Composite silage leavening agent, silage and application

Abstract

The invention belongs to the technical field of biological feed, and particularly relates to a composite silage leavening agent, silage and application. The compound silage leavening agent is prepared from the following components: lactobacillus plantarum and vitamin enzyme, wherein the concentration of the lactobacillus plantarum is greater than or equal to 1 * 10 < 9 > CFU / kg, and the concentration of the cellulase is 1 * 10 < 6 >-1 * 10 < 8 > U / kg. In the preparation process of the silage, due to the synergistic effect of cellulase and lactobacillus plantarum, escape of nutrient substances such as ammoniacal nitrogen is reduced, the content of nutrient substances such as polypeptide is increased, and the nutritional value of protein of the silage is reserved. The ensiling feed disclosed by the invention is good in fermentation quality and rich in nutrient substances, and can improve the digestibility and the total volatile fatty acid yield of mutton sheep when being used for feeding the mutton sheep; and meanwhile, efficient conversion of silkworm branch and leaf byproducts can also be realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological feeds, and specifically relates to a compound silage fermentation agent, silage feed and application thereof. Background Art

[0002] Mulberry leaf and twig by-products refer to the by-products generated during the planting, pruning or picking of mulberry leaves, mainly including silkworm excrement, mulberry twigs and mulberry leaves, most of which are discarded as fuel or agricultural waste. The generation of unutilized mulberry leaf and twig by-products not only causes waste of valuable resources, but also increases environmental pressure. A large amount of substances such as cellulose, protein and trace elements still remain in the mulberry leaf and twig by-products, which can be widely used in agriculture, animal husbandry and industry, can realize the efficient utilization of resources and reduce waste. In addition, forage mulberry also has unique functional factors, which have incomparable advantages over other forage varieties in improving the quality and flavor of livestock and poultry products and enhancing animal immunity. Due to its high nutrient content, mulberry branches and leaves can be used as a potential feed resource for supplementing high-quality protein and fiber for cattle and sheep.

[0003] However, the mulberry leaf and twig by-products have a high water content and are difficult to store for a long time. Especially in the rainy season in the south, making silage fermentation feed is one of the common methods for preserving high-moisture fresh forage. Research shows that the mulberry leaf and twig by-products have a high protein content and buffer energy value, and a low content of water-soluble carbohydrates (WSC), which further exacerbates the difficulty of its preservation. Summary of the Invention

[0004] The purpose of the present invention is to provide a compound silage fermentation agent, silage feed and application thereof, so as to improve the digestibility of meat sheep.

[0005] To this end, the present invention provides the following technical solutions.

[0006] The first aspect of the present invention provides a compound silage fermentation agent, which includes the following components: Lactobacillus plantarum, cellulase; wherein, the concentration of Lactobacillus plantarum ≥ 1×10 9 CFU / kg, and the concentration of the cellulase is 1×10 6 ~1×10 8 U / kg.

[0007] In a preferred embodiment of the present invention, the Lactobacillus plantarum includes Lactobacillus plantarum FF34, and the preservation number of Lactobacillus plantarum FF34 is CCTCC NO:M 20211221.

[0008] The second aspect of the present invention provides an application of the compound silage fermentation agent as described above in the preparation of silage feed.

[0009] The third aspect of the present invention provides a silage feed. The raw materials for preparing the silage feed include: the composite silage fermentation agent as described above, and mulberry branches and leaves by-products.

[0010] In a preferred embodiment of the present invention, based on per kg of mulberry branches and leaves by-products, the viable count of Lactobacillus plantarum in the silage feed is ≥ 1×10 9 CFU and the cellulase activity is 1×10 6 ~1×10 8 U.

[0011] In a preferred embodiment of the present invention, it further includes molasses, and the content of the molasses is 1% of the fresh weight of the mulberry branches and leaves by-products

[0012] The fourth aspect of the present invention provides a method for preparing a silage feed. The method includes the following steps:

[0013] S1: Pretreat the mulberry branches and leaves by-products to obtain pretreated mulberry branches and leaves by-products;

[0014] S2: Add the composite silage fermentation agent to the obtained pretreated mulberry branches and leaves by-products for fermentation to obtain the silage feed.

[0015] In a preferred embodiment of the present invention, in step S1, the pretreatment process is: collect the mulberry branches and leaves by-products after feeding silkworms, dry them in the air at room temperature until the water content is 65 - 70%, and then crush and cut them to 2 - 3 cm.

[0016] In a preferred embodiment of the present invention, the mulberry branches and leaves by-products contain the following components in weight fractions: mulberry leaves 20 - 30%, mulberry branches 65 - 75%, and silkworm excrement 0 - 5%.

[0017] In a preferred embodiment of the present invention, in step S2, the fermentation conditions are: anaerobic fermentation, the fermentation temperature is 25 - 30°C, and the fermentation time is 30 - 60 days.

[0018] By means of the above technical solutions, the present invention has at least the following advantages:

[0019] The present invention provides a silage feed made from the by-products of mulberry leaves and branches. This feed is prepared by fermenting the by-products of mulberry leaves and branches with a compound silage fermentation agent. This feed can rapidly reduce the pH, ammonia-nitrogen level, and the number of harmful bacteria in the feed raw materials, while increasing the lactic acid content. Among them, the cellulase in the compound silage fermentation agent used can effectively degrade the fibers of the by-products of mulberry leaves and branches in the initial stage of fermentation. The monosaccharides produced serve as a carbon source for the growth of Lactobacillus plantarum or other microorganisms, forming a strictly anaerobic environment to promote the growth and fermentation of lactic acid bacteria and increase the accumulation of lactic acid during silage; the addition of Lactobacillus plantarum can increase the lactic acid bacteria attachment rate of the raw materials, produce lactic acid, and reduce fermentation losses. At the same time, it can acidify to improve the taste and inhibit the reproduction of harmful organisms.

[0020] During the preparation process of the silage feed of the present invention, due to the synergistic effect of cellulase and Lactobacillus plantarum, the escape of nutrients such as ammonia-nitrogen is reduced, and the content of nutrients such as polypeptides increases, retaining the nutritional value of its protein. In addition, the silage feed made from the by-products of mulberry leaves and branches provided by the present invention can improve the in vitro dry matter digestibility, increase the yield of total volatile fatty acids, and the total gas production.

[0021] The silage feed of the present invention has high stability and rich nutrients. When used in the feeding of meat sheep, it can improve the digestibility of meat sheep; at the same time, it can also achieve the efficient conversion of the by-products of mulberry leaves and branches.

[0022] The above description is only an overview of the technical solution of the present invention. In order to be able to more clearly understand the technical means of the present invention and implement it in accordance with the content of the specification, the following describes in detail with the preferred embodiments of the present invention as follows. Brief Description of the Drawings

[0023] Figure 1 Shows the changes in the pH, ammonia-nitrogen, and harmful bacteria content of the feed obtained after 7, 15, 30, and 60 days of fermentation in each example;

[0024] Figure 2 Shows the relative abundance changes of bacteria in the feed obtained after 0 days (FM), 7, 15, 30, and 60 days of fermentation in each example at the phylum (A) and genus (B) levels;

[0025] Figure 3 Shows the comparison of the in vitro total volatile fatty acid production between the silage feed obtained after 60 days of fermentation in Example 1 and the unfermented by-products of mulberry leaves and branches;

[0026] Figure 4 Shows the comparison of the in vitro total gas production between the silage feed obtained after 60 days of fermentation in Example 1 and the unfermented by-products of mulberry leaves and branches;

[0027] Figure 5It shows the comparison of the in vitro digestibility between the silage obtained by fermentation for 60 days in Example 1 and the unfermented mulberry branch and leaf by-products. Detailed implementation manners

[0028] In order to make the technical means, creative features, achieved purposes and functions of the present invention easy to understand, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present invention.

[0029] Unless otherwise specified, the following are involved and used in the embodiments:

[0030] (1) Lactobacillus plantarum: Lactobacillus plantarum FF34, classified and named as Lactobacillus plantarum, deposited in the China Center for Type Culture Collection (CCTCC), deposit number CCTCC NO: M 20211221. This strain applied for a patent on July 5, 2022, with the application number: 202210793310.8.

[0031] (2) The cellulase product number is: C6270C, purchased from Beijing Bio-ATech Co., Ltd.

[0032] As used herein, the term "silage" refers to a feed preserved by anaerobic fermentation, mainly used for feeding ruminants such as cattle and sheep. Its production process is to cut fresh plant materials (such as corn, sorghum, forage grass, etc.) and ferment them under anaerobic conditions to produce organic acids such as lactic acid, reducing the pH value, thereby inhibiting the growth of harmful microorganisms and achieving the purpose of long-term preservation. "Mulberry branch and leaf by-products" refer to the by-products generated during the planting, pruning or picking of mulberry leaves of mulberry trees, mainly including mulberry branches, mulberry leaf residues, etc. These by-products have a wide range of uses in agriculture, animal husbandry and industry, can realize the efficient utilization of resources and reduce waste. The inventor found in long-term research that the mulberry branch and leaf by-products have a high moisture content and are difficult to store for a long time, so there are certain limitations in use as feed.

[0033] Based on the above, the present invention provides a silage feed made from mulberry branch and leaf by-products that can improve the digestibility of meat sheep and a preparation method thereof. The silage feed based on mulberry branch and leaf by-products provided by the present invention has an increased lactic acid level and a decreased pH value after being fermented by a silage fermenter, while reducing harmful bacteria such as Escherichia coli. At the same time, the obtained silage feed also reduces the loss of ammonia nitrogen and effectively preserves the free amino acids and small peptides in the by-products. In addition, through in vitro digestion tests, the present invention found that the silage feed based on mulberry branch and leaf by-products can effectively improve its digestibility.

[0034] In one embodiment, the present invention provides a compound silage fermenter, and the compound silage fermenter includes the following components: Lactobacillus plantarum, cellulase; wherein, the concentration of the Lactobacillus plantarum ≥ 1×10 9 CFU / kg, and the concentration of the cellulase is 1×10 6 ~1×10 8 U / kg.

[0035] Furthermore, the Lactobacillus plantarum can be any suitable Lactobacillus plantarum in the art, and in the present invention, it is preferably Lactobacillus plantarum FF34, and the preservation number of the Lactobacillus plantarum FF34 is CCTCC NO: M 20211221.

[0036] In another embodiment, the present invention provides an application of a compound silage fermenter in the preparation of silage feed.

[0037] In still another embodiment, the present invention provides a silage feed, and the raw materials for preparing the silage feed include: a compound silage fermenter, and mulberry branch and leaf by-products.

[0038] Preferably, based on every kg of mulberry branch and leaf by-products, the viable count of Lactobacillus plantarum in the silage feed > 1×10 9 CFU and the cellulase activity is 1×10 6 ~1×10 8 U.

[0039] Furthermore, the silage feed further includes molasses, and the addition amount of the molasses is 1% of the fresh weight of the mulberry branch and leaf by-products. Based on the high buffer energy value and low soluble sugar content of the mulberry branch and leaf by-products, it is difficult to successfully produce fermented feed. Therefore, the molasses selected in the present invention has a wide source and a low price. By adding molasses, it can be used as a nutrient source for lactic acid bacteria, providing more fermentation substrates for lactic acid bacteria, thereby promoting the growth of lactic acid bacteria.

[0040] In yet another embodiment, the present invention provides a preparation method of a silage feed, and the method includes the following steps:

[0041] Step 1: Pretreat the by-products of mulberry leaves and branches to obtain pretreated by-products of mulberry leaves and branches. In this step, the pretreatment process of the by-products of mulberry leaves and branches is as follows: Collect the by-products of mulberry leaves and branches after feeding silkworms, which contain 20-30% mulberry leaves, 65-75% mulberry branches, and 0-5% silkworm excrement. First, adjust the moisture content of the by-products of mulberry leaves and branches, and reduce the moisture content to 65%-70% at room temperature. Then, use a crusher to crush and shorten the mulberry branch structure to 2-3 cm. The appropriate moisture content is 65%, 66%, 67%, 68%, 69% or 70%, preferably 68%.

[0042] Step 2: Add a compound silage fermentation agent to the obtained pretreated by-products of mulberry leaves and branches for fermentation to obtain silage. In this step, the fermentation conditions are as follows: Anaerobic fermentation, the fermentation temperature is 25-30°C, and the fermentation time is 30-60 days. The appropriate fermentation temperature can be, for example, 25°C, 26°C, 27°C, 28°C, 29°C or 30°C, preferably 25°C. The appropriate fermentation time can be 30 days, 35 days, 40 days, 45 days, 50 days, 55 days or 60 days, preferably 60 days.

[0043] The following will be discussed in detail with specific examples.

[0044] Example 1:

[0045] (1) Activation and cultivation of Lactobacillus plantarum: Inoculate Lactobacillus plantarum at a ratio of 3% into 5 mL of liquid MRS medium and culture it at 37°C for 48 h for the first activation to obtain once-activated Lactobacillus plantarum. Inoculate the obtained once-activated Lactobacillus plantarum at a ratio of 3% into 5 mL of liquid MRS medium and culture it at 37°C for 48 h for the second activation to obtain twice-activated Lactobacillus plantarum. Inoculate the twice-activated Lactobacillus plantarum at a ratio of 3% into 120 mL of MRS medium and culture it at 37°C for 48 h to obtain a Lactobacillus plantarum culture solution. After fermentation for 48 h, perform viable count on the obtained Lactobacillus plantarum culture solution and keep the viable count greater than 1×10 9 CFU, and store it for later use.

[0046] The measurement results of the dynamic changes of the acid production ability (culture solution pH) and the absorbance value at 620 nm (0 h, 3 h, 6 h, 9 h, 12 h, 15 h, 18 h, 21 h, 24 h and 48 h) of the above-mentioned implanted Lactobacillus during the culture process are shown in Table 1.

[0047] Table 1 Dynamic changes of acid production ability and absorbance value at 620 nm during the culture of lactic acid bacteria

[0048]

[0049]

[0050] The acid production ability is one of the important characteristics of good vitality of lactic acid bacteria. As shown in Table 1, with the extension of the culture time, the acid production ability of Lactobacillus plantarum implanted shows an increasing trend. When cultured for 48 h, the lowest pH is 3.76, and at this time, the acid production ability of Lactobacillus plantarum is the strongest; at the same time, when cultured for 48 h, its growth rate increases to 2.35.

[0051] (2) Preparation of the compound silage ferment: Add cellulase (its usage concentration is 1×10 6 U / kg fresh weight) and 1% molasses of the fresh weight of the mulberry leaf and branch by-products to the obtained Lactobacillus plantarum culture solution, mix evenly to obtain the compound silage ferment.

[0052] (3) Pretreatment of the discarded mulberry leaves and branches: Collect the mulberry leaf and branch by-products after feeding silkworms. This by-product contains 30% mulberry leaves, 65% mulberry branches and 5% silkworm excrement. First, carry out the treatment of moisture adjustment, reduce the water content to 65% - 70% at room temperature, and then use a crusher to crush and break the mulberry branch structure and cut it short to 2 - 3 cm to obtain the pretreated mulberry leaf and branch by-products.

[0053] (4) Preparation of the silage feed: Add the compound silage ferment to the obtained pretreated mulberry leaf and branch by-products in an amount of 1×10 9 CFU Lactobacillus plantarum / kg (fresh weight) and 1×10 6 U / kg (fresh weight) of cellulase, stir evenly to obtain the fermentation raw materials. Then put the fermentation raw materials into 30 cm×40 cm polyethylene plastic bags, 200 g per bag, repeat three times for each group, seal them in vacuum, and ferment at room temperature (25±2℃) for 7 days, 15 days, 30 days and 60 days respectively.

[0054] Example 2:

[0055] The only difference between this example and Example 1 is that: cellulase is not added during the preparation process of the silage feed, and the rest is the same as Example 1. Specifically:

[0056] (1) Activation and culture of Lactobacillus plantarum: Inoculate Lactobacillus plantarum into 5 mL of liquid MRS medium at a ratio of 3% and culture it at 37℃ for 48 h for the first activation to obtain the once-activated Lactobacillus plantarum. Inoculate the obtained once-activated Lactobacillus plantarum into 5 mL of liquid MRS medium at a ratio of 3% and culture it at 37℃ for 48 h for the second activation to obtain the twice-activated Lactobacillus plantarum. Inoculate the twice-activated Lactobacillus plantarum into 120 mL of MRS medium and culture it at 37℃ for 48 h to obtain the Lactobacillus plantarum culture solution. After fermenting for 48 h, conduct viable count on the obtained Lactobacillus plantarum culture solution, and keep the viable count greater than 1×109 CFU, reserved for backup.

[0057] (2) Preparation of silage fermentation agent: Add molasses at 1% of the fresh weight of the mulberry and silkworm branch by-product to the obtained Lactobacillus plantarum culture solution, and mix evenly to obtain the silage fermentation agent.

[0058] (3) Pretreatment of discarded mulberry and silkworm branches: Collect the mulberry and silkworm branch by-products after feeding silkworms. This by-product contains 30% mulberry leaves, 65% mulberry branches, and 5% silkworm excrement. First, perform moisture adjustment on it, reduce the water content to 65% - 70% at room temperature, and then use a crusher to crush and break the mulberry branch structure and cut it short to 2 - 3 cm to obtain the pretreated mulberry and silkworm branch by-product.

[0059] (4) Preparation of silage: Add the silage fermentation agent to the obtained pretreated mulberry and silkworm branch by-product at a rate of 1×10 9 CFU Lactobacillus plantarum / kg (fresh weight), stir evenly to obtain the fermentation raw material. Then put the fermentation raw material into 30 cm × 40 cm polyethylene plastic bags, 200 g per bag, repeat three times for each group, vacuum seal, and ferment at room temperature (25 ± 2°C) for 7 days, 15 days, 30 days, and 60 days respectively.

[0060] Example 3:

[0061] The only difference between this example and Example 1 is that: Lactobacillus plantarum was not added during the preparation of the silage. The rest is the same as Example 1. Specifically:

[0062] (1) Preparation of fermentation agent: Add cellulase (its usage concentration is 1×10 6 U / kg fresh weight) and molasses at 1% of the fresh weight of the mulberry and silkworm branch by-product to the obtained Lactobacillus plantarum culture solution, and mix evenly to obtain the silage fermentation agent.

[0063] (2) Pretreatment of discarded mulberry and silkworm branches: Collect the mulberry and silkworm branch by-products after feeding silkworms. This by-product contains 30% mulberry leaves, 65% mulberry branches, and 5% silkworm excrement. First, perform moisture adjustment on it, reduce the water content to 65% - 70% at room temperature, and then use a crusher to crush and break the mulberry branch structure and cut it short to 2 - 3 cm to obtain the pretreated mulberry and silkworm branch by-product.

[0064] (3) Preparation of silage: Add the silage fermentation agent to the obtained pretreated mulberry and silkworm branch by-product at a rate of 100 mg cellulase / kg (fresh weight), stir evenly to obtain the fermentation raw material. Then put the fermentation raw material into 30 cm × 40 cm polyethylene plastic bags, 200 g per bag, repeat three times for each group, vacuum seal, and ferment at room temperature (25 ± 2°C) for 7 days, 15 days, 30 days, and 60 days respectively.

[0065] Example 4:

[0066] The only difference between this example and Example 1 is that during the preparation of the silage feed, only distilled water equal in amount to the compound silage fermentation agent was added, and the rest was the same as in Example 1. Specifically:

[0067] Prepare the silage feed: Add distilled water equal in amount to the compound silage fermentation agent to the obtained pretreated mulberry leaf and branch by-products, stir evenly to obtain the fermentation raw material. Then, put the fermentation raw material into 30 cm × 40 cm polyethylene plastic bags, 200 g per bag, repeat three times for each group, seal it under vacuum, and ferment at room temperature (25 ± 2 °C) for 7 days, 15 days, 30 days, and 60 days respectively.

[0068] Example 5: Quality evaluation of silage feed

[0069] In this example, the quality of the feeds obtained in the above examples was evaluated respectively to assess the influence of different fermentation agents on the fermentation of mulberry leaf and branch by-products. That is, after 7, 15, 30, and 60 days of fermentation, open the fermentation bags to take samples, mix them evenly in a sterile container, sample the fermented feed of mulberry leaf and branch by-products, and use them for analyzing the fermentation quality, protein and cellulose composition, microbial population, and bacterial diversity respectively. Finally, conduct statistical analysis:

[0070] (1) Analysis of fermentation quality

[0071] Determine the fermentation parameters (pH, ammonia nitrogen, and the number of harmful bacteria) to evaluate the quality of the silage feeds obtained in each group. The determination method is as follows: Take 20 g of the sample into 180 ml of distilled water, shake it on a shaker for 60 min and then filter. Use a pH meter (E-201-D, Shanghai First Electric Scientific Instrument Co., Ltd., China) to measure the pH of the filtrate. Analyze lactic acid and acetic acid in the filtrate using a high-performance liquid chromatograph (Agilent 1260, Agilent Technologies Inc., USA). The results are shown in Figure 1 , where LE in the figure refers to the silage feed obtained in Example 1, LP refers to the silage feed obtained in Example 2, EM refers to the silage feed obtained in Example 3, and CK refers to the silage feed obtained in Example 4.

[0072] pH, ammonia nitrogen, and harmful bacteria are important indicators for evaluating the quality of roughage. As Figure 1As shown in the figure, the compound silage starter provided in Embodiment 1 of the present invention is applied to the fermentation of mulberry branch and leaf by-products, significantly reducing the pH, ammonia nitrogen content and the number of harmful bacteria, thereby effectively improving the nutritional quality of discarded mulberry branches and leaves. Specifically, the ammonia nitrogen content of the CK treatment during the whole silage fermentation process (the content was 10.4 g / kg on the 60th day) was significantly higher than that of the LP and LE groups (the LP and LE contents were 1.94 and 2.02 g / kg respectively on the 60th day, P < 0.01). The above results show that the addition of Lactobacillus plantarum and cellulase inoculants plays a synergistic effect, thus avoiding the loss of nutrients during the silage process. Therefore, the silage feed finally obtained in Embodiment 1 has a high content of nutritional components and a small number of harmful bacteria.

[0073] (2) Analysis of protein and cellulose composition

[0074] After drying each sample in an oven at 65 °C for 48 h, the dry matter content in the silage feed obtained in each group was calculated based on the dry weight and fresh weight. After drying, the samples were ground with a pulverizer through a 1 mm sieve for analysis of protein and cellulose composition. The crude protein and true protein contents were determined by a Kjeldahl apparatus. And the non-protein nitrogen was calculated by the difference between the crude protein and the true protein. The ammonia nitrogen was determined by the phenol-sodium hypochlorite colorimetric method. The polypeptide concentration in the fermented feed was determined as the difference between the non-protein nitrogen, the concentration of free amino acids and the ammonia nitrogen in the silage. The results are shown in Table 2.

[0075] Table 2 Analysis of protein and cellulose composition in each group of feeds

[0076]

[0077]

[0078] By detecting the dynamic changes in the protein components (such as crude protein, total nitrogen, non-protein nitrogen, polypeptide nitrogen, free amino acid nitrogen, and ammonia nitrogen) of the fermented feed from mulberry and silkworm by-products, the effects of adding different additives on the protein distribution of the fermented feed from mulberry and silkworm by-products were evaluated. Total nitrogen includes true protein nitrogen and non-protein nitrogen, and the efficiency of non-protein nitrogen in ruminant nitrogen retention is lower than that of true protein. As shown in Table 2, more than half of the protein in all groups was degraded into non-protein nitrogen (639, 548, 645, and 642 g / kg respectively), indicating a relatively high degree of protein hydrolysis. However, the percentages of free amino acid nitrogen (26.5, 25.6, 22.3, and 19.3 g / kg respectively) and ammonia nitrogen (10.4, 9.97, 1.94, and 2.02 g / kg respectively) in the obtained feeds of each group were relatively low, while the percentage of polypeptide nitrogen was relatively high, indicating that polypeptide nitrogen accounted for most of the NPN. In addition, the addition of the compound silage fermentation agent in Example 1 increased the proportion of polypeptide nitrogen in the obtained silage feed and decreased the proportions of free amino acid nitrogen and ammonia nitrogen. The above results show that the addition of the compound silage fermentation agent LE in Example 1 better retained the nutritional components of the fermented feed from mulberry and silkworm by-products.

[0079] (3) Analysis of microbial population and bacterial diversity

[0080] The relative abundance changes of microorganisms in the obtained silage feeds of each group in the above examples were detected at the phylum and genus levels. The genomic DNA was extracted using the TIANamp Bacteria DNA Extraction Kit (Tiangen Biotech Co., Ltd, Beijing, China). The concentration of genomic DNA was measured using a 260 nm UV-VIS spectrophotometer (Shanghai Sunny Hengping Scientific Instrument Co., Ltd, Shanghai, China). The extracted DNA was stored at -80 °C temporarily. Subsequently, it was sent to Sangon Biotech (Shanghai) Co., Ltd for the determination of 16S rRNA, and the primers used were: 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). The results are shown in Figure 2 .

[0081] As Figure 2 shown, compared with Examples 2-4, the silage feed obtained after 60 days of fermentation in Example 1 significantly increased the relative abundance of the Lactobacillus genus and decreased the relative abundances of the Aerococcus, unclassi-fied_Enterobacteriaceae, Enterococcus, and Enterobacter genera.

[0082] Example 6: Determination of in vitro digestibility

[0083] The silage obtained after 60 days of fermentation in Example 1 and the feed obtained after 60 days of fermentation in Example 4 were subjected to in vitro digestibility determination. The specific operation was as follows: After drying the samples in an oven at 65°C for 48 h, the samples were ground with a pulverizer through a 1-mm sieve and used for digestibility determination. 500 mL of rumen fluid was collected from the rumens of 3 healthy fistulated sheep, mixed evenly, and filtered through 3 layers of gauze to obtain a mixed solution. The obtained mixed rumen fluid was filled into a thermos flask and quickly transferred to the laboratory for in vitro digestibility determination test. The results are shown in Figure 3 、 4 and 5.

[0084] As Figure 3 、 4 and 5 show, compared with the mulberry and silkworm branch by-products added only with distilled water (Example 4), cellulase (Example 2), and Lactobacillus plantarum (Example 3) (the dry matter digestibility was 80.4, 80.1, and 80.4 respectively; the total volatile fatty acid yields were 78.3, 80.0, and 80.8 respectively), the silage obtained after 60 days of fermentation in the case of mixed addition of bacteria and enzyme (Example 1) significantly increased the dry matter digestibility and the total volatile fatty acid yield (the dry matter digestibility and the total volatile fatty acid yield were 82.7 and 89.3 respectively).

[0085] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications within the scope of the technical solution of the present invention to make equivalent embodiments of equivalent changes. However, as long as it does not depart from the content of the technical solution of the present invention, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A composite silage fermentation agent, characterized in that: The composite silage fermentation agent comprises the following components: plant lactobacillus and vitamin enzyme; wherein the concentration of plant lactobacillus is ≥1×10 9 CFU / kg, the concentration of the cellulase was 1×10 6 ~1×10 8 U / kg.

2. The composite silage fermentation agent according to claim 1, characterized in that: The plant lactobacillus includes plant lactobacillus FF34, and the preservation number of the plant lactobacillus FF34 is CCTCC NO: M 20211221.

3. Use of the composite silage fermentation agent according to claim 1 or 2 in preparing silage.

4. A silage, characterized in that: The raw materials for preparing the silage include: the composite silage fermentation agent according to claim 1 or 2, and by-products of silkworm branches and leaves.

5. The silage according to claim 4, characterized in that: The number of viable Lactobacillus plantarum in the silage is ≥ 1×10 9 CFU and cellulase activity were 1×10 6 ~1×10 8 U.

6. The silage according to claim 4, characterized in that: It also includes molasses, wherein the content of the molasses is 1% of the fresh weight of the silkworm and mulberry branches and leaves by-products.

7. The method for preparing silage according to any one of claims 5 to 7, characterized in that: The method comprises the following steps: S1: pre-treating the silkworm branches and leaves by-products to obtain pre-treated silkworm branches and leaves by-products; S2: adding a composite silage fermentation agent to the obtained pre-treated silkworm branches and leaves by-products for fermentation to obtain silage.

8. The preparation method according to claim 7, characterized in that: In step S1, the pretreatment process is: collecting mulberry branches and leaves byproducts after feeding silkworms, drying them at room temperature until the moisture content is 65-70%, and then flattening and cutting them into 2-3 cm.

9. The preparation method according to claim 7 or 8, characterized in that: The mulberry branches and leaves by-products comprise the following components in weight fractions: 20-30% mulberry leaves, 65-75% mulberry branches and 0-5% silkworm excrement.

10. The preparation method according to claim 7, characterized in that: In step S2, the fermentation conditions are: anaerobic fermentation, fermentation temperature is 25-30°C, and fermentation time is 30-60 days.

Images