Application of a GBP gene of Asian corn borer in regulating the reproductive capacity of adult insects
By constructing a homozygous mutant of the GBP gene in the Asian corn borer and using gene editing technology to knock out the GBP gene, the problems of pesticide resistance and agricultural product contamination caused by chemical pesticide control have been solved, achieving green pest control.
Patent Information
- Application Number
- CN202510242155.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2045-03-03
AI Technical Summary
Existing methods of using chemical pesticides to control the Asian corn borer have led to increased pesticide resistance in the pest, decreased quality of agricultural products, and a lack of green control measures.
A homozygous mutant of the GBP gene in the Asian corn borer was constructed. The GBP gene was knocked out using gene editing technology to reduce its reproductive and immune capabilities. The GBP gene was then used as a target gene for pest control.
It significantly reduces the reproductive capacity and immunity of the Asian corn borer, provides green control measures, reduces pesticide use, and lowers the risk of pest resistance.
Smart Images

Figure CN120041513B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to the application of the Asian corn borer GBP (OfGBP) gene in regulating adult reproductive capacity. Specifically, it relates to a method for constructing homozygous Asian corn borer GBP genes and its application in causing a decrease in adult reproductive capacity. Background Technology
[0002] Corn is not only a staple food and feed crop in my country, but also an important industrial raw material for energy and value-added processing. In recent years, the planting area and yield of corn in my country have been increasing year by year. In 2023, corn was the most widely planted and highest-yielding of my country's three major grain crops, serving as a staple food and providing a guarantee for the deep processing of grain. The Asian corn borer (… Ostrinia furnacalis The Asian corn borer (Guenée) is a major pest affecting corn yield and quality in my country, causing damage throughout the entire developmental stage of corn. According to FAOSTAT (http: / / faostat.fao.org), the Asian corn borer can cause an annual loss of 40 million tons of corn production in East Asia. In severe cases, its borer rate can reach 90%, resulting in a yield reduction of over 30% per acre.
[0003] Currently, the main method for controlling the Asian corn borer is chemical pesticides, primarily organophosphates, pyrethroids, and fipronil. While chemical control offers advantages such as speed, efficiency, and ease of operation, long-term, large-scale pesticide spraying not only leads to severe pesticide resistance in pests but also significantly impacts corn quality, causing a sharp increase in pesticide residues in grains, vegetables, and fruits. This reduces crop yield and quality, ultimately posing a serious threat to human health. Therefore, new pest control methods for the Asian corn borer are urgently needed.
[0004] Currently, the Genetic Regulation Technique (GRT) for pest populations utilizes key genes in the pest's own growth and development, employing a sex control switch. Through genetic transformation, male insects are made to carry a genetic control complex (i.e., a complex of a sex switch element and a target gene) that causes abnormal development or female sterility in offspring. Genetic regulation technology represents a future direction for pest control. Genome editing technology is currently an important tool for studying insect gene function. Using genome editing technology to screen and study the function of target genes allows for the construction of genetically regulated strains of the Asian corn borer, providing theoretical and applied value for the control of the Asian corn borer and laying the foundation for the control of agricultural pests. Genetic regulation technology based on gene editing and transgenics is a research direction for the green control of the Asian corn borer. Summary of the Invention
[0005] This invention addresses the technical problem at hand and overcomes the shortcomings of existing technologies by providing an application of the GBP gene in regulating the reproductive capacity of the Asian corn borer.
[0006] Research has found that insects' innate immune function is an important channel for resisting external pathogens and microbial infections. GBP Genes are important factors in insect cellular immunity. Parasitic wasps are important natural enemies of the Asian corn borer, providing crucial control measures. This invention reveals that when parasitic wasps parasitize Asian corn borer larvae, GBP A significant increase in gene expression levels indicates GBP Genes play an important role in the innate immunity of the Asian corn borer. Meanwhile, utilizing the Asian corn borer... GBP Homozygous mutants were found to have significantly downregulated cellular immune genes, further demonstrating... GBP The gene has the function of regulating the immunity of the Asian corn borer, providing a target gene for the control of the Asian corn borer pest, and also providing technical ideas for constructing gene-edited homozygous mutants for other pests and non-model organisms.
[0007] One of the objectives of this invention is to provide a method for constructing the Asian corn borer. GBP The method for producing homozygous gene mutants includes the following steps:
[0008] Step 1: Amplify the cloned Asian corn borer by comparing genome sequences and further using RACE technology. GBP Gene sequence, and verification of the pre- and post-parasitic infestation of the Asian corn borer. GBP Gene expression trends in the Asian corn borer GBP The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 3;
[0009] Step 2, in the Asian corn borer GBP Two sgRNA target sequences were designed in exon 2 of the gene sequence. The target sgRNA was synthesized by in vitro transcription. The target sgRNA was fused with Cas9 protein in vitro to form an RNP mixture. The RNP mixture was then injected into Asian corn borer eggs.
[0010] Step 3: Extract genome from mutant individuals of Asian corn borer, perform PCR amplification of the target site using target detection primers, confirm the mutant individuals through sequencing, and then hybridize and self-cross to obtain... GBP Homozygous mutant population. Asian corn borer. GBP The nucleotide sequence of the homozygous mutant is shown in SEQ ID No. 2, and the amino acid sequence is shown in SEQ ID No. 4.
[0011] This invention constructs a homozygous gene-edited mutant of the Asian corn borer, screens for target genes that play important roles in the reproduction and immunity of the Asian corn borer, and verifies the... GBP These genes are essential functional genes for the innate immunity and reproductive development of the Asian corn borer, laying a technological foundation for the green control of the Asian corn borer.
[0012] The further optimized technical solution of this invention is as follows:
[0013] In step 3, the sequences of the target detection primers are as follows:
[0014] OfGBP-GF: 5'-CTGCTGAAAAGGTGAAGGAAGAT -3';
[0015] OfGBP-GR: 5'-CCTGAACCTCTAAGCAGTAATGTA-3'.
[0016] In step 2, GBP The first target site of the gene is 5'-CCACTAAGAGTAGTAACGGCACC-3'; GBP The second target site of the gene is 5'-GGGTACCAACGCACCTCTGATGG-3'.
[0017] In step 2, the RNP mixture is injected into Asian corn borer eggs via microinjection. Specifically, the sgRNA and Cas9 protein are transcribed in vitro and injected using the Asian corn borer embryo microinjection platform (DRUMMOND NANOJECT III microinjector) at a final concentration of 400 ng / μL. The mixture is injected into eggs laid less than 1 hour prior to birth, and the culture conditions are a temperature of 25±1℃ and a relative humidity of 80%.
[0018] In step 3, the Asian corn borer... GBP The PCR amplification fragment size of the homozygous mutant was 392 bp.
[0019] In step 3, the Asian corn borer... GBP The following tests were performed on homozygous gene mutants:
[0020] (1) Using PCR amplification and agarose gel electrophoresis to detect the Asian corn borer GBP homozygous mutants GBP Size detection to confirm GBP Whether the gene was successfully knocked out, if GBP The homozygous test band was smaller than that of the wild type. GBP Strip size description GBP The gene was successfully knocked out;
[0021] (2) Using bioassay experiments to study the Asian corn borer GBP The egg production and hatching rate of homozygous mutants were statistically analyzed to verify the Asian corn borer. GBP The reproductive capacity of homozygous mutants was assessed, and the results indicated that the Asian corn borer... GBP The reproductive capacity of homozygous mutants is significantly reduced;
[0022] (3) Using qPCR to detect Asian corn borer GBP The gene homozygous mutant was tested for reproduction-related genes to verify the Asian corn borer. GBP The regulatory role of genes on reproductive genes;
[0023] (4) Using qPCR to target Asian corn borer GBP The homozygous mutant was tested for cellular immunity-related genes to verify the Asian corn borer. GBP Gene regulation of cellular immune genes.
[0024] Insects' strong reproductive capacity is fundamental to the propagation and growth of insect populations. This invention, through bioassays, discovered that in the Asian corn borer... GBP In the homozygous mutant of the adult insect, the number of eggs laid and the hatching rate were significantly lower than those of the wild type, further proving that... GBP The role of genes in maintaining reproductive capacity in the Asian corn borer. Simultaneously, this invention used qPCR to detect reproduction-related genes, finding that reproduction-related genes such as Doublesex were significantly downregulated, indicating... GBP Genes regulate the reproductive capacity of adult Asian corn borers by modulating the expression of reproductive genes. This provides insights into the powerful reproductive capabilities of insects and also offers a theoretical basis and application potential for the biological control of Asian corn borers.
[0025] In step 3, mutant individuals of the Asian corn borer are crossed with wild-type individuals to obtain the G1 generation. Sequencing confirms the G1 generation mutant individuals. These G1 generation mutant individuals are then crossed with wild-type individuals to obtain the G2 generation. After successful mutation detection in the G2 generation individuals, individuals with identical male and female mutation types are self-crossed to obtain the G3 generation. Homozygous mutants among the G3 individuals are screened and then self-crossed to obtain… GBP Homozygous mutant population;
[0026] Successful individual mutation detection means that at the sgRNA target site, homozygotes show a single-peak sequence pattern, and PCR gel running results show that the homozygous band size is smaller than that of wild-type and heterozygotes.
[0027] The second objective of this invention is to provide an Asian corn borer constructed using the above-described method. GBP Application of homozygous mutants in the control of Asian corn borer pests.
[0028] In the above applications, the Asian corn borer GBP The reproductive capacity of homozygous mutant adults is reduced.
[0029] The third objective of this invention is to provide the Asian corn borer. GBP The application of genes in regulating adult reproductive capacity, as described in the Asian corn borer. GBP The gene was used to produce Asian corn borers with low egg-laying and hatching rates.
[0030] The fourth objective of this invention is to provide a method for addressing the lack of Asian corn borer. GBP Application of genes in reducing the immunity of Asian corn borer larvae.
[0031] This invention has discovered the Asian corn borer. GBP The gene is an important gene in the innate immune pathway of the Asian corn borer, and it is used to induce the deletion of the Asian corn borer gene. GBP The gene can reduce the immunity of Asian corn borer larvae and reduce the reproductive capacity of adult mutants.
[0032] The Asian corn borer of this invention GBP The gene is a key gene in the immunity and reproductive development of the Asian corn borer, and its gene function has potential application value in the control of the Asian corn borer. Constructing homozygous mutant lines of the Asian corn borer provides potential reference and application value for the green control of the Asian corn borer.
[0033] Furthermore, this invention constructs a model of the Asian corn borer. GBP Homozygous mutants, which lead to a significant decline in the reproductive and immune functions of mutants, are important targets for RNA interference pesticides and genetic regulation, providing a reference and research foundation for the later development of highly efficient biological pesticides for pests. Attached Figure Description
[0034] Figure 1 Before and after parasitism of the Asian corn borer in this invention GBP Expression pattern analysis diagram. In the diagram, A represents the period before and after 12 hours of parasitism by the Asian corn borer. OfGBP Expression levels in different tissues; B represents the Asian corn borer before and after 144 hours of parasitism. OfGBP Expression levels in different organizations.
[0035] Figure 2 This is a schematic diagram illustrating the cystation level of Asian corn borers before and after parasitism and injection of sGBP in this invention. Figure A shows the cystation ability of blood cells observed under a microscope, with a scale bar of 100 μm; Figure B shows the recording and analysis of blood cell cystation responses based on the classified cystation levels.
[0036] Figure 3 In this invention Sf 9 cell infections OfGBPSchematic diagram of transcriptional expression analysis of genes related to post-cellular immunity. In the diagram, A represents cellular immunity genes. Rab5 exist Sf 9 cells overexpression OfGBP Upregulated expression in cell lines, B is Myosin exist Sf9 OfGBP overexpression was upregulated in cell lines, with C being [missing information]. ATG2 exist Sf9 OfGBP overexpression in cell lines is upregulated, D is ATG8 exist Sf 9 cells overexpression OfGBP Upregulated expression in cell lines.
[0037] Figure 4 The CRISPR / Cas9-mediated method in this invention OfGBP Schematic diagram of gene deletion. A in the diagram represents... OfGBP The genome structure of the gene, with the red portion representing the PAM region; B represents the wild-type Asian corn borer and... OfGBP Gene sequence alignment of the deletion strain: "*" indicates sequence identity, "-" indicates missing bases in the deletion strain; C represents the Asian corn borer. OfGBP Sequencing peak diagram of the deletion strain: red arrows indicate the starting deletion; black horizontal lines indicate the deleted bases; D stands for DNAMaker; lane 1 is... OfGBP Heterozygote; lane 2 is wild-type; lane 3 is... OfGBP Homozygous; E is OfGBP Diagram illustrating the construction of homozygous strains.
[0038] Figure 5 This diagram illustrates the fertility levels of OfGBP homozygotes and wild-type individuals in this invention. In the diagram, A represents the wild-type group and... OfGBP Schematic diagram of mating in homozygous groups; B and C are the microscopic views of wild-type and wild-type groups, respectively. OfGBP Diagram of oviposition in the homozygous group; D represents the wild-type group and... OfGBP Statistics on egg production and hatching rate of homozygous groups.
[0039] Figure 6 Knockout in this invention OfGBP The diagram illustrates the impact of different combinations on the life cycle of the Asian corn borer. In the diagram, A represents the duration of the pre-oviposition period (the period from pupa emergence to the start of oviposition); B represents the duration of different combinations of the oviposition period (the period from the start of oviposition by adult Asian corn borers to the death of the male or female); C represents the life cycle of the female adult Asian corn borer; and D represents the life cycle of the male adult Asian corn borer.
[0040] Figure 7 Wild male adults and OfGBPSchematic diagram of reproductive gene expression levels in homozygous male adults. AC in the diagram represents reproductive genes. Doublesex , Sex-lethal , TSSPK In the Asian corn borer GBP Gene knockout mutants showed downregulated expression.
[0041] Figure 8 Asian corn borer in this invention GBP A graph showing the transcriptional expression levels of cellular immune genes in gene knockout mutant larvae. In the graph, AF represents cellular immune genes. Rab5, ARP, Tep2, Hemocytin, EPH, EPP1 In the Asian corn borer GBP Gene knockout mutant larvae showed downregulated expression; G is a cellular immunity gene. Myosin In the Asian corn borer GBP There was no significant difference in expression in gene knockout mutant larvae. Detailed Implementation
[0042] The technical solution of the present invention will be further described in detail below with reference to the embodiments: This embodiment is implemented under the premise of the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.
[0043] Building the Asian corn borer GBP The method for producing homozygous gene mutants includes the following steps:
[0044] (1) The Asian corn borer was cloned by comparing genome sequences and further amplifying and cloning using RACE technology. GBP Gene sequence was obtained and the effects of Asian corn borer parasitism on the genes were verified. GBP The trend of expression. Asian corn borer GBP The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 3. In sequence 1, GBP The CDS sequence of the gene is from the 56th to the 523rd base. GBP The target site for gene 1 is from base 414 to 436, and the target site for gene 2 is from base 479 to 501.
[0045] (2) In the Asian corn borer GBP Two sgRNA target sequences were designed from exon 2 of the gene sequence. These target sgRNAs were synthesized via in vitro transcription and fused with Cas9 protein to form an RNP mixture at a final concentration of 400 ng / μL. The RNP mixture was then injected into Asian corn borer eggs (less than 1 hour after laying) using an Asian corn borer embryo microinjection platform. The culture conditions were 25±1℃ and 80% relative humidity.
[0046] GBP Gene target 1 is 5'-CCACTAAGAGTAGTAACGGCACC-3' (SEQ ID NO.5);
[0047] GBP Gene target 2 is 5'-GGGTACCAACGCACCTCTGATGG-3' (SEQ ID NO.6).
[0048] (3) Genomic DNA was extracted from mutant individuals of the Asian corn borer. PCR was performed on the target using target detection primers, followed by sequencing. After confirming the mutant individuals, they were hybridized with wild-type individuals to obtain the G1 generation. The same detection steps were used to confirm the G1 generation mutant individuals. After hybridization between the G1 generation mutant individuals and wild-type individuals, the G2 generation was obtained. Once the mutation detection was successful in the G2 generation individuals, individuals with the same mutation type in both sexes were self-crossed to obtain the G3 generation individuals. Homozygous mutants among the G3 individuals were screened and self-crossed to obtain... GBP Homozygous mutant population. Asian corn borer. GBP The nucleotide sequence of the homozygous mutant is shown in SEQ ID No. 2, and the amino acid sequence is shown in SEQ ID No. 4. In sequence 2, GBP The CDS sequence of the homozygous mutant is from the 56th to the 445th base, the target site 1 is from the 414th to the 416th base, and the target site 2 is from the 417th to the 423rd base.
[0049] The target detection primers are as follows:
[0050] OfGBP-GF: 5'-CTGCTGAAAAGGTGAAGGAAGAT-3' (SEQ ID NO.7);
[0051] OfGBP-GR: 5'-CCTGAACCTCTAAGCAGTAATGTA-3' (SEQ ID NO. 8).
[0052] The following method was used to detect mutations in the Asian corn borer:
[0053] (1) Adult stage detection
[0054] After the Asian corn borer emerged, several males and females were selected for foreleg analysis. The genome of the forelegs was extracted using an alkaline lysis method, as follows:
[0055] Cut off only one side of the foreleg (about 1 cm) from each Asian corn borer and place it directly in a 1.5 mL centrifuge tube. Add 45 μL of 50 mM NaOH and incubate in a metal bath at 95 °C for 60 min. Then add 5 μL of 1 M Tris-HCl (pH=8.0), vortex to mix, centrifuge, and collect the supernatant to obtain the foreleg genome.
[0056] (2) Sanger sequencing method for detecting mutations
[0057] NCBI was used to design mutation detection primers, and the target fragment was amplified using Novizan's high-fidelity Phanta enzyme. The amplified PCR products were then analyzed by gel electrophoresis, selecting bright, single bands that were slightly lower in number than the control group (wild-type) (indicating successful knockout, a reduction in the number of bases). The Novizan FastPure Gel DNA Extraction MiniKit was used for gel extraction according to the instructions, followed by sequencing. If the sequencing results did not show a double peak, and a certain number of bases were missing near the target site when compared with the wild-type genome, the knockout was successful. If the sequencing results showed a double peak at the target site, TA cloning (using the TOPO universal vector and Trans5a competent cells from TransGen) was required. The sequencing results of the single clone were then compared with the original sequence to observe whether the knockout was successful.
[0058] The PCR method is as follows:
[0059] The interfering DNA template was amplified using Novizan 2×Phanta Max Master Mix. The reaction system and procedure are as follows:
[0060] Table 1 PCR reaction system
[0061] reagents Dosage 2×Phanta Max Buffer 12.5 μL F (10 μM) 1.0 μL R (10 μM) 1.0 μL cDNA 1.0 μL
[0062] Table 2 PCR reaction procedure
[0063]
[0064] (3) The homozygous mutant population was tested by PCR gel running to confirm that there were no heterozygous or wild-type mutants in the homozygous population.
[0065] (4) Photograph and observe homozygous mutant individuals, and verify the results using bioassay experiments. GBP The courtship and mating behavior of homozygous individuals was studied, and the number of eggs laid and the hatching rate of homozygous individuals were statistically analyzed.
[0066] All materials and reagents mentioned in this invention are commercially available and can be purchased or obtained free of charge from domestic and international commercial channels, and will not be described in detail here. Example 1
[0067] 1. Before and after Asian corn borer parasitism GBP Expression pattern analysis
[0068] Asian corn borer larvae parasitized by *Conchaetomium peltatum* for 12 h and 144 h were collected, with unparasitized Asian corn borer larvae as a control. Five tissues were collected: head (H), hemolymph (HC), midgut (MG), fat body (FB), and body wall (IT). The tissues were placed in 1.5 mL EP tubes, 1000 μL of Trizol was added, and the tissues were ground into powder using an automatic grinder. Transfer the homogenized liquid to an RNase-free EP tube. Add 200 μL of chloroform to the RNase-free EP tube, mix vigorously for 15 s, and let stand at room temperature for 5 min. Centrifuge at 13500 g for 15 min at 4 ℃. Add 400 μL of isopropanol, mix by inverting, and place in a -20 ℃ freezer for 30 min. Centrifuge at 13500 g for 10 min at 4 ℃, and RNA precipitate will appear at the bottom of the EP tube. Discard the supernatant, wash the RNA precipitate with 75% ethanol prepared with 1 mL of DEPC water, centrifuge at 13500 g for 5 min at 4 ℃, discard the supernatant, and repeat this operation. After removing the 70% anhydrous ethanol with a pipette, place the EP tube on a clean bench to dry for 5 min, waiting for the remaining ethanol to evaporate completely. Add an appropriate amount of enzyme-free water to dissolve the RNA precipitate, dilute 100 times, and use it for electrophoresis to detect RNA quality. After measuring the concentration of the stock solution, store it at -80 ℃. Using Novizan reverse transcription reagent, cDNA was reverse transcribed and then processed using qPCR technology. GBP The expression levels of the gene at the mRNA level in different tissues before and after parasitism were analyzed at 12h and 144h. The results showed... OfGBP Genes are mainly located in the fat body, and after 12 hours of parasitism... OfGBP The level of expression will be improved (see) Figure 1 ).
[0069] 2. GBP Affecting the level of hemocyte cysts in Asian corn borer larvae
[0070] Asian corn borer larvae parasitized by *Baracus septaceae* for 144 hours were collected, with unparasitized Asian corn borers serving as a control. Hemolymph was collected from both parasitized and unparasitized larvae 12 hours after injection of sGBP (an in vitro expressed GBP protein). The abdominal prolegs were cut with dissecting scissors, and the hemolymph was aspirated using a pipette. 40 μL of larval hemolymph was incubated with 4 μL of beads on a shaker at 28 °C and 50 g for 4 hours. The incubated larval hemolymph was prepared into slides, and the cyst grade was observed under a microscope. Each treatment was repeated three times. Parasitism decreased the hemolymph cyst level in Asian corn borer larvae, while sGBP injection partially increased the hemolymph cyst level in both the larvae and the inoculated larvae (see Figure 2). Figure 2All data are expressed as mean ± standard deviation (M ± SD). The symbols “*”, “**”, and “***” indicate significant differences between the treatment and control groups, respectively. p <0.05, p <0.01, p <0.001, t-test).
[0071] 3. Using the Sf9 cell line to overexpress the Asian corn borer GBP The influence of genes on genes related to cellular immunity
[0072] Overexpression vectors were constructed using Novizan's pFastBac™ Dual expression vector. OfGBP The recombinant plasmid was transformed into DH10Bac competent cells from TransGen, and then plated on cells containing 50 μL of plasmid. μ g / mL Kanamycin (kanamycin), 10 μ g / mL Tetracycline, 7 μ g / mL Gentamicin, 40 μ g / mL X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside) and 40 μ After incubation at 37°C for 48 hours on LB agar plates containing 1000 g / mL IPTG (isopropyl-β-D-thiogalactopyranoside), positive clones were picked, and plasmids were extracted using Beyotime's Bacmid mini-extraction kit. The plasmids were then extracted via Lipo3000 microplate extraction. TM Transfection reagent was used to infect Sf9 cells stored in our laboratory. Cells were cultured at 28 ℃ for 96 h. The supernatant (P1 generation virus solution) was collected by centrifugation. The P1 generation virus solution was then transferred into an appropriate amount of fresh Sf9 cells. This process was repeated until the P3 generation virus solution was collected. Sf9 cells infected with the P3 generation virus solution were... OfGBP Overexpression group. Cells were collected by centrifugation, and total RNA was extracted with 1 mL of Trizol. The RNA was reverse transcribed into cDNA, and the expression level of cellular immune genes was detected by qPCR. The results showed overexpression in the Sf9 cell line. OfGBP The gene led to upregulation of the expression levels of four cytokines (see Figure 3). Figure 3 All data are expressed as mean ± standard deviation (M ± SD). The symbols “*”, “**”, and “***” indicate significant differences between the treatment and control groups, respectively. p <0.05, p <0.01, p <0.001, t-test).
[0073] 4. CRISPR / Cas9 gene editing technology-mediated Asian corn borer GBP Schematic diagram of homozygous mutation construction
[0074] First, based on the genome sequence of the Asian corn borer, two sgRNAs were designed in exon 2, with red representing the PAM region (see [link]). Figure 4 A) Then, in vitro transcription was performed using the Novizan T7 High Yield RNA Transcription Kit. The specific steps were performed according to the kit instructions, as follows:
[0075] (1) Preparation of the reaction system:
[0076] 10×Buffer 2 μL NTP solution 2 μL The recycled products from the previous rubber tapping step 0.5 μg T7 RNA Polymerase Mix 2 μL RNase-free ddH2O Up to 20 μL
[0077] Gently mix by pipetting, and incubate in a PCR instrument at 37 ℃ for 2 h;
[0078] (2) Add 1 μL of DNase I to the reaction system and incubate at 37 °C for 15 min;
[0079] (3) Add 160 μL of enzyme-free water to dilute the product to 180 μL;
[0080] (4) Add 20 μL of 3 M sodium acetate to the system;
[0081] (5) Add an equal volume of phenol / chloroform mixed solution to the above system, and centrifuge at 4 ℃ and 12000 g for 5 min in a refrigerated centrifuge;
[0082] (6) Carefully transfer the upper aqueous phase to a new enzyme-free EP tube, add twice the volume of anhydrous ethanol, and let stand at -20 ℃ for 30 min.
[0083] (7) Centrifuge at 4 ℃ for 12000 g for 5 min in a refrigerated centrifuge; discard the supernatant;
[0084] (8) Wash the precipitate twice with 75% pre-cooled anhydrous ethanol, centrifuge, and discard the supernatant;
[0085] (9) After drying for 5 minutes, add an appropriate amount of enzyme-free water to dissolve the RNA precipitate, and then use electrophoresis to detect the quality and concentration of gRNA for later use.
[0086] Microinjection:
[0087] Preparation system:
[0088] Cas9 protein 1600 ng gRNA 1600 ng 10×Buffer 0.4 μL RNase-free ddH2O 4 μL
[0089] Incubate at 37 °C for 15 min in a PCR instrument, ready for injection. Inject using a microinjector. Before injection, use a needle puller to pull the needle out according to fixed parameters, and then sharpen the needle tip pulled out of the capillary tube using a needle sharpener. Take egg masses hatched within 1 hour, attach them to a glass slide with double-sided tape, and inject under a microscope. Inject 1 nL of the above-mentioned mixed solution into each egg mass. After injection, place the egg masses back into a disposable culture dish and moisten them with a damp paper towel, waiting for hatching. Then, collect hemolymph from 5th instar larvae or forelegs from adults after injection, extract DNA using a DNA extraction kit from Tiangen Biotech, and then use pre-designed target detection primers for PCR electrophoresis to detect bands. Select suitable G0 generation chimeras and cross them with wild type to obtain G1 generation. Self-fertilize G1 generation to obtain G2 generation. Homozygotes appear in G2 generation. Finally, self-fertilize the homozygotes of G2 generation to obtain a stably inherited G3 generation homozygous strain (see...). Figure 4 (E) We can learn through sequencing that knockout causes GBP Large gene fragment deletions (see) Figure 4 (B) Through bioengineering sequencing and PCR electrophoresis, we have determined that we have obtained a stable, homozygous line (see [link]). Figure 4 (C, D).
[0090] 5. Asian corn borer GBP Mutations affect adult fertility
[0091] Wild-type Asian corn borer adults and GBP Homozygous Asian corn borer adults were allowed to mate in a confined space (see...). Figure 5 (A) Change the honey water daily, observe and count the number of eggs laid and the hatching rate using a microscope (see A). Figure 5 (B and C), with 10 replicates for each combination. It was found that mating of homozygous groups resulted in significantly different egg production and hatching rates compared to the wild-type groups (see...). Figure 5 (D). Figure 5 All data are expressed as mean ± standard deviation (M ± SD). The symbols “*”, “**”, and “***” indicate significant differences between the treatment and control groups, respectively. p <0.05, p <0.01, p <0.001, t-test). Scale bar = 2mm.
[0092] 6. Asian corn borer GBP Historical statistics of homozygous mutants
[0093] Take wild type and OfGBP Homozygous adults were allowed to mate in a closed space with different combinations, and the honey water was changed daily. Microscopic observation and statistical analysis were performed on the pre-oviposition period (see...). Figure 6 A), Spawning period (see A) Figure 6 (B) Female lifespan (see B) Figure 6 C), male lifespan (see C), male lifespan (see C) Figure 6 The study included several indicators such as (pre-oviposition period, which represents the number of days from the emergence of the Asian corn borer pupa to the start of oviposition; and oviposition period, which represents the number of days from the start of oviposition by the Asian corn borer adult to the death of the male or female). Each combination was replicated 10 times, and no significant differences were found between different combinations. Figure 6 All data are expressed as mean ± standard deviation (M ± SD). The symbols “*”, “**”, and “***” indicate significant differences between the treatment and control groups, respectively. p <0.05, p <0.01, p <0.001, t-test).
[0094] 7. Knock out the Asian corn borer GBP Regulation of the expression of reproduction-related genes
[0095] Wild male Asian corn borers and OfGBP Homozygous male adults were placed in 1.5 ml EP tubes, 1000 μL of Trizol was added, and the adults were ground into powder using an automatic grinder. Transfer the homogenized liquid to an RNase-free EP tube. Add 200 μL of chloroform to the RNase-free EP tube, mix vigorously for 15 s, and let stand at room temperature for 5 min. Centrifuge at 13500 g for 15 min at 4 ℃. Add 400 μL of isopropanol, mix by inverting, and place in a -20 ℃ freezer for 30 min. Centrifuge at 13500 g for 10 min at 4 ℃, and RNA precipitate will appear at the bottom of the EP tube. Discard the supernatant, wash the RNA precipitate with 75% ethanol prepared with 1 mL of DEPC water, centrifuge at 13500 g for 5 min at 4 ℃, discard the supernatant, and repeat this operation. After removing the 70% anhydrous ethanol with a pipette, place the EP tube on a clean bench to dry for 5 min, waiting for the remaining ethanol to evaporate completely. Add an appropriate amount of enzyme-free water to dissolve the RNA precipitate, dilute 100 times, and use it for electrophoresis to detect RNA quality. After measuring the concentration of the stock solution, store it at -80 ℃. Using Novizan reverse transcription reagent, cDNA was reverse transcribed and then analyzed using qPCR technology. Doublesex , Sex-lethal , TSSPK (See Figure 7 Analysis of the mRNA expression levels of three reproductive genes (A, B, and C) showed that... OfGBP These three reproductive genes in homozygous male adults differ from those in the wild type. Figure 7 All data are expressed as mean ± standard deviation (M ± SD). The symbols “*”, “**”, and “***” indicate significant differences between the treatment and control groups, respectively. p<0.05, p <0.01, p <0.001, t-test).
[0096] 8. Knock out the Asian corn borer GBP Regulation of the expression of genes related to cellular immunity
[0097] Wild-type and wild-type were taken from the EP tube. GBP 500 μL of mutant larval blood was centrifuged at high speed, and 1 mL of Trizol and a steel ball were added. The mixture was then placed in an automated homogenizer for 1 min. The homogenized liquid was transferred to an enzyme-free tube, and total RNA was extracted. The RNA was reverse transcribed into cDNA, and the expression levels of cellular immune genes were detected by qPCR. Cellular immunity involving blood cells is an important component of insect defense responses. Related cellular immune genes were detected, including those involved in phagocytosis. ATG2 , ATG8 , Rab5 , Myosin , ARP , Tep2 Genes involved in nodules include Hemocytin Genes involved in cyst formation include EPP1 , EPH It plays a key role in cell function (see Figure 8 ). Figure 8 In this table, all data are expressed as mean ± standard deviation (M ± SD). The symbols “*”, “**”, and “***” indicate significant differences between the treatment and control groups, respectively. p <0.05, p <0.01, p <0.001, t-test).
[0098] Insects' innate immune function is an important channel for resisting external pathogens and microbial infections. GBP It is an important insect cellular immune factor. Parasitic wasps are important natural enemies of the Asian corn borer, providing an important measure for its control. In this experiment, when parasitic wasps parasitized Asian corn borer larvae, we found... GBP A significant increase in expression levels indicates GBP It plays an important role in the innate immunity of the Asian corn borer. Meanwhile, utilizing the Asian corn borer... GBP In homozygous mutants, we found that cellular immune genes were significantly downregulated, further demonstrating... GBP This study, which has the function of regulating the immunity of Asian corn borer, provides a target gene for the control of Asian corn borer pest and also provides technical ideas for constructing gene-edited homozygous mutants for other pests and non-model organisms.
[0099] Insects' strong reproductive capacity is the foundation for the propagation and expansion of insect populations. In this invention, bioassays revealed that in the Asian corn borer... GBP In the homozygous adult mutants, the number of eggs laid and the hatching rate were significantly lower than those of the wild type, further proving that... GBP The study investigated the role of reproductive capacity maintenance in the Asian corn borer, and also examined reproduction-related genes using qPCR. Doublesex Significant downregulation of reproduction-related genes indicates GBP This study modulates the reproductive capacity of adult Asian corn borers by regulating the expression of reproductive genes. This provides insights into the robust reproductive capabilities of insects and offers a theoretical basis and application potential for the biological control of Asian corn borers.
[0100] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. A method for constructing the Asian corn borer GBP The method for producing homozygous mutant genes is characterized by, Includes the following steps: Step 1: Amplify the cloned Asian corn borer using RACE technology. GBP Gene sequence, and verification of the pre- and post-parasitic infestation of the Asian corn borer. GBP Gene expression trends in the Asian corn borer GBP The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 3; Step 2, in the Asian corn borer GBP Two sgRNA target sequences were designed in exon 2 of the gene sequence. The target sgRNA was synthesized by in vitro transcription. The target sgRNA was fused with Cas9 protein in vitro to form an RNP mixture. The RNP mixture was then injected into Asian corn borer eggs. GBP The first target site of the gene is 5'-CCACTAAGAGTAGTAACGGCACC-3'; GBP The second target site of the gene is 5'-GGGTACCAACGCACCTCTGATGG-3'; Step 3: Extract genome from mutant individuals of Asian corn borer, perform PCR amplification of the target site using target detection primers, confirm the mutant individuals through sequencing, and then hybridize and self-cross to obtain... GBP Homozygous mutant population; the sequences of the target detection primers are as follows: OfGBP-GF: 5'-CTGCTGAAAAGGTGAAGGAAGAT -3'; OfGBP-GR: 5'- CCTGAACCTCTAAGCAGTAATGTA -3'; Asian corn borer GBP The nucleotide sequence of the homozygous mutant is shown in SEQ ID No. 2, and the amino acid sequence is shown in SEQ ID No.
4.
2. A method for constructing the Asian corn borer according to claim 1 GBP The method for producing homozygous mutant genes is characterized by, In step 2, the RNP mixture is injected into the eggs of Asian corn borer by microinjection. Specifically, sgRNA and Cas9 protein are transcribed in vitro and injected at a final concentration of 400 ng / μL. The mixture is injected into the eggs of Asian corn borer that have been laid for less than 1 hour. The culture conditions are a temperature of 25±1℃ and a relative humidity of 80%.
3. A method for constructing the Asian corn borer according to claim 1 GBP The method for producing homozygous mutant genes is characterized by, In step 3, the Asian corn borer... GBP The PCR amplification fragment size of the homozygous mutant was 392 bp.
4. A method for constructing the Asian corn borer according to claim 1 GBP The method for producing homozygous mutant genes is characterized by, In step 3, the Asian corn borer... GBP The following tests were performed on homozygous gene mutants: (1) Using PCR amplification and agarose gel electrophoresis to detect the Asian corn borer GBP homozygous mutants GBP Size detection to confirm GBP Whether the gene was successfully knocked out, if GBP The homozygous test band was smaller than that of the wild type. GBP Strip size description GBP The gene was successfully knocked out; (2) Using bioassay experiments to study the Asian corn borer GBP The egg production and hatching rate of homozygous mutants were statistically analyzed to verify the Asian corn borer. GBP The reproductive capacity of homozygous mutants was assessed, and the results indicated that the Asian corn borer... GBP The reproductive capacity of homozygous mutants is significantly reduced; (3) Using qPCR to detect Asian corn borer GBP The gene homozygous mutant was tested for reproduction-related genes to verify the Asian corn borer. GBP The regulatory role of genes on reproductive genes; (4) Using qPCR to target Asian corn borer GBP The homozygous mutant was tested for cellular immunity-related genes to verify the Asian corn borer. GBP Gene regulation of cellular immune genes.