TNF-α, IL-6, CD16, and iNOS in the overexpressed Six2 group were significantly decreased compared with those in the NC group, as shown in Figure 3 E in, while the mRNA expressions of M2 microglia molecular markers Arg-1, IL-10, and CD206 were significantly increased compared with those in the NC group, as shown in Figure 3 F in. Western blot results also showed that in LPS-treated microglia, the expression of iNOS decreased and the expression of Arg-1 increased in the overexpressed Six2 group, as shown in Figure 3 G, H, and I in; ELISA results showed that in the conditioned medium of LPS-treated microglia, the secretion of TNF-α decreased and the secretion of IL-10 increased in the overexpressed Six2 group, as shown in Figure 3 J and K in. The above results indicate that overexpressing SIX2 can promote the polarization of microglia from the M1 type to the M2 type under inflammatory stimulation.

[0049] 3. Effects of knocking down / overexpressing SIX2 in microglia on co-cultured MES23.5 DA cells SIX2 can promote the polarization of microglia from the M1 type to the M2 type. Does the polarization of microglia have a protective effect on DA cells? The present invention collected the conditioned medium of BV-2 cells with knocked down or overexpressed Six2, co-cultured MES23.5 cells, and detected the apoptosis of MES23.5 cells using the TUNEL method. The results showed that compared with the PBS group, the apoptosis of MES23.5 cells co-cultured with the conditioned medium of LPS-induced BV-2 cells increased, and the results were as shown in Figure 4As shown by A and B in [reference], knockdown of Six2 exacerbated this phenomenon, while overexpression of Six2 had the opposite effect. The apoptosis of MES23.5 cells co-cultured with the supernatant of BV-2 cells overexpressing Six2 was significantly reduced, as shown by Figure 4 D and E in [reference]. In addition, the present invention also detected the cell viability of MES23.5 cells and found that the cell viability of MES23.5 cells co-cultured with the supernatant of BV-2 cells with knockdown of Six2 was significantly reduced, while the cell viability of MES23.5 cells co-cultured with the supernatant of BV-2 cells overexpressing Six was significantly increased, as shown by Figure 4 C and F in [reference]. The above results indicate that high expression of SIX2 in microglia can protect MES23.5 DA cells co-cultured with them.

[0050] Example 3: In an LPS-induced mouse model, high expression of SIX2 in microglia can promote the polarization of microglia from the M1 type to the M2 type and slow down the loss of DA neurons in the substantia nigra

[0051] 1. In an LPS-induced mouse model, high expression of SIX2 in microglia can promote the polarization of microglia from the M1 type to the M2 type. To further confirm that SIX2 can promote the polarization of microglia from the M1 type to the M2 type and protect DAergic cells by inhibiting neuroinflammation, the present invention used Cx3cr1-CreERT2 mice and DIO-dependent adeno-associated virus carrying Six2 to specifically overexpress Six2 in the microglia of the substantia nigra and administered LPS to establish a model, and observed the effects on microglia polarization and DAergic neurons, as shown by Figure 5 A in [reference]. The co-labeling results of the microglia marker Iba-1 and the virus-carried m-cherry showed that Iba-1 and the red fluorescence of the virus co-existed in microglia, indicating that SIX2 was specifically highly expressed in the microglia of the substantia nigra of mice, as shown by Figure 5 B in [reference]. Immunofluorescence results showed that the microglia in the substantia nigra compacta of LPS group mice were activated and the number increased; compared with the LPS group, the activation of microglia in the substantia nigra compacta of the overexpressing Six2+LPS group mice was weakened and the number of Iba-1 positive microglia decreased, as shown by Figure 5 C-D in [reference].

[0052] Subsequently, real-time PCR and immunofluorescence were used to detect the expression of M1 / M2 type molecular markers of microglia in the midbrain of mice. Real-time PCR results showed that: compared with the sham group, the mRNA expression level of TNF-α in the midbrain of LPS group mice increased; the mRNA expression of TNF-α in the overexpressing Six2+LPS group was significantly reduced, as shown by Figure 6 C in [reference], and at the same time, the mRNA expression of CD206 was significantly increased, as shown byFigure 6 as shown by F in []. The results of immunofluorescence were consistent with those of real-time PCR. The proportion of TNF-α+ / Iba-1+ cells in the substantia nigra of LPS group mice increased. Compared with the LPS group, the proportion of TNF-α+ / Iba-1+ cells in the substantia nigra of the overexpressed Six2+LPS group mice decreased, as Figure 6 shown in A - B of [], and at the same time, the proportion of CD206+ / Iba-1+ cells increased, as Figure 6 shown in D - E of []. The above results indicate that in the LPS-induced mouse model, specifically overexpressing SIX2 in microglia can promote the polarization of microglia from the M1 type to the M2 type.

[0053] 2. In the LPS-induced mouse model, high expression of SIX2 in microglia can slow down the loss of DAergic neurons in the substantia nigra

[0054] To further detect the effect of microglia polarization on surrounding DAergic neurons, the present invention used immunofluorescence to detect the number of TH-positive cells in the substantia nigra of mice. The results showed that: compared with the sham group, the number of TH-positive cells in the substantia nigra of LPS group mice decreased; compared with the LPS group, the number of TH-positive cells in the substantia nigra of the overexpressed Six2+LPS group mice increased significantly, as Figure 7 shown in A - B of []. At the same time, western blot was used to detect the expression level of TH in the midbrain of mice. The results showed that: compared with the sham group, the protein expression of TH in the LPS group decreased; compared with the LPS group, the protein expression of TH in the overexpressed Six2+LPS group increased significantly, as Figure 7 shown in C - D of []. The rotarod and horizontal ladder tests were used to detect the motor ability of mice. The results showed that: compared with the sham group, the motor ability of LPS group mice decreased significantly; compared with the LPS group, the motor ability of the overexpressed Six2+LPS group mice improved, as Figure 7 shown in E - F of []. It shows that specifically overexpressing SIX2 in microglia can protect surrounding DAergic neurons and improve the motor ability of mice.

[0055] In summary, in the LPS-induced mouse model, high expression of SIX2 in microglia can promote the polarization of microglia from the M1 type to the M2 type and slow down the loss of LPS-induced DA neurons in the substantia nigra.

[0056] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered to be within the scope described in this specification.

[0057] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. Use of a preparation overexpressing the SIX2 gene in the preparation of a reagent for promoting phenotypic transformation of microglia, characterized in that: The nucleotide sequence of the SIX2 gene is shown in SEQ ID NO.1; the phenotypic conversion refers to the polarization from the pro-inflammatory M1 type to the anti-inflammatory M2 phenotype.

2. The use according to claim 1, characterized in that: The preparation includes a recombinant lentiviral vector overexpressing the SIX2 gene.

3. The use according to claim 2, characterized in that: The specific construction method of the recombinant lentiviral vector overexpressing the SIX2 gene is: using a specific primer pair to perform PCR amplification on the SIX2 gene fragment, recovering the gel product and connecting it with the lentiviral vector to form a recombinant plasmid; transforming the recombinant plasmid into a host cell for amplification; and screening and identifying to obtain the recombinant lentiviral vector overexpressing the SIX2 gene.

4. The use according to claim 3, characterized in that The upstream primer of the specific primer pair is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.

3.

5. The use according to claim 3, characterized in that The host cell is an UltraStable competent cell.

6. The use according to claim 1, characterized in that: The preparation also includes pharmaceutically acceptable excipients.

7. The use according to claim 6, characterized in that: The pharmaceutically acceptable excipient is one or more of a diluent, a disintegrant, a precipitation inhibitor, a glidant, a binder, a dispersant, a suspending agent, an isotonic agent, a thickener, an emulsifier, a preservative and a stabilizer.

8. The use according to claim 1, characterized in that: Acceptable dosage forms of the preparation include tablets, capsules, granules, injections, pills, powders or pastes.

9. The use according to claim 1, characterized in that: The microglial cells are mouse microglial cell line BV-2 cells.

10. A drug for treating Parkinson's disease by promoting polarization of microglia from pro-inflammatory M1 type to anti-inflammatory M2 phenotype, characterized in that: The medicine comprises the preparation according to claim 1 and pharmaceutically acceptable excipients.

Images