Plant Q10 synthesis element for improving synthesis level of plant coenzyme Q10 and application

Abstract

The invention discloses a plant Q10 synthesis element capable of remarkably improving the synthesis level of plant coenzyme Q10 and an application of the plant Q10 synthesis element. Plants or recombinant bacteria for converting the plant Q10 synthesis element can synthesize coenzyme Q10, and the plant Q10 synthesis element is not only used for synthesizing coenzyme Q10 non-transgenic plants such as rice, lettuce, cucumber, corn, wheat and sorghum, but also can be applied to transgenic crop cultivation, and has wide application prospects.

Description

A plant Q10 synthesis element for improving the synthesis level of plant coenzyme Q10 and its application Technical Field

[0001] This patent relates to the field of plant genetic engineering technology, and in particular to a plant Q10 synthesis element that improves the synthesis level of plant coenzyme Q10. Background Art

[0002] Coenzyme Q (CoQ) is a fat-soluble terpenoid quinone compound found throughout the body. It serves as an electron transporter in the mitochondrial respiratory chain and is essential for cellular energy production. The side chain of CoQ is typically composed of 6-10 isoprene units, with side chain lengths varying between species. Humans primarily synthesize CoQ10, which has a side chain of 10 isoprene units (C50), while some plants, including cereal crops like rice, primarily synthesize CoQ9, which has a side chain of 9 isoprene units (C45).

[0003] Long-chain prenyltransferase (CoQ1) is a key enzyme in the coenzyme Q biosynthesis pathway. It determines the number of isoprene units in the coenzyme Q side chain, i.e., the length of the side chain. It catalyzes the condensation reaction of isopentenyl pyrophosphate with an allyl acceptor to produce polyprenyl pyrophosphate. The product produced by CoQ1 varies in length between different species.

[0004] The human body can synthesize Coenzyme Q10, but levels decrease with age. For those with Coenzyme Q10 deficiency, exogenous Coenzyme Q10 supplementation can alleviate deficiency symptoms to varying degrees. Therefore, Coenzyme Q10 is one of the most consumed dietary supplements worldwide. While the diet is a significant source of Coenzyme Q10, staple crops like rice and wheat synthesize Coenzyme Q9, not Coenzyme Q10.

[0005] Because the mechanism of action of the CoQ10 enzyme at each site was previously unknown, the only method for cultivating crops that synthesize Coenzyme Q10 was to use genetic engineering to introduce the CoQ10-producing CoQ10 gene from bacteria or eukaryotes into crops, thereby creating new transgenic crops that synthesize Coenzyme Q10. This transgenic technology introduces genes blindly, with the entire site being random. Moreover, the transgene is introduced into the organism as an exogenous DNA fragment that does not exist naturally, and its biosafety remains to be verified. The Q10 synthesis element provided by the present invention can be used to cultivate non-transgenic plants that synthesize Coenzyme Q10, such as rice, lettuce, cucumber, corn, wheat, and sorghum.

[0006] Summary of the Invention

[0007] The purpose of the present invention is to provide a Q10 synthesis element (Q10SE, Q10 synthase element) that can be achieved through gene editing, namely a long-chain prenyltransferase Coq1 mutant, which comes from plants and has the activity of synthesizing coenzyme Q10 side chains after editing and mutation.

[0008] In a first aspect, a plant Q10 synthesis element is provided that significantly improves the level of coenzyme Q10 synthesis in plants. Compared with rice Coq1, the amino acid sequence of the plant Q10 synthesis element corresponds to the rice Coq1 with the following mutations: 1) mutation I / M240L / V / F / Y / C at position 240; 2) mutation A243V at position 243; 3) mutation I255M at position 255; 4) mutation S256T at position 256; 5) mutation K166D / E at position 166; mutation G245E at position 245; and / or 7) amino acid residues 145-173 and 238-263 are changed to the corresponding sequence of tomato Coq1, wherein the amino acid sequence of rice Coq1 is shown in SEQ ID NO.1, and the amino acid sequence of tomato Coq1 is shown in SEQ ID NO.69.

[0009] Furthermore, the amino acid sequence of the plant Q10 synthesis element is identical or has at least 80%, 85%, 90%, 95%, 98% or 99% homology to any one of the following amino acid sequences: SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, SEQ ID NO. ID NO.67.

[0010] Furthermore, the plant Q10 synthesis element comes from any one of rice, lettuce, cucumber, corn and wheat.

[0011] In a second aspect, a coding gene is provided, which encodes any one of the plant Q10 synthesis elements described above.

[0012] Furthermore, the base sequence of the above-mentioned encoding gene is identical to or has at least 80%, 85%, 90%, 95%, 98% or 99% homology with any one of the following base sequences: SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34, SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, SEQ ID NO.60, SEQ ID NO.62, SEQ ID NO.64, SEQ ID NO.65 NO.66 and SEQ ID NO.68.

[0013] In a third aspect, a vector containing the above-mentioned encoding gene is provided.

[0014] In a fourth aspect, a recombinant bacterium or recombinant cell containing the above-mentioned vector is provided.

[0015] In a fifth aspect, a plant individual, plant tissue or plant cell containing the above-mentioned gene is provided.

[0016] In a sixth aspect, a coenzyme Q10 extract is provided, which is extracted from the plant individual, plant tissue or plant cell of the above gene.

[0017] In a seventh aspect, the invention provides the use of any one of the above-mentioned plant Q10 synthesis components in the cultivation of plants, microorganisms, and enzyme activity reaction systems that synthesize coenzyme Q10.

[0018] Furthermore, the above application includes: transforming the target plant with the vector, wherein the vector contains a gene encoding the plant Q10 synthesis element.

[0019] Furthermore, the above application includes: modifying the endogenous Coq1 gene of the target plant so that it encodes the plant Q10 synthesis element.

[0020] Furthermore, the above application includes: mutagenizing and screening cells, tissues, individuals or groups of target plants to encode plant Q10 synthesis elements.

[0021] Furthermore, the target plants are plants of the Poaceae family, Solanaceae family, Cucurbitaceae family, Asteraceae family, Lamiaceae family, Amaryllidaceae family, Chenopodiaceae family, Amaranthaceae family, Malvaceae family, Araliaceae family, Asparagaceae family, etc.

[0022] Furthermore, the target plant is any one of wheat, rice, barley, oats, corn, sorghum, wild rice, millet, buckwheat, sorghum, sesame, sunflower, cucumber, zucchini, pumpkin, wax gourd, bitter melon, loofah, cucumber, watermelon, melon, leek, green onion, onion, leek, spinach, lettuce, tomato, lettuce, garland chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, dragon fruit, and kiwi.

[0023] The present invention has the following beneficial effects:

[0024] Rice Coq1 synthesizes Q9, and the plant Q10 synthesis element provided by the present invention can enable plants to synthesize Q10. Compared to rice Coq1, the amino acid sequence of the plant Q10 synthesis element corresponds to that of rice Coq1, with the mutations I / M240L / V / F / Y / C at position 240, and / or the mutation A243V at position 243, and / or the mutation I255M at position 255, and / or the mutation S256T at position 256, and / or the mutation K166D / E at position 166, and / or the mutation G245E at position 245. Mutations at position 240 and / or simultaneous mutations at multiple positions can enhance the activity of various plant Q10 synthesis elements in synthesizing coenzyme Q10 precursors while maintaining the catalytic activity of the enzyme itself. Compared to rice Coq1, the amino acid sequence of this plant Q10 synthesis element is obtained by replacing the amino acid sequence fragments 145-173 and 238-263 of wild-type rice Coq1 with tomato Coq1. Plants or recombinant bacteria transformed with the plant Q10 synthesis element provided by the present invention are all capable of synthesizing coenzyme Q10. This plant Q10 synthesis element is not only used to synthesize coenzyme Q10 in non-transgenic plants such as rice, lettuce, cucumber, corn, wheat, and sorghum, but can also be used in the cultivation of transgenic crops, with broad application prospects. Because gene editing technology is more precise than transgenic technology, it solves the blindness and randomness of the entire site caused by the previous whole-gene transfer of Coq1. Compared with the existing method of transforming genes for synthesizing coenzyme Q10 from microorganisms, direct gene editing has more reliable biosafety, which is conducive to the promotion and application of new varieties of synthetic coenzyme Q10 and improves public acceptance.

[0025] References

[0026] 1.J.Wang,Z.He,G.Wang,R.Zhang,J.Duan,P.Gao,X.Lei,H.Qiu,C.Zhang,YZhang,and H.Yin.Efficient targeted insertion of large DNA fragments without DNA donors.Nat Methods,2022.19(3):p.331-340.

[0027] 2.E.Weber,C.Engler,R.Gruetzner,S.Werner,and S.Marillonnet,A modular cloning system for standardized assembly of multigene constructs.PLoS One,2011.6(2):p.e16765.

[0028] 3.Yuan Zong,Yijing Liu,Chenxiao Xue,Boshu Li,Xiangyang Li,Yanpeng Wang,Ji Li,Guanwen Liu,Xingxu Huang,Xiaofeng Cao,and Caixia Gao,An engineered prime editor with enhanced editing efficiency in plants.Nature biotechnology,2022.40(9):p.1394-1402.

[0029] 4.Y.Y.Jiang,Y.P.Chai,M.H.Lu,X.LHan,Q.Lin,Y.Zhang,Q.Zhang,Y.Zhou,X.C.Wang,C.Gao,and Q.J.Chen,Prime editing efficiently generates W542L and S621I double mutations in two ALS genes in maize.Genome Biol,2020.21(1):p.257.

[0030] 5.Michelle F.Richter,Kevin T.Zhao,Elliot Eton,Audrone Lapinaite,Gregory A.Newby,BWThuronyi,Christopher Wilson,Luke W.Koblan,Jing Zeng,Daniel E.Bauer,Jennifer A.Doudna.and David R.Liu,Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity.Nature biotechnology, 2020.38(7): p.883-891. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0032] FIG1 is a complete alignment of the amino acid sequences of the eight rice Q10 synthesis elements OsA, OsB, OsC, OsD, OsE, OsF, OsG, and wild-type rice Coq1 provided in Examples A1-A7 of the present invention;

[0033] FIG2 is a complete alignment of the amino acid sequences of the lettuce Q10 synthesis elements LsA, LsB, LsC, LsD, LsE, LsF, wild-type lettuce Coq1, and wild-type rice Coq1 provided in Examples B1-B6 of the present invention;

[0034] FIG3 is a complete alignment of the amino acid sequences of the cucumber Q10 synthesis elements CsA, CsB, wild-type cucumber Coq1, and wild-type rice Coq1 provided in Examples C1-C2 of the present invention;

[0035] FIG4 shows the coenzyme Q detection results for an empty vector control (VEC), E. coli transformed with wild-type rice Coq1 (OsCoq1), and the rice Coq10 synthesis components OsA, OsB, OsC, OsD, OsE, OsF, and OsG provided in Examples A1-A7 of the present invention;

[0036] Figure 5 shows the coenzyme Q detection results for an empty vector control (VEC), Escherichia coli transformed with wild-type lettuce Coq1 (LsCoq1), and the lettuce Q10 synthesis elements LsA, LsB, LsC, LsD, LsE, and LsF provided in Examples B1-B6 of the present invention;

[0037] FIG6 shows the coenzyme Q detection results of E. coli transformed with an empty vector control (VEC), wild-type cucumber Coq1 (CsCoq1), and the cucumber Q10 synthesis components CsA and CsB provided in Examples C1-C2 of the present invention;

[0038] FIG7 shows the coenzyme Q detection results of six rice lines obtained by gene editing to obtain OsE synthetic elements and wild-type rice plants (WT) provided in Experimental Example 4 of the present invention;

[0039] FIG8 is a complete alignment of the amino acid sequences of the seven maize Q10 synthesis elements ZmA, ZmB, ZmC, ZmD, ZmE, wild-type maize ZmCoq1, and wild-type rice OsCoq1 provided in Examples D1-D5 of the present invention;

[0040] FIG9 is a complete alignment of the amino acid sequences of wheat Q10 synthesis elements TaA, TaB, TaC, TaD, TaE, wild-type wheat TaCoq1, and wild-type rice OsCoq1 provided in Examples E1-E5 of the present invention;

[0041] Figure 10 is a complete alignment of the amino acid sequences of the rice Q10 synthesis elements OsH and OsI in Examples A8-A9 of the present invention, the maize Q10 synthesis element ZmF in Example D6, the wheat Q10 synthesis element TaF in Example E6, wild-type rice Coq1, wild-type maize ZmCoq1, wild-type wheat TaCoq1, and wild-type tomato SlCoq1;

[0042] Figure 11 shows the coenzyme Q detection results of an empty vector control (VEC), E. coli transformed with wild-type maize ZmCoq1, and the maize Q10 synthesis elements ZmA, ZmB, ZmC, ZmD, and ZmE provided in Examples D1-D5 of the present invention;

[0043] Figure 12 shows the coenzyme Q detection results of an empty vector control (VEC), E. coli transformed with wild-type wheat TaCoq1, and the wheat Q10 synthesis elements TaA, TaB, TaC, TaD, and TaE provided in Examples E1-E5 of the present invention;

[0044] FIG13 shows the coenzyme Q detection results of two lettuce lines (numbers 130 and 106) obtained by gene editing to obtain LsB synthetic elements and a wild-type lettuce plant (WT) provided in Experimental Example 7 of the present invention;

[0045] FIG14 shows the coenzyme Q detection results of Escherichia coli transformed with the rice Q10 synthesis elements OsH and OsI provided in Examples A8-A9 of the present invention and the rice Q10 synthesis element OsE provided in Example A5;

[0046] FIG15 shows the coenzyme Q detection results of Escherichia coli transformed with the corn Q10 synthesis element ZmF provided in Example D6 of the present invention and the corn Q10 synthesis element ZmE provided in Example D5;

[0047] FIG16 shows the coenzyme Q detection results of Escherichia coli transformed with the wheat Q10 synthesis element TaF provided in Example E6 of the present invention and the wheat Q10 synthesis element TaE provided in Example E5. DETAILED DESCRIPTION

[0048] The following examples are intended to illustrate the present invention but are not intended to limit the scope of the invention. Modifications or substitutions to the methods, steps, or conditions of the present invention are intended to be within the scope of this application without departing from the spirit and substance of the present invention. Unless otherwise specified, the examples are based on conventional experimental conditions, such as those described in Sambrook et al. (Sambrook, J. & Russell, DW, Molecular cloning: a laboratory manual, 2001), or the conditions recommended by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are conventional commercially available reagents, and the techniques used in the examples are conventional means familiar to those skilled in the art.

[0049] The plant Q10 synthesis element of the present invention, its encoding gene and application are described in detail below.

[0050] In one aspect, the present invention provides a plant Q10 synthesis element, which has a mutation in its amino acid sequence corresponding to position 240, and / or position 243, and / or position 255, and / or position 256, and / or position 166, and / or position 245 of rice Coq1, compared to rice Coq1.

[0051] That is, the amino acid sequence of the plant Q10 synthesis element provided by the present invention is compared with the amino acid sequence of rice Coq1. The amino acid sequence of the plant Q10 synthesis element corresponds to a mutation of amino acid residue M or I to L, V, F, Y or C at position 240 of rice Coq1, or a mutation of amino acid residue A to V at position 243 of rice Coq1, or a mutation of amino acid residue I to M at position 255 of rice Coq1, or a mutation of amino acid residue S to T at position 256 of rice Coq1, or a mutation of amino acid residue K to D or E at position 166 of rice Coq1, or a mutation of amino acid residue G to E at position 245 of rice Coq1.

[0052] Of course, the plant Q10 synthesis element provided by the present invention can also have various combinations of the above mutations.

[0053] In other words, the plant Q10 synthesis element provided by the present invention is obtained by the following mutation:

[0054] (1) aligning the amino acid sequences of wild-type plant Coq1 and rice Coq1, and mutating the amino acid residue M or I at position 240 of wild-type plant Coq1 corresponding to rice Coq1 to L, V, F, Y, or C to obtain the plant Q10 synthesis element having the measurable activity of synthesizing coenzyme Q10 provided by the present invention;

[0055] (2) Alternatively, the amino acid sequences of wild-type plant Coq1 and rice Coq1 are aligned, and the amino acid residue A at position 243 of wild-type plant Coq1 corresponding to rice Coq1 is mutated to V to obtain the plant Q10 synthesis element having the activity of synthesizing coenzyme Q10 provided by the present invention;

[0056] (3) Alternatively, the amino acid sequences of wild-type plant Coq1 and rice Coq1 are aligned, and the amino acid residue I at position 255 of wild-type plant Coq1 corresponding to rice Coq1 is mutated to M to obtain the plant Q10 synthesis element having the activity of synthesizing coenzyme Q10 provided by the present invention;

[0057] (4) Alternatively, the amino acid sequences of wild-type plant Coq1 and rice Coq1 are aligned, and the amino acid residue S at position 256 of wild-type plant Coq1 corresponding to that of rice Coq1 is mutated to T to obtain the plant Q10 synthesis element having the activity of synthesizing coenzyme Q10 provided by the present invention;

[0058] (5) Alternatively, the amino acid sequences of wild-type plant Coq1 and rice Coq1 are aligned, and the amino acid residue K at position 166 of wild-type plant Coq1 corresponding to rice Coq1 is mutated to D or E to obtain the plant Q10 synthesis element having the activity of synthesizing coenzyme Q10 provided by the present invention;

[0059] (6) Alternatively, the amino acid sequences of wild-type plant Coq1 and rice Coq1 are aligned, and the amino acid residue G at position 245 of wild-type plant Coq1 corresponding to that of rice Coq1 is mutated to E to obtain the plant Q10 synthesis element having the activity of synthesizing coenzyme Q10 provided by the present invention;

[0060] It should be noted that the wild-type plant Coq1 corresponds to the mutation position of rice Coq1, and the specific position on the wild-type plant Coq1 sequence varies depending on the species of origin.

[0061] Furthermore, in some embodiments of the present invention, the amino acid sequence of rice Coq1 is shown as SEQ ID NO.1.

[0062] The plant Q10 synthesis element provided by the present invention is obtained by the above-mentioned mutation of wild-type Coq1 from plants of the Gramineae, Solanaceae, Cucurbitaceae, Compositae, Lamiaceae, Amaryllidaceae, Chenopodiaceae, Amaranthaceae, Malvaceae, Araliaceae, and Asparagaceae, in particular from wheat, rice, barley, oats, corn, sorghum, wild rice stem, millet, buckwheat, broomcorn millet, sesame, sunflower, cucumber, zucchini, pumpkin, wax gourd, bitter melon, loofah, snake melon, watermelon, melon, leek, scallion, onion, leek, spinach, lettuce, tomato, lettuce, chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, dragon fruit, and kiwi fruit, preferably from plants such as rice, lettuce, cucumber, wheat, and corn, and retains the characteristics of plant origin. The gene encoding the plant Q10 synthesis element can be used to cultivate the aforementioned crop varieties that synthesize Coenzyme Q10, for example, through gene editing, mutagenesis screening, or genetic engineering. Compared to existing methods of transforming genes that synthesize Coenzyme Q10 from microorganisms, direct gene editing offers greater biosafety, facilitates the promotion and application of new Coenzyme Q10 varieties, and increases public acceptance.

[0063] Furthermore, the amino acid sequence of the plant Q10 synthesis element is identical or has at least 80%, 85%, 90%, 95%, 98% or 99% homology to any one of the following amino acid sequences: SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54.

[0064] Among them, the Q10 synthesis elements shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13 are obtained by mutation of wild-type rice Coq1 (SEQ ID NO.1) from rice (Oryza sativa). The mutation sites include: corresponding to positions 240, 243, 255, 256, and 166 of rice Coq1 shown in SEQ ID NO.1.

[0065] For example, the rice Q10 synthesis element (named OsA) shown in SEQ ID NO. 7 corresponds to position 240 of wild-type rice Coq1 (SEQ ID NO. 1) (this mutation can also be represented as M240L);

[0066] The rice Coq10 synthesis element (designated OsB) shown in SEQ ID NO. 8 corresponds to positions 240 and 243 of wild-type rice Coq1 (SEQ ID NO. 1) (this mutation may also be represented as M240L, A243V);

[0067] The rice Coq10 synthesis element (designated OsC) represented by SEQ ID NO. 9 corresponds to positions 240, 243, and 255 of wild-type rice Coq1 (SEQ ID NO. 1) (the mutations may also be represented as M240L, A243V, and I255M);

[0068] The rice Coq10 synthesis element (designated OsD) represented by SEQ ID NO. 10 corresponds to positions 240, 243, 255, and 256 of wild-type rice Coq1 (SEQ ID NO. 1) (the mutations may also be represented as M240L, A243V, I255M, and S256T);

[0069] The rice Coq10 synthesis element (designated OsE) represented by SEQ ID NO. 11 corresponds to positions 240, 243, 255, 256, and 166 of wild-type rice Coq1 (SEQ ID NO. 1) (this mutation may also be represented as M240L, A243V, I255M, S256T, K166D);

[0070] The rice Coq10 synthesis element (designated OsF) represented by SEQ ID NO. 12 corresponds to positions 240, 243, 255, 256, and 166 of wild-type rice Coq1 (SEQ ID NO. 1) (this mutation may also be represented as M240L, A243V, I255M, S256T, K166E);

[0071] The rice Coq10 synthesis element (designated OsG) represented by SEQ ID NO. 13 corresponds to positions 243, 255, 256, and 166 of wild-type rice Coq1 (SEQ ID NO. 1) (this mutation may also be represented as A243V, I255M, S256T, K166D);

[0072] Among them, the Q10 synthesis elements shown in SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, and SEQ ID NO. 19 are obtained by mutation of wild-type lettuce Coq1 (SEQ ID NO. 3) from lettuce (Lactuca sativa). The mutation sites include: corresponding to positions 240 and 243 of rice Coq1 shown in SEQ ID NO. 1.

[0073] For example, the lettuce Q10 synthesis element (named LsA) shown in SEQ ID NO. 14 has a mutation I240L at position 240 corresponding to wild-type rice Coq1 (SEQ ID NO. 1), and this site corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO. 3) (this site can also be expressed as I221(240)L);

[0074] The lettuce Q10 synthesis element shown in SEQ ID NO. 15 (named LsB), which corresponds to position 240 of wild-type rice Coq1 (SEQ ID NO. 1) with a mutation I240V, and corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO. 3) (this position can also be expressed as 1221(240)V);

[0075] The lettuce Q10 synthesis element shown in SEQ ID NO. 16 (named LsC), which corresponds to position 240 of wild-type rice Coq1 (SEQ ID NO. 1) with a mutation I240F, and corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO. 3) (this position can also be expressed as 1221(240)F);

[0076] The lettuce Q10 synthesis element (named LsD) shown in SEQ ID NO. 17, which corresponds to position 240 of wild-type rice Coq1 (SEQ ID NO. 1) with a mutation I240Y, and which corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO. 3) (this position may also be expressed as I221(240)Y);

[0077] The lettuce Q10 synthesis element (named LsE) shown in SEQ ID NO. 18, which corresponds to position 240 of wild-type rice Coq1 (SEQ ID NO. 1) with a mutation I240C, and which corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO. 3) (this position may also be expressed as I221(240)C);

[0078] The lettuce Q10 synthesis element shown in SEQ ID NO. 19 (named LsF), which corresponds to positions 240 and 243 of wild-type rice Coq1 (SEQ ID NO. 1) with mutations I240L and A243V, and corresponds to positions 221 and 224 of wild-type lettuce Coq1 (SEQ ID NO. 3) (this position can also be expressed as I221(240)L, A224(243)V);

[0079] Among them, the Q10 synthesis elements shown in SEQ ID NO.20 and SEQ ID NO.21 are obtained by mutating the wild-type cucumber Coq1 (SEQ ID NO.5) from cucumber (Cucumis sativus), and the mutation sites include: corresponding to the 240th position of rice Coq1 shown in SEQ ID NO.1.

[0080] For example, the cucumber Q10 synthesis element (named CsA) shown in SEQ ID NO. 20 has a mutation I240L at position 240 corresponding to wild-type rice Coq1 (SEQ ID NO. 1), and this site corresponds to position 233 of wild-type cucumber Coq1 (SEQ ID NO. 5) (this site can also be expressed as I233(240)L);

[0081] The cucumber Q10 synthesis element (designated CsB) shown in SEQ ID NO. 21 has a mutation I240V at position 240 corresponding to wild-type rice Coq1 (SEQ ID NO. 1), and this site corresponds to position 233 of wild-type cucumber Coq1 (SEQ ID NO. 5) (this site may also be expressed as I233(240)V);

[0082] Among them, the Q10 synthesis elements shown in SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, and SEQ ID NO.42 are obtained by mutation of wild-type maize Coq1 (SEQ ID NO.37) from Zea mays. The mutation sites include: corresponding to positions 240, 243, 255, 256, and 166 of rice Coq1 shown in SEQ ID NO.1.

[0083] For example, the maize Q10 synthesis element (named ZmA) shown in SEQ ID NO. 38 has a mutation M240L at position 240 corresponding to wild-type rice Coq1 (SEQ ID NO. 1), and this site corresponds to position 238 of wild-type maize Coq1 (SEQ ID NO. 37) (this site can also be expressed as M238(240)L;

[0084] The maize Q10 synthesis element shown in SEQ ID NO.39 (named ZmB) has mutations M240L and A243V at positions 240 and 243 corresponding to wild-type rice Coq1 (SEQ ID NO.1). This site corresponds to positions 238 and 241 of wild-type maize Coq1 (SEQ ID NO.37) (this site can also be expressed as M238(240)L, A241(243)V;

[0085] The maize Q10 synthesis element shown in SEQ ID NO.40 (named ZmC), which corresponds to position 240 of wild-type rice Coq1 (SEQ ID NO.1), and has mutations M240L, A243V, and I255M at positions 243 and 255. This site corresponds to positions 238, 241, and 253 of wild-type maize Coq1 (SEQ ID NO.37) (this site can also be expressed as M238(240)L, A241(243)V, I253(255)M;

[0086] The maize Q10 synthesis element shown in SEQ ID NO.41 (named ZmD), which corresponds to positions 240, 243, 255 and 256 of wild-type rice Coq1 (SEQ ID NO.1) and has mutations M240L, A243V, I255M, S256T. This site corresponds to positions 238, 241, 253 and 254 of wild-type maize Coq1 (SEQ ID NO.37) (this site can also be expressed as M238(240)L, A241(243)V, I253(255)M, S254(256)T);

[0087] The maize Q10 synthesis element shown in SEQ ID NO.42 (named ZmE) has mutations M240L, A243V, I255M, S256T, K166D at positions 240, 243, 255, 256 and 166 of wild-type rice Coq1 (SEQ ID NO.1). This site corresponds to positions 238, 241, 253, 254 and 164 of wild-type maize Coq1 (SEQ ID NO.37) (this site can also be expressed as M238(240)L, A241(243)V, I253(255)M, S254(256)T, K164(166)D:

[0088] Among them, the Q10 synthesis elements shown in SEQ ID NO. 50, SEQ ID NO. 51, SEQ ID NO. 52, SEQ ID NO. 53, and SEQ ID NO. 54 were obtained by mutation of wild-type wheat Coq1 (SEQ ID NO. 49) from wheat (Triticum aestivum). The mutation sites include: corresponding to positions 240, 243, 245, 256, and 166 of rice Coq1 shown in SEQ ID NO. 1.

[0089] For example, the wheat Q10 synthesis element (named TaA) shown in SEQ ID NO. 50 has a mutation M240L at position 240 corresponding to wild-type rice Coq1 (SEQ ID NO. 1), and this site corresponds to position 236 of wild-type wheat Coq1 (SEQ ID NO. 49) (this site can also be expressed as M236(240)L;

[0090] The wheat Q10 synthesis element shown in SEQ ID NO.51 (named TaB), which corresponds to positions 240 and 243 of wild-type rice Coq1 (SEQ ID NO.1) with mutations M240L and A243V. This site corresponds to positions 236 and 239 of wild-type wheat Coq1 (SEQ ID NO.49) (this site can also be expressed as M236(240)L, A239(243)V;

[0091] The wheat Q10 synthesis element shown in SEQ ID NO.52 (named TaC), which corresponds to position 240 of wild-type rice Coq1 (SEQ ID NO.1), and has mutations M240L, A243V, and G245E at positions 243 and 245. This site corresponds to positions 236, 239, and 241 of wild-type wheat Coq1 (SEQ ID NO.49) (this site can also be expressed as M236(240)L, A239(243)V, G241(245)E;

[0092] The wheat Q10 synthesis element shown in SEQ ID NO.53 (named TaD), which corresponds to positions 240, 243, 245 and 256 of wild-type rice Coq1 (SEQ ID NO.1) with mutations M240L, A243V, G245E, S256T. This site corresponds to positions 236, 239, 241 and 252 of wild-type wheat Coq1 (SEQ ID NO.49) (this site can also be expressed as M236(240)L, A239(243)V, G241(245)E, S252(256)T);

[0093] The wheat Q10 synthesis element shown in SEQ ID NO.54 (named TaE), which corresponds to positions 240, 243, 245, 256 and 166 of wild-type rice Coq1 (SEQ ID NO.1) and has mutations M240L, A243V, G245E, S256T, K166D. This site corresponds to positions 236, 239, 241, 252 and 162 of wild-type wheat Coq1 (SEQ ID NO.49) (this site can also be expressed as M236(240)L, A239(243)V, G241(245)E, S252(256)T, K162(166)D);

[0094] Compared to wild-type rice Coq1 (SEQ ID NO.1), wild-type lettuce Coq1 (SEQ ID NO.3), wild-type cucumber Coq1 (SEQ ID NO.5), wild-type corn Coq1 (SEQ ID NO.37), and wild-type wheat Coq1 (SEQ ID NO.49), the above-mentioned single site corresponding to position 240 of rice Coq1 is mutated from amino acid residue M or I to L or V or F or Y or C, or simultaneously has a mutation corresponding to position 240 of rice Coq1 and mutations at 243, 255, 256, 166, and 245, such as SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID The plant Q10 synthesis elements shown in SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, and SEQ ID NO.54 all have the activity of synthesizing coenzyme Q10, and the Escherichia coli transformed with these Q10 synthesis elements and the plants edited with these sites can synthesize coenzyme Q10.

[0095] Furthermore, the plant Q10 synthesis element is preferably derived from any one of rice, lettuce, cucumber, wheat, and corn.

[0096] In a second aspect, a second plant Q10 synthesis element is provided that significantly improves the level of plant coenzyme Q10 synthesis. The amino acid sequence of the plant Q10 synthesis element is obtained by replacing a portion of the amino acid sequence fragment of wild-type plant Coq1 by tomato Coq1. The amino acid sequence fragment includes: 145-173 and 238-263 corresponding to wild-type rice Coq1, wherein the amino acid sequence of tomato Coq1 is shown in SEQ ID NO.69.

[0097] Furthermore, the wild-type plant Coq1 is derived from any one of rice, corn, and wheat.

[0098] Tomato Coq1 replaced the amino acid sequence fragments 145-173 and 238-263 of the corresponding wild-type rice Coq1 in wild-type rice Coq1, wild-type corn Coq1, and wild-type wheat Coq1, respectively, to obtain four plant Q10 synthesis elements: SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, and SEQ ID NO.67. The obtained plant Q10 synthesis elements all have the activity of synthesizing coenzyme Q10. Escherichia coli transformed with these Q10 synthesis elements and plants edited with these sites can synthesize coenzyme Q10.

[0099] The Q10 synthesis elements represented by SEQ ID NO. 61 and SEQ ID NO. 63 were obtained by mutation of wild-type rice Coq1 (SEQ ID NO. 1) from rice (Oryza sativa). The mutation sites include: amino acid residues 145-173 and 238-263, which were replaced by the corresponding fragments of tomato Coq1 represented by SEQ ID NO. 69.

[0100] For example, the rice Coq10 synthesis element (named OsH) shown in SEQ ID NO. 61, amino acid residues 145-173 and 238-263, were replaced by the corresponding fragments of tomato Coq1 shown in SEQ ID NO. 69;

[0101] For example, the rice Q10 synthesis element (designated OsI) shown in SEQ ID NO. 63, amino acid residues 145-173, 238-239, and 241-263, were replaced by the corresponding fragments of tomato Coq1 shown in SEQ ID NO. 69;

[0102] The Q10 synthesis element (designated ZmF) shown in SEQ ID NO. 65 was derived from wild-type maize Coq1 (SEQ ID NO. 37) by mutation. The mutation sites include: amino acid residues 145-173 and 238-263 corresponding to wild-type rice Coq1, which were replaced by the corresponding fragments of tomato Coq1 shown in SEQ ID NO. 69;

[0103] The Q10 synthesis element (designated TaF) shown in SEQ ID NO. 67 was obtained by mutating wild-type wheat Coq1 (SEQ ID NO. 49) from wheat (Triticum aestivum). The mutation sites include: amino acid residues 145-173 and 238-263 corresponding to wild-type rice Coq1, which were replaced by the corresponding fragments of tomato Coq1 shown in SEQ ID NO. 69.

[0104] On the other hand, the present invention also provides a coding gene that encodes the plant Q10 synthesis element as described above, and the base sequence of these coding genes is selected from any one of the following sequences:

[0105] SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34, SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, SEQ ID NO.60, SEQ ID NO.62, SEQ ID NO.64, SEQ ID NO.66, SEQ ID NO.68 and SEQ ID NO.70.

[0106] in,

[0107] SEQ ID NO.22 encodes the rice Q10 synthesis element OsA shown in SEQ ID NO.7;

[0108] SEQ ID NO. 23 encodes the rice Q10 synthesis element OsB shown in SEQ ID NO. 8;

[0109] SEQ ID NO.24 encodes the rice Q10 synthesis element OsC shown in SEQ ID NO.9;

[0110] SEQ ID NO.25 encodes the rice Q10 synthesis element OsD shown in SEQ ID NO.10;

[0111] SEQ ID NO.26 encodes the rice Q10 synthesis element OsE shown in SEQ ID NO.11;

[0112] SEQ ID NO.27 encodes the rice Q10 synthesis element OsF shown in SEQ ID NO.12;

[0113] SEQ ID NO.28 encodes the rice Q10 synthesis element OsG shown in SEQ ID NO.13;

[0114] SEQ ID NO.29 encodes the lettuce Q10 synthesis element LsA shown in SEQ ID NO.14;

[0115] SEQ ID NO.30 encodes the lettuce Q10 synthesis element LsB shown in SEQ ID NO.15;

[0116] SEQ ID NO.31 encodes the lettuce Q10 synthesis element LsC shown in SEQ ID NO.16;

[0117] SEQ ID NO.32 encodes the lettuce Q10 synthesis element LsD shown in SEQ ID NO.17;

[0118] SEQ ID NO.33 encodes the lettuce Q10 synthesis element LsE shown in SEQ ID NO.18;

[0119] SEQ ID NO.34 encodes the lettuce Q10 synthesis element LsF shown in SEQ ID NO.19;

[0120] SEQ ID NO.35 encodes the cucumber Q10 synthesis element CsA shown in SEQ ID NO.20;

[0121] SEQ ID NO.36 encodes the cucumber Q10 synthesis element CsB shown in SEQ ID NO.21;

[0122] SEQ ID NO.44 encodes the maize Q10 synthesis element ZmA shown in SEQ ID NO.38;

[0123] SEQ ID NO.45 encodes the maize Q10 synthesis element ZmB shown in SEQ ID NO.39;

[0124] SEQ ID NO.46 encodes the maize Q10 synthesis element ZmC shown in SEQ ID NO.40;

[0125] SEQ ID NO.47 encodes the maize Q10 synthesis element ZmD shown in SEQ ID NO.41;

[0126] SEQ ID NO.48 encodes the maize Q10 synthesis element ZmE shown in SEQ ID NO.42;

[0127] SEQ ID NO.56 encodes the wheat Q10 synthesis element TaA shown in SEQ ID NO.50;

[0128] SEQ ID NO.57 encodes the wheat Q10 synthesis element TaB shown in SEQ ID NO.51;

[0129] SEQ ID NO.58 encodes the wheat Q10 synthesis element TaC shown in SEQ ID NO.52;

[0130] SEQ ID NO.59 encodes the wheat Q10 synthesis element TaD shown in SEQ ID NO.53;

[0131] SEQ ID NO.60 encodes the wheat Q10 synthesis element TaE shown in SEQ ID NO.54;

[0132] SEQ ID NO.62 encodes the rice Q10 synthesis element OsH shown in SEQ ID NO.61;

[0133] SEQ ID NO.64 encodes the rice Q10 synthesis element OsI shown in SEQ ID NO.63;

[0134] SEQ ID NO.66 encodes the maize Q10 synthesis element ZmF shown in SEQ ID NO.65;

[0135] SEQ ID NO.68 encodes the wheat Q10 synthesis element TaF shown in SEQ ID NO.67;

[0136] SEQ ID NO. 70 encodes the tomato Coq1 shown in SEQ ID NO. 69.

[0137] It should be readily understood that, based on the degeneracy of codons, one or more nucleotide substitutions can be readily made within the sequence of the aforementioned coding gene to yield corresponding derivative sequences encoding the plant Q10 synthesis element provided herein. Therefore, derivative sequences encoding the plant Q10 synthesis element provided herein by substituting one or more nucleotides within the sequence of the aforementioned coding gene also fall within the scope of protection of the present invention.

[0138] In another aspect, the present invention also provides a vector containing the aforementioned encoding gene. The vector can be a cloning vector or an expression vector; the expression vector can be a prokaryotic expression vector, such as the pTrc99a vector, or a eukaryotic expression vector. Those skilled in the art can select an appropriate vector as a means of transporting the aforementioned encoding gene, as needed, and all such vectors fall within the scope of the present invention.

[0139] In another aspect, the present invention provides recombinant bacteria or recombinant cells containing the above-mentioned vectors. The recombinant bacteria can be cocci, bacilli such as Escherichia coli, or spirochetes; they can also be autotrophic or heterotrophic. The recombinant cells can be prokaryotic or eukaryotic; eukaryotic cells can be animal cells or plant cells; and plant cells can be dicotyledonous or monocotyledonous. It is readily understood that those skilled in the art can select appropriate bacteria or cells as hosts for the above-mentioned encoding genes, as needed, and all of these fall within the scope of protection of the present invention.

[0140] On the other hand, the present invention provides a use of the plant Q10 synthesis element in cultivating plants that synthesize coenzyme Q10, comprising: transforming a target plant with a vector containing a gene encoding the plant Q10 synthesis element.

[0141] For example, a vector containing genes encoding the rice Coenzyme Q10 synthesis elements set forth in SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 62, and SEQ ID NO. 64 can be used to transform cells, such as rice callus, and cultured to differentiate into complete rice plants, thereby cultivating rice that synthesizes Coenzyme Q10. Transgenic rice plants transformed with these encoding genes do not introduce foreign genes, i.e., genes from different species, which can improve public acceptance.

[0142] For example, lettuce that synthesizes Coenzyme Q10 can be grown by transforming cells, such as lettuce callus, with a vector containing genes encoding the lettuce Q10 synthesis elements set forth in SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, and SEQ ID NO. 34, and culturing the cells to differentiate into complete lettuce plants. Transgenic lettuce plants transformed with these encoding genes do not introduce foreign genes, i.e., genes from different species, which can improve public acceptance.

[0143] For example, a vector containing genes encoding the Cucumber Q10 synthesis element shown in SEQ ID NOs. 35 and 36 can be used to transform cells, such as cucumber callus, and cultured to differentiate into complete cucumber plants to cultivate cucumbers that synthesize Coenzyme Q10. Transgenic cucumber plants transformed with these encoding genes do not introduce foreign genes, i.e., genes from different species, potentially increasing public acceptance.

[0144] For example, by transforming cells, such as corn callus, with a vector encoding the maize Q10 synthesis element shown in SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO. 46, SEQ ID NO. 47, and SEQ ID NO. 48, and then culturing and allowing differentiation to form complete corn plants, corn that synthesizes Coenzyme Q10 can be cultivated. Transgenic corn plants transformed with these encoding genes do not introduce foreign genes, i.e., genes from different species, which can improve public acceptance.

[0145] For example, wheat that synthesizes Coenzyme Q10 can be cultivated by transforming cells, such as wheat callus, with a vector containing genes encoding the wheat Q10 synthesis elements shown in SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, SEQ ID NO. 59, and SEQ ID NO. 60, and culturing the cells to differentiate into complete wheat plants. Transgenic wheat plants transformed with these encoding genes do not introduce exogenous genes, i.e., genes from different species, which can improve public acceptance. These applications include modifying the endogenous Coq1 gene of the target plant to encode the plant Q10 synthesis element:

[0146] For example, using part or all of the rice Coq10 synthesis element encoding genes shown in SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.62, and SEQ ID NO.64 as templates, the endogenous Coq1 gene in the rice genome can be modified to cultivate non-transgenic rice.

[0147] For example, using part or all of the genes encoding the lettuce Q10 synthesis elements shown in SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, and SEQ ID NO.34 as templates, the endogenous Coq1 gene in the lettuce genome can be modified to cultivate non-transgenic lettuce.

[0148] For example, using part or all of the cucumber Q10 synthesis element encoding gene shown in SEQ ID NO.35 and SEQ ID NO.36 as a template, the endogenous Coq1 gene in the cucumber genome is modified, thereby cultivating non-transgenic cucumbers.

[0149] For example, using part or all of the maize Q10 synthesis element encoding genes shown in SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, and SEQ ID NO.48 as templates, the endogenous Coq1 gene in the maize genome is modified, thereby cultivating non-transgenic maize.

[0150] For example, using part or all of the wheat Q10 synthesis element encoding genes shown in SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, and SEQ ID NO.60 as templates, the endogenous Coq1 gene in the wheat genome can be modified to cultivate non-transgenic wheat.

[0151] The above application includes mutagenesis and screening of plant cells, tissues, individuals or groups to encode the plant Q10 synthesis element:

[0152] For example, using the genes encoding the mutants of OsA, OsB, OsC, OsD, OsE, OsF, OsG, OsH, and OsI shown in SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.62, and SEQ ID NO.64 as a guide, rice materials can be mutagenized, such as chemically or by radiation, to thereby cultivate rice with endogenous Coq1 gene mutations. For example, the coding sequence of the endogenous Coq1 gene can be modified into the base sequence of the coding gene (SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 62, SEQ ID NO. 64) by CRISPR / Cas9 technology, and the resulting target plant encodes the same protein as the rice OsA, OsB, OsC, OsD, OsE, OsF, OsG, OsH, and OsI mutants provided by the present invention (SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 62, SEQ ID NO. 64), so that the resulting target plant can synthesize coenzyme Q10.

[0153] For example, using the LsA, LsB, LsC, LsD, LsE, and LsF mutant encoding genes shown in SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, and SEQ ID NO.34 as a guide, lettuce materials can be mutagenized, such as chemically or by radiation, to cultivate lettuce with endogenous Coq1 gene mutations. For example, the coding sequence of the endogenous Coq1 gene can also be modified into the base sequence of the coding gene (SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34) by CRISPR / Cas9 technology, and the resulting target plant encodes the same protein as the lettuce LsA, LsB, LsC, LsD, LsE, and LsF mutants (SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34) provided by the present invention, so that the target plant finally formed can synthesize coenzyme Q10.

[0154] For example, using the CsA and CsB mutant encoding genes shown in SEQ ID NO. 35 and SEQ ID NO. 36 as a guide, cucumber materials can be mutagenized, such as chemically or by radiation, to cultivate cucumbers with endogenous Coq1 gene mutations. For example, the coding sequence of the endogenous Coq1 gene can be modified to the base sequence of the encoding gene (SEQ ID NO. 35, SEQ ID NO. 36) using CRISPR / Cas9 technology, and the resulting target plant encodes the same protein as the cucumber CsA and CsB mutants (SEQ ID NO. 35, SEQ ID NO. 36) provided by the present invention, so that the resulting target plant can synthesize Coenzyme Q10.

[0155] For example, using the ZmA, ZmB, ZmC, ZmD, ZmE, and ZmF mutant encoding genes shown in SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.48, and SEQ ID NO.66 as a guide, corn materials can be mutagenized, such as chemically or by radiation, to thereby cultivate corn with endogenous Coq1 gene mutations. For example, the coding sequence of the endogenous Coq1 gene can also be modified into the base sequence of the coding gene (SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.66) by CRISPR / Cas9 technology, and the resulting target plant encodes the same protein as the maize ZmA, ZmB, ZmC, ZmD, ZmE, and ZmF mutants (SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.66) provided by the present invention, so that the target plant finally formed can synthesize coenzyme Q10.

[0156] For example, using the TaA, TaB, TaC, TaD, TaE, and TaF mutant coding genes shown in SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, SEQ ID NO. 59, SEQ ID NO. 60, and SEQ ID NO. 68 as a guide, wheat materials are subjected to mutagenesis, such as chemical or radiation mutagenesis, to thereby cultivate wheat with endogenous Coq1 gene mutations. For example, the coding sequence of the endogenous Coq1 gene can also be modified to the base sequence of the coding gene (SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, SEQ ID NO. 59, SEQ ID NO. 60, and SEQ ID NO. 68) using CRISPR / Cas9 technology, and the resulting target plant encodes a protein identical to the wheat provided by the present invention (SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, SEQ ID NO. 59, SEQ ID NO. 60, and SEQ ID NO. 68), so that the resulting target plant can synthesize Coenzyme Q10.

[0157] The target plants are grasses, solanaceous plants, cucurbitaceous plants, compositae plants, labiatae plants, amaryllidaceae plants, chenopodiaceae, amaranthaceae, malvaceae, araliaceae, and asparagaceae plants, and specifically wheat, rice, barley, oats, corn, sorghum, wild rice stem, millet, buckwheat, broomcorn millet, sesame, sunflower, cucumber, zucchini, pumpkin, wax gourd, bitter melon, loofah, cucumber, watermelon, melon, leek, green onion, onion, leek, spinach, lettuce, tomato, lettuce, chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, pitaya, and kiwi fruit. It is easy to understand that those skilled in the art can select the crop varieties to be cultivated as needed, and as long as the plant Q10 synthesis element and / or its encoding gene provided by the present invention is applied, it falls within the scope of protection of the present invention.

[0158] It should be noted that the protein sequence alignments used in the present invention are performed using Clustal online alignment, available at: http: / / www.ebi.ac.uk / Tools / msa / clustalo / . Results obtained using other sequence alignment tools (e.g., MAFFT, with default parameters) are generally consistent with those obtained using Clustal online alignment.

[0159] In summary, the amino acid sequence of the plant Q10 synthesis element provided by the present invention, such as SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20 or SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, corresponds to that of rice Coq1 (SEQ ID NO. NO.1) has a mutation M / I240L / V / F / Y / C at position 240 and / or a mutation A243V at position 243 and / or a mutation I255M at position 255 and / or a mutation S256T at position 256 and / or a mutation K166D / E at position 166 and / or a mutation G245E at position 245.

[0160] Among them, mutation at position 240 and simultaneous mutation at more positions can improve the activity of various plant Q10 synthesis elements in synthesizing coenzyme Q10 precursors while maintaining their own biological enzyme catalytic activity.

[0161] Tomato Coq1 replaced the amino acid sequence fragments 145-173 and 238-263 of the corresponding wild-type rice Coq1 in wild-type rice Coq1, wild-type corn Coq1, and wild-type wheat Coq1, respectively, to obtain four plant Q10 synthesis elements: SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, and SEQ ID NO.67. The obtained plant Q10 synthesis elements all have the activity of synthesizing coenzyme Q10. Escherichia coli transformed with these Q10 synthesis elements and plants edited with these sites can synthesize coenzyme Q10.

[0162] These plant Q10 synthesis components can not only be used to cultivate non-transgenic plants that synthesize coenzyme Q10, such as rice, lettuce, cucumber, corn, wheat, watermelon, etc., but can also be used in the cultivation of transgenic crops, and have broad application prospects.

[0163] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0164] Examples A1-A7 (Rice)

[0165] The rice Q10 synthesis element provided in Example A1, designated OsA, has an amino acid sequence as shown in SEQ ID NO. 7. It is derived from wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) by mutating amino acid residue M to L at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsA, whose base sequence is shown in SEQ ID NO. 22.

[0166] The rice Q10 synthesis element provided in Example A2, designated OsB, has an amino acid sequence as shown in SEQ ID NO. 8. It is derived from wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) by mutating amino acid residues at position 240 from M to L and at position 243 from A to V. Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsB, whose base sequence is shown in SEQ ID NO. 23.

[0167] The rice Q10 synthesis element provided in Example A3, designated OsC, has an amino acid sequence as shown in SEQ ID NO. 9. It is derived from wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) by mutations at position 240 from M to L, at position 243 from A to V, and at position 255 from I to M. Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsC, whose base sequence is shown in SEQ ID NO. 24.

[0168] The rice Q10 synthesis element provided in Example A4, designated OsD, has an amino acid sequence as shown in SEQ ID NO. 10. It is derived from wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) by mutations at position 240 from M to L, at position 243 from A to V, at position 255 from I to M, and at position 256 from S to T. Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsD, whose base sequence is shown in SEQ ID NO. 25.

[0169] The rice Q10 synthesis element provided in Example A5, designated OsE, has an amino acid sequence as shown in SEQ ID NO. 11. It is derived from wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) by mutations at position 240 from M to L, position 243 from A to V, position 255 from I to M, position 256 from S to T, and position 166 from K to D. Additionally, this example provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsE, whose base sequence is shown in SEQ ID NO. 26.

[0170] The rice Q10 synthesis element provided in Example A6, designated OsF, has an amino acid sequence as shown in SEQ ID NO. 12. It is derived from wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) by mutations at position 240 from M to L, at position 243 from A to V, at position 255 from I to M, at position 256 from S to T, and at position 166 from K to E. Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsF, whose base sequence is shown in SEQ ID NO. 27.

[0171] The rice Q10 synthesis element provided in Example A7, designated OsG, has an amino acid sequence as shown in SEQ ID NO. 13. It is derived from wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) by mutation of amino acid residue A at position 243 to V, amino acid residue I at position 255 to M, amino acid residue S at position 256 to T, and amino acid residue K at position 166 to D. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsG, whose base sequence is shown in SEQ ID NO. 28.

[0172] The amino acid sequence alignment of the eight rice Coq10 synthesis elements OsA, OsB, OsC, OsD, OsE, OsF, OsG, and wild-type rice Coq1 in Examples A1-A7 is shown in FIG1 .

[0173] Rice Q10 synthesis elements OsA, OsB, OsC, OsD, OsE, OsF, OsG and nucleic acid molecules encoding them can be obtained by various chemical synthesis methods.

[0174] Examples B1-B6 (lettuce)

[0175] The lettuce Q10 synthesis element provided in Example B1, designated LsA, has an amino acid sequence as shown in SEQ ID NO. 14. It is derived from wild-type lettuce Coq1 (designated LsCoq1, with an amino acid sequence as shown in SEQ ID NO. 3) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue I to L at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthesis element LsA, whose base sequence is shown in SEQ ID NO. 29.

[0176] The lettuce Q10 synthesis element provided in Example B2, designated LsB, has an amino acid sequence as shown in SEQ ID NO. 15. It is derived from wild-type lettuce Coq1 (designated LsCoq1, with an amino acid sequence as shown in SEQ ID NO. 3) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue I to V at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthesis element LsB, whose base sequence is shown in SEQ ID NO. 30.

[0177] The lettuce Q10 synthesis element provided in Example B3, designated LsC, has an amino acid sequence as shown in SEQ ID NO. 16. It is derived from wild-type lettuce Coq1 (designated LsCoq1, with an amino acid sequence as shown in SEQ ID NO. 3) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue I to F at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthesis element LsC, whose base sequence is shown in SEQ ID NO. 31.

[0178] The lettuce Q10 synthesis element provided in Example B4, designated LsD, has an amino acid sequence as shown in SEQ ID NO. 17. It is derived from wild-type lettuce Coq1 (designated LsCoq1, with an amino acid sequence as shown in SEQ ID NO. 3) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue I to Y at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthesis element LsD, whose base sequence is shown in SEQ ID NO. 32.

[0179] The lettuce Q10 synthesis element provided in Example B5, designated LsE, has an amino acid sequence as shown in SEQ ID NO. 18. It is derived from wild-type lettuce Coq1 (designated LsCoq1, with an amino acid sequence as shown in SEQ ID NO. 3) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue I to C at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthesis element LsE, whose base sequence is shown in SEQ ID NO. 33.

[0180] The lettuce Q10 synthesis element provided in Example B6, designated LsF, has an amino acid sequence as shown in SEQ ID NO. 19. It is derived from wild-type lettuce Coq1 (designated LsCoq1, with an amino acid sequence as shown in SEQ ID NO. 3) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue I to L at position 240 and amino acid residue A to V at position 243. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthesis element LsF, whose base sequence is shown in SEQ ID NO. 34.

[0181] The amino acid sequence alignment of the lettuce Q10 synthesis elements LsA, LsB, LsC, LsD, LsE, LsF, wild-type lettuce Coq1, and wild-type rice Coq1 in Examples B1-B6 is shown in FIG2 .

[0182] The lettuce Q10 synthesis elements LsA, LsB, LsC, LsD, LsE, LsF and the nucleic acid molecules encoding them can all be obtained through various chemical synthesis methods.

[0183] Examples C1-C2 (cucumber)

[0184] The cucumber Q10 synthesis element provided in Example C1, designated CsA, has an amino acid sequence as shown in SEQ ID NO. 20. It is derived from wild-type cucumber Coq1 (designated CsCoq1, with an amino acid sequence as shown in SEQ ID NO. 5) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue I to L at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the cucumber Q10 synthesis element CsA, whose base sequence is shown in SEQ ID NO. 35.

[0185] The cucumber Q10 synthesis element provided in Example C2, designated CsB, has an amino acid sequence as shown in SEQ ID NO. 21. It is derived from wild-type cucumber Coq1 (designated CsCoq1, with an amino acid sequence as shown in SEQ ID NO. 5) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue I to V at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the cucumber Q10 synthesis element CsB, whose base sequence is shown in SEQ ID NO. 36.

[0186] The amino acid sequence alignment of the cucumber Q10 synthesis components CsA, CsB, wild-type cucumber Coq1, and wild-type rice Coq1 in Examples C1-C2 is shown in FIG3 .

[0187] Cucumber Q10 synthetic elements CsA, CsB and nucleic acid molecules encoding them can be obtained by various chemical synthesis methods.

[0188] Examples D1-D5 (Corn)

[0189] The maize Q10 synthesis element provided in Example D1, designated ZmA, has an amino acid sequence as shown in SEQ ID NO. 38. It is derived from wild-type maize Coq1 (designated ZmCoq1, with an amino acid sequence as shown in SEQ ID NO. 37) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue M to L at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthesis element ZmA, whose base sequence is shown in SEQ ID NO. 44.

[0190] The maize Q10 synthesis element provided in Example D2, designated ZmB, has an amino acid sequence as shown in SEQ ID NO. 39. It is derived from wild-type maize Coq1 (designated ZmCoq1, with an amino acid sequence as shown in SEQ ID NO. 37) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutation of amino acid residue M at position 240 to L and amino acid residue A at position 243 to V. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthesis element ZmB, whose base sequence is shown in SEQ ID NO. 45.

[0191] The maize Q10 synthesis element provided in Example D3, designated ZmC, has an amino acid sequence as shown in SEQ ID NO. 40. It is derived from wild-type maize Coq1 (designated ZmCoq1, with an amino acid sequence as shown in SEQ ID NO. 37) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutations at position 240 from M to L, position 243 from A to V, and position 255 from I to M. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthesis element ZmC, whose base sequence is shown in SEQ ID NO. 46.

[0192] The maize Q10 synthesis element provided in Example D4, designated ZmD, has an amino acid sequence as shown in SEQ ID NO. 41. It is derived from wild-type maize Coq1 (designated ZmCoq1, with an amino acid sequence as shown in SEQ ID NO. 37) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutations at position 240 from M to L, position 243 from A to V, position 255 from I to M, and position 256 from S to T. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthesis element ZmD, whose base sequence is shown in SEQ ID NO. 47.

[0193] The maize Q10 synthesis element provided in Example D5, designated ZmE, has an amino acid sequence as shown in SEQ ID NO. 42. It is derived from wild-type maize Coq1 (designated ZmCoq1, with an amino acid sequence as shown in SEQ ID NO. 37) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutation of amino acid residue M at position 240 to L, amino acid residue A at position 243 to V, amino acid residue I at position 255 to M, amino acid residue S at position 256 to T, and amino acid residue K at position 166 to D. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthesis element ZmE, whose base sequence is shown in SEQ ID NO. 48.

[0194] The amino acid sequence alignment of the seven maize Q10 synthesis elements ZmA, ZmB, ZmC, ZmD, ZmE, wild-type maize Coq1, and wild-type rice Coq1 in Examples D1-D5 is shown in FIG8 .

[0195] Corn Q10 synthesis elements ZmA, ZmB, ZmC, ZmD, ZmE and nucleic acid molecules encoding them can be obtained by various chemical synthesis methods.

[0196] Examples E1-E5 (wheat)

[0197] The wheat Q10 synthesis element provided in Example E1, designated TaA, has an amino acid sequence as shown in SEQ ID NO. 50. It is derived from wild-type wheat Coq1 (designated TaCoq1, with an amino acid sequence as shown in SEQ ID NO. 49) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutating amino acid residue M to L at position 240. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthesis element TaA, whose base sequence is shown in SEQ ID NO. 56.

[0198] The wheat Q10 synthesis element provided in Example E2, designated TaB, has an amino acid sequence as shown in SEQ ID NO. 51. It is derived from wild-type wheat Coq1 (designated TaCoq1, with an amino acid sequence as shown in SEQ ID NO. 49) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutation of amino acid residue M at position 240 to L and amino acid residue A at position 243 to V. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthesis element TaB, whose base sequence is shown in SEQ ID NO. 57.

[0199] The wheat Q10 synthesis element provided in Example E3, designated TaC, has an amino acid sequence as shown in SEQ ID NO. 52. It is derived from wild-type wheat Coq1 (designated TaCoq1, with an amino acid sequence as shown in SEQ ID NO. 49) corresponding to wild-type rice Coq1 (with an amino acid sequence as shown in SEQ ID NO. 1), by mutation of amino acid residue M at position 240 to L, amino acid residue A at position 243 to V, and amino acid residue G at position 245 to E. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthesis element TaC, whose base sequence is shown in SEQ ID NO. 58.

[0200] The wheat Q10 synthesis element provided in Example E4, designated TaD, has an amino acid sequence as shown in SEQ ID NO. 53. It is obtained by mutating amino acid residues at position 240 from M to L, amino acid residues at position 243 from A to V, amino acid residues at position 245 from G to E, and amino acid residues at position 256 from S to T in wild-type wheat Coq1 (designated TaCoq1, amino acid sequence as shown in SEQ ID NO. 49) corresponding to wild-type rice Coq1 (amino acid sequence as shown in SEQ ID NO. 1). Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthesis element TaD, whose base sequence is shown in SEQ ID NO. 59.

[0201] The wheat Q10 synthesis element provided in Example E5, designated TaE, has an amino acid sequence as shown in SEQ ID NO. 54. It is obtained by mutating amino acid residues at position 240 from M to L, amino acid residues at position 243 from A to V, amino acid residues at position 245 from G to E, amino acid residues at position 256 from S to T, and amino acid residues at position 166 from K to D, corresponding to wild-type wheat Coq1 (designated TaCoq1, amino acid sequence as shown in SEQ ID NO. 49), Example E5. Furthermore, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthesis element TaE, whose base sequence is shown in SEQ ID NO. 60.

[0202] The amino acid sequence alignment of the wheat Q10 synthesis elements TaA, TaB, TaC, TaD, TaE, wild-type wheat Coq1, and wild-type rice Coq1 in Examples E1-E5 is shown in FIG9 .

[0203] Wheat Q10 synthesis elements TaA, TaB, TaC, TaD, TaE and nucleic acid molecules encoding them can be obtained by various chemical synthesis methods.

[0204] Examples A8-A9 (Rice)

[0205] The rice Q10 synthesis element provided in Example A8, designated OsH, has an amino acid sequence as shown in SEQ ID NO. 61. This element is derived by mutating amino acid residues 145-173 and 238-263 of wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) to the corresponding sequences of tomato Coq1 (designated SlCoq1, with an amino acid sequence as shown in SEQ ID NO. 69 and a base sequence as shown in SEQ ID NO. 70). This example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsH, whose base sequence is shown in SEQ ID NO. 62.

[0206] The rice Q10 synthesis element provided in Example A9, designated OsI, has an amino acid sequence as shown in SEQ ID NO. 63. This element is derived by replacing amino acid residues 145-173, 238-239, and 241-263 of wild-type rice Coq1 (designated OsCoq1, with an amino acid sequence as shown in SEQ ID NO. 1) with the corresponding sequences of tomato Coq1 (designated SlCoq1, with an amino acid sequence as shown in SEQ ID NO. 69 and a base sequence as shown in SEQ ID NO. 70). This example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthesis element OsI, whose base sequence is shown in SEQ ID NO. 64.

[0207] Rice Q10 synthesis elements OsH, OsI and the nucleic acid molecules encoding them can be obtained by various chemical synthesis methods.

[0208] Example D6 (corn)

[0209] The maize Q10 synthesis element provided in Example D6, designated ZmF, has an amino acid sequence as shown in SEQ ID NO. 65. It is derived by mutating amino acid residues 145-173 and 238-263 of wild-type maize Coq1 (designated ZmCoq1, with an amino acid sequence as shown in SEQ ID NO. 37) to the corresponding sequences of tomato Coq1 (designated SlCoq1, with an amino acid sequence as shown in SEQ ID NO. 69 and a base sequence as shown in SEQ ID NO. 70). This example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthesis element ZmF, whose base sequence is shown in SEQ ID NO. 66.

[0210] The corn Q10 synthesis element ZmF and the nucleic acid molecule encoding it can be obtained by various chemical synthesis methods.

[0211] Example E6 (wheat)

[0212] The wheat Q10 synthesis element provided in Example E6, designated TaF, has an amino acid sequence as shown in SEQ ID NO. 67. This element is derived by converting amino acid residues 145-173 and 238-263 of wild-type wheat Coq1 (designated TaCoq1, with an amino acid sequence as shown in SEQ ID NO. 49) to the corresponding sequences of tomato Coq1 (designated SlCoq1, with an amino acid sequence as shown in SEQ ID NO. 69 and a base sequence as shown in SEQ ID NO. 70). This example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthesis element TaF, whose base sequence is shown in SEQ ID NO. 68.

[0213] The wheat Q10 synthesis element TaF and the nucleic acid molecule encoding it can be obtained by various chemical synthesis methods.

[0214] The amino acid sequence alignment of the rice Q10 synthesis elements OsH and OsI in Examples A8-A9, the maize Q10 synthesis element ZmF in Example D6, the wheat Q10 synthesis element TaF in Example E6, wild-type rice Coq1, wild-type maize Coq1, wild-type wheat Coq1, and wild-type tomato Coq1 is shown in Figure 10.

[0215] Experimental Example 1

[0216] The enzyme activity products of the rice Q10 synthesis components OsA, OsB, OsC, OsD, OsE, OsF, and OsG provided in Examples A1-A7 were detected as follows:

[0217] Based on the nucleic acid sequences provided in the Examples, genes encoding the rice Q10 biosynthetic elements OsA, OsB, OsC, OsD, OsE, OsF, and OsG were chemically synthesized and inserted into the E. coli expression vector ptrc99a, which was then transformed into wild-type E. coli strain MG1655. Comparative strains were also prepared using an empty vector control (VEC) and a strain incorporating wild-type rice Coq1 (OsCoq1).

[0218] For each transformant, pick 3 single clones and shake them separately. Add 10mL of liquid LB culture containing ampicillin antibiotics to a 50mL sterile centrifuge tube and culture at 37 degrees on a shaker at 220rpm until OD600 is about 1.0. Then add a final concentration of 1mM IPTG and culture overnight at 28 degrees on a shaker at 220rpm. The next day, centrifuge at 4000rpm for 10min to collect the bacteria, discard the supernatant, resuspend the precipitate with 1mL ultrapure water, and transfer it to a weighed 2mL centrifuge tube. Centrifuge at 12000rpm for 10min, aspirate the supernatant with a pipette, weigh again, and calculate the wet weight of the bacteria. Add ethanol at a ratio of 0.5mL of extract for every 10mg of bacteria. Ultrasonic extraction at low temperature and in the dark for 1h. The filtered sample is then injected into liquid chromatography-mass spectrometry for analysis. The mass spectrometry detection method is as follows:

[0219] The filtered sample was analyzed by liquid chromatography-mass spectrometry (HPLC-DAD-MS) (1260 Infinity II-6460, Agilent) using a ZORBAX Eclipse XDB C18 column (3.5 μm, 2.1 × 50 mm). The mobile phases were (A) isopropanol and (B) 87.5% acetonitrile in water (containing 10 mmol / L ammonium acetate). The mobile phase was 65-15% B over a 0-6 min period at a flow rate of 0.4 mL / min. The mass spectrometry conditions were as follows: an ESI source with a capillary voltage of 4.0 kV, a nebulizer pressure of 35 psi, high-purity nitrogen as the carrier gas, and a flow rate of 11 L / min. The analysis was performed in positive ion mode. Coenzyme Q9 (precursor ion m / z 795.6, product ion m / z 197.1) was detected with a fragmentor voltage of 216 V and a collision energy of 36 V. Coenzyme Q10 (precursor ion m / z 863.6, product ion m / z 197.1), fragmentor voltage 230 V, collision energy 42 V.

[0220] According to the results in Figure 4, we can see that:

[0221] E. coli transformed with wild-type rice Coq1 (OsCoq1) synthesizes almost no CoQ10 but can synthesize CoQ9. E. coli transformed with the rice CoQ10 synthesis elements OsA, OsB, OsC, OsD, OsE, OsF, and OsG can produce varying levels of CoQ10. Comparison of OsE and OsG suggests that the mutation at position 240 is crucial.

[0222] Experimental Example 2

[0223] Referring to the detection method of Experimental Example 1, the products of the lettuce Q10 synthesis components LsA, LsB, LsC, LsD, LsE, and LsF provided in Examples B1-B6 were verified. Comparative strains were also prepared using an empty vector control (VEC) and a strain incorporating wild-type lettuce Coq1 (LsCoq1). The results are shown in Figure 5.

[0224] According to the results in Figure 5, we can see that:

[0225] E. coli transformed with wild-type lettuce Coq1 (LsCoq1) synthesizes almost no Coenzyme Q10 but can synthesize Coenzyme Q9. E. coli transformed with the lettuce CoQ10 synthesis components LsA, LsB, LsC, LsD, LsE, and LsF can synthesize Coenzyme Q10 at varying levels.

[0226] Experimental Example 3

[0227] Referring to the detection method of Experimental Example 1, the products of the cucumber Q10 synthesis components CsA and CsB provided in Examples C1-C2 were verified. Comparative strains were prepared using an empty vector control (VEC) and a strain incorporating wild-type cucumber Coq1 (CsCoq1). The results are shown in Figure 6.

[0228] According to the results in Figure 6, we can see that:

[0229] E. coli transformed with wild-type cucumber Coq1 (CsCoq1) synthesizes almost no Coenzyme Q10 but can synthesize Coenzyme Q9. E. coli transformed with the cucumber Q10 synthesis components CsA and CsB can synthesize Coenzyme Q10 at varying levels.

[0230] Experimental Example 4

[0231] Using CRISPR / Cas9-guided editing, we edited the corresponding DNA sequence in the wild-type rice Coq1 (OsCoq1) genome to incorporate the Q10 biosynthesis element of OsE. For site 166, we designed the Specer (caatattttgctgtctcgtg), RT template (tactggcaaatGACctccgcac), and PBS (gagacagcaa) using the PlantPegDesigner website. For the fragment containing 240, 243, 255, and 256, two pegRNAs were designed according to the GRAND (1) strategy to replace the sequence of 240-256 at one time: Specer1 (TTTCTCTACATTGTTTCTTC), RT template + PBS (GGAGATTTGCATGGTTTCACCAGTAACTAGATGTTCTACAGCAGTAGCCATTAGAGATACCACCTGAAGAAACAATGTAG), and Specer2 (AAATCTAAGATAATGATATT), RT template + PBS (ACTGGTGAAACCATGCAAATCTCCACAAGTAGAGAGCAAAGGCGAAGGTAGTTGCTCTAATACCTAAATCTAAGATAATG). The three pegRNAs were designed into an expression cassette using tRNA (transfer RNA) and HDV (hepatitis delta virus) elements, and driven by the same polyII promoter according to the literature (2). The engineered plant prime editor (ePPE) system (3) was used, and the Addgene vector number is #183095.

[0232] The constructed binary vector was transformed into competent Agrobacterium tumefaciens EHA105 cells, and then transformed into the rice variety Zhonghua 11 according to conventional rice transgenic methods to obtain transgenic-positive rice plants. DNA from T0 plants was extracted and PCR was performed (Primer 1: AGGCTTCAGACTGAGCACTA, Primer 2: ACAGCCTTGCAGCTATTTGA). The PCR product was sequenced at the company (Primer 1: AGGCTTCAGACTGAGCACTA) to confirm the edited target sequence.

[0233] Six independent successfully edited strains were obtained (numbered 45, 49, 87, 109, 120 and 124), among which site 166 was still in a heterozygous mutation state, and sites 240, 243, 255, and 256 were homozygous mutations.

[0234] Coenzyme Q10 extraction process: Rice leaves were freeze-dried and ground in a ball mill. 10 mg of powder was weighed and added to 1 mL of isopropyl alcohol. Ultrasonic extraction was performed at low temperature and in the dark for 1 hour. The filtered extract was then analyzed by liquid chromatography-mass spectrometry using the same liquid chromatography conditions as in Experimental Example 1.

[0235] According to the results in Figure 7, we can see that:

[0236] Wild-type rice (WT) mainly synthesizes coenzyme Q9, while six gene-edited rice lines with OsE Q10 synthesis elements mainly synthesize coenzyme Q10.

[0237] Experimental Example 5

[0238] Referring to the detection method of Experimental Example 1, the products of the maize Q10 synthesis elements ZmA, ZmB, ZmC, ZmD, and ZmE provided in Examples D1-D5 were verified. Comparative strains were also prepared using an empty vector control (VEC) and a strain incorporating wild-type maize Coq1 (ZmCoq1). The results are shown in Figure 11.

[0239] According to the results in Figure 11, we can see that:

[0240] E. coli transformed with wild-type maize Coq1 (ZmCoq1) synthesizes almost no Coenzyme Q10 but can synthesize Coenzyme Q9. E. coli transformed with the maize Q10 synthesis elements ZmA, ZmB, ZmC, ZmD, and ZmE can synthesize Coenzyme Q10 at varying levels.

[0241] Experimental Example 6

[0242] Referring to the detection method of Experimental Example 1, the products of the wheat Q10 synthesis elements TaA, TaB, TaC, TaD, and TaE provided in Examples E1-E5 were verified. Comparative strains were also prepared using an empty vector control (VEC) and a strain incorporating wild-type wheat Coq1 (TaCoq1). The results are shown in Figure 12.

[0243] According to the results in Figure 12, we can see that:

[0244] E. coli transformed with wild-type wheat Coq1 (TaCoq1) synthesizes almost no Coenzyme Q10 but can synthesize Coenzyme Q9. E. coli transformed with wheat Coq10 synthesis elements TaA, TaB, TaC, TaD, and TaE can synthesize Coenzyme Q10 at varying levels.

[0245] Experimental Example 7

[0246] Based on the CRISPR / Cas9 system, adenine base editing system was used to edit the corresponding DNA sequence in the wild-type lettuce Coq1 (LsCoq1) genome, making it contain the Q10 synthesis element of LsB. For the 240 site, a sgRNA (ATCACTAATAGCAACAGCTG) was designed and driven by the 35S-CmYLCV-U6 promoter (4). ABE8e (5) was driven by the Ubi10 promoter.

[0247] The constructed binary vector was transformed into competent Agrobacterium tumefaciens EHA105 cells, and then transformed into the lettuce variety wd40 according to conventional lettuce transgenic methods to obtain transgenic-positive lettuce plants. DNA from the T0 generation plants was extracted and PCR was performed (Primer 1: CTTGCAGTATTGGCTGGAGA, Primer 2: CAGCATGGCAACCTCAGTAG). The PCR product was sequenced at the company (Primer 1: CTTGCAGTATTGGCTGGAGA) to confirm the edited target sequence.

[0248] Two independent successfully edited lines were obtained (numbered 130 and 106), and plants with homozygous mutations at 240 sites were isolated from the T1 generation plants.

[0249] The extraction process and liquid phase conditions of the coenzyme Q10 extract were the same as those in Experimental Example 4.

[0250] According to the results in Figure 13, we can see that:

[0251] Wild-type lettuce (WT) mainly synthesizes coenzyme Q9, and two gene-edited lettuce lines with the Q10 synthesis element of LsB synthesize a certain level of coenzyme Q10.

[0252] Experimental Example 8

[0253] Referring to the detection method of Experimental Example 1, the products of the rice Q10 synthesis components OsH and OsI provided in Examples A8-A9 were verified. A comparative strain was prepared by simultaneously incorporating the rice Q10 synthesis component OsE provided in Example A5. The results are shown in Figure 14.

[0254] According to the results in Figure 14, we can see that:

[0255] E. coli transformed with the rice Q10 synthesis element OsH can produce a moderate level of Coenzyme Q10, exceeding that of OsE. Comparisons between OsH and OsE suggest that altering additional amino acids at five key amino acid positions (166, 240, 243, 255, and 256) can further enhance Coenzyme Q10 levels. Comparisons between OsH and OsI suggest that mutations at position 240 are crucial.

[0256] Experimental Example 9

[0257] Referring to the detection method of Experimental Example 1, the product of the corn Q10 synthesis element ZmF provided in Example D6 was verified. A comparative example strain was prepared by simultaneously incorporating the corn Q10 synthesis element ZmE provided in Example D5. The results are shown in Figure 15.

[0258] According to the results in Figure 15, we can see that:

[0259] E. coli transformed with the maize Q10 synthesis element ZmF can produce a certain level of Coenzyme Q10, which is higher than that of ZmE. Comparison of ZmF and ZmE suggests that modifying additional amino acids at five key amino acid positions (166, 240, 243, 255, and 256) can further increase Coenzyme Q10 levels.

[0260] Experimental Example 10

[0261] The product of the wheat Q10 synthesis element TaF provided in Example E6 was verified by referring to the detection method of Experimental Example 1. A comparative example strain was prepared by simultaneously incorporating the wheat Q10 synthesis element TaE provided in Example E5. The results are shown in FIG16 .

[0262] According to the results in Figure 16, we can see that:

[0263] E. coli transformed with the wheat Q10 synthesis element TaF can produce a certain level of Coenzyme Q10, exceeding that of TaE. Comparison of TaF and TaE suggests that modifying additional amino acids at five key amino acid positions (166, 240, 243, 255, and 256) can further increase Coenzyme Q10 levels.

[0264] In addition, referring to the methods of Experimental Examples 4 and 7, commercially available crop varieties were transformed based on the CRISPR / Cas9 system-guided editing and existing conventional transgenic technology to obtain wheat, rice, barley, oats, corn, sorghum, wild rice, millet, buckwheat, millet, sesame, sunflower, cucumber, zucchini, pumpkin, wax gourd, bitter melon, loofah, cucumber, watermelon, melon, leek, green onion, onion, leek, lettuce, tomato, spinach, lettuce, garland chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, dragon fruit, kiwi, etc., which have successfully completed gene editing. After extracting coenzyme Q10 extracts with reference to the method of Experimental Example 4 and performing liquid chromatography-mass spectrometry analysis, it was found that these plants also had beneficial changes in their ability to synthesize coenzyme Q10.

[0265] Comparative Example D1

[0266] Comparative Example D1, referring to the detection method of Experimental Example 1, detected the products of the rice Coq10 synthesis elements OsA, OsB, OsC, OsD, OsE, OsF, and OsG provided in Examples A1-A7, as well as the rice Coq1 point mutations M240I, M240V, and M240A. Comparative example strains were also prepared using an empty vector control (VEC) and a wild-type rice Coq1 (OsCoq1) transfection. The results are shown in Table 1. Data are the mean ± SD of three biological replicates.

[0267] Table 1 Detection results of enzyme activity products of Q10 synthesis element in comparative example D1

[0268] Comparative Example D2

[0269] Comparative Example D2, referring to the detection method of Experimental Example 1, tested the enzyme activities of the lettuce Coq10 synthesis elements LsA, LsB, LsC, LsD, LsE, and LsF provided in Examples B1-B6, as well as the other lettuce Coq1 point mutations I240M, I240T, I240P, I240S, and I240A. Comparative example strains were also prepared using an empty vector control (VEC) and a wild-type lettuce Coq1 (LsCoq1) transfection. The results are shown in Table 2, where the data are the mean ± SD of three biological replicates.

[0270] Table 2 Detection results of enzyme activity products of Q10 synthesis element in comparative example D2

[0271] Comparative Example D3

[0272] Comparative Example D3, referring to the detection method of Experimental Example 1, tested the enzyme activities of the cucumber Q10 synthesis components CsA and CsB provided in Examples C1-C2, as well as other cucumber Coq1 point mutations I240M and I240A. Comparative strains were also prepared using an empty vector control (VEC) and a wild-type cucumber Coq1 (CsCoq1) transfection. The results are shown in Table 3. Data are the mean ± SD of three biological replicates.

[0273] Table 3 Detection results of enzyme activity products of Q10 synthesis element in comparative example D3

[0274] Comparative Example D4

[0275] Comparative Example D4, referring to the detection method of Experimental Example 1, tested the enzyme activities of the maize Q10 synthesis components ZmA, ZmB, ZmC, ZmD, and ZmE provided in Examples D1-D5. Comparative strains were also prepared using an empty vector control (VEC) and a strain incorporating wild-type maize Coq1 (ZmCoq1). The results are shown in Table 4. Data are the mean ± SD of three biological replicates.

[0276] Table 4 Detection results of enzyme activity products of Q10 synthesis element in comparative example D4

[0277] Comparative Example D5

[0278] Comparative Example D5, referring to the detection method of Experimental Example 1, tested the enzyme activities of the wheat Q10 synthesis elements TaA, TaB, TaC, TaD, and TaE provided in Examples E1-E5. Comparative example strains were also prepared using an empty vector control (VEC) and a strain incorporating wild-type wheat Coq1 (TaCoq1). The results are shown in Table 5. Data are the mean ± SD of three biological replicates.

[0279] Table 5 Detection results of enzyme activity products of Q10 synthesis element in comparative example D5

[0280] Comparative Example D6

[0281] Comparative Example D6, referring to the detection method of Experimental Example 1, tested the enzyme activities of the rice Q10 synthesis components OsH and OsI provided in Examples A8-A9. The comparative strain was also prepared by incorporating the rice Q10 synthesis component OsE provided in Example A5. The results are shown in Table 6. Data are the mean ± SD of three biological replicates.

[0282] Table 6 Detection results of enzyme activity products of Q10 synthesis element in comparative example D6

[0283] Comparative Example D7

[0284] Comparative Example D7 used the same assay method as in Experimental Example 1 to test the enzyme activity of the maize Q10 synthesis element ZmF provided in Example D6. A comparative strain was prepared by incorporating the maize Q10 synthesis element ZmE provided in Example D5. The results are shown in Table 7. Data are the mean ± SD of three biological replicates.

[0285] Table 7 Detection results of enzyme activity products of Q10 synthesis element in comparative example D7

[0286] Comparative Example D8

[0287] Comparative Example D8 used the same assay method as in Experimental Example 1 to test the enzyme activity of the wheat Q10 synthesis element TaF provided in Example E6. A comparative bacterial strain was prepared by incorporating the wheat Q10 synthesis element TaE provided in Example E5. The results are shown in Table 8. Data are mean ± SD of three biological replicates.

[0288] Table 8 Detection results of enzyme activity products of Q10 synthesis element in comparative example D8

[0289] The above results fully demonstrate that the amino acid sequence of the plant Q10 synthesis element can confer or enhance the ability of plants to synthesize coenzyme Q10 by mutating the amino acid residue M or I to L, V, F, Y or C at position 240 of rice Coq1, and / or mutating the amino acid residue A to V at position 243 of rice Coq1, and / or mutating the amino acid residue I to M at position 255 of rice Coq1, and / or mutating the amino acid residue S to T at position 256 of rice Coq1, and / or mutating the amino acid residue K to D or E at position 166 of rice Coq1, and / or mutating the amino acid residue G to E at position 245 of rice Coq1, and / or changing the amino acid residues 145-173 and 238-263 of rice Coq1 to the corresponding sequences of tomato Coq1.

[0290] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A plant Q10 synthesis element that significantly improves the synthesis level of plant coenzyme Q10, characterized in that: Compared with rice Coq1, the amino acid sequence of the plant Q10 synthesis element corresponds to the following mutations in rice Coq1: 1) Position 240 has the mutation I / M240L / V / F / Y / C; 2) position 243 has a mutation A243V; 3) position 255 has a mutation I255M; 4) position 256 has a mutation S256T; 5) position 166 has the mutation K166D / E; 6) position 245 has a mutation G245E; and / or 7) The amino acid residues 145-173 and 238-263 were changed to the corresponding sequences of tomato Coq1, The amino acid sequence of the rice Coq1 is shown in SEQ ID NO.1, and the amino acid sequence of the tomato Coq1 is shown in SEQ ID NO.

69.

2. The plant Q10 synthesis element according to claim 1, characterized in that The amino acid sequence of the plant Q10 synthesis element is identical to or has at least 80%, 85%, 90%, 95%, 98% or 99% homology with any one of the following amino acid sequences: SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, SEQ ID NO.67; The plant Q10 synthesis element is derived from any one of rice, lettuce, cucumber, corn and wheat.

3. A coding gene, characterized in that It encodes the plant Q10 synthesis element according to any one of claims 1-2.

4. A vector containing the coding gene according to claim 3.

5. A recombinant bacterium or recombinant cell containing the vector according to claim 4.

6. A plant individual, plant tissue or plant cell containing the gene according to claim 3.

7. A coenzyme Q10 extract extracted from a plant individual, plant tissue or plant cell containing the gene according to claim 3.

8. Use of the plant Q10 synthesis element according to any one of claims 1 to 2 in the cultivation of plants, microorganisms and enzyme activity reaction systems that synthesize coenzyme Q10.

9. The use according to claim 8, characterized in that: It includes: The vector is used to transform the target plant, wherein the vector contains the gene encoding the plant Q10 synthesis element.

10. The use according to claim 8, characterized in that: It includes: The endogenous Coq1 gene of the target plant is modified to encode the plant Q10 synthesis element.

11. The use according to claim 8, characterized in that: It includes: The cells, tissues, individuals or groups of the target plant are subjected to mutagenesis or gene editing, and are screened to encode the plant Q10 synthesis element.

12. The use according to any one of claims 6 to 11, characterized in that: The target plant is any one of wheat, rice, barley, oats, corn, sorghum, wild rice, millet, buckwheat, millet, sesame, sunflower, cucumber, zucchini, pumpkin, wax gourd, bitter gourd, loofah, melon, watermelon, melon, leek, green onion, onion, leek, spinach, lettuce, tomato, lettuce, chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, pitaya, and kiwi.

Images