Application of myriocin in relieving rosacea

Abstract

The invention belongs to the technical field of biology, and particularly discloses application of myriocin in relieving rosacea, the myriocin disclosed by the invention can obviously improve rosacea-like symptoms, and can reduce the level of rosacea-related proinflammatory factors in rosacea-like skin lesions.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of myriocin in relieving rosacea. Background Art

[0002] Rosacea is a chronic inflammatory skin disease that commonly occurs in the central part of the face, mainly manifested as repeated flushing and erythema in the central part of the face, accounting for about 2-10% of the general population.

[0003] Lipids play a crucial role in the structural integrity and function of the skin. Sebum derived from sebaceous cells and lipids derived from keratinocytes cover the skin surface, including cholesterol esters, triglycerides, and squalene. Epidermal keratinocytes are supported by an extracellular lipid matrix composed of ceramides, cholesterol, and free fatty acids. Lipids play a key role in skin inflammation, especially when they are converted into bioactive mediators. These key bioactive lipids include sphingolipids, eicosanoids, and endocannabinoids, etc.

[0004] Myriocin (also known as: Myriocin, ISP-1, Thermmozymocidin), molecular formula C 21 H 39 NO 6 , is a natural compound isolated from the fungus Isaria sinclairii, which can block the interleukin-2 receptor signal transduction pathway by regulating sphingolipid metabolism, thereby inhibiting the proliferation of T cells and showing strong immunosuppressive activity.

[0005] Currently, there is no relevant research report on the ability of myriocin to relieve rosacea. Summary of the Invention

[0006] Through a large number of experiments and extensive research, the present invention discovers that myriocin can relieve rosacea-like dermatitis, including relieving the degree of skin lesion erythema and the degree of inflammatory cell infiltration in the skin lesions, and significantly reducing the expression of inflammatory factors (KLK5, CXCL1, TNF-α, MMP9, IL-6, CCL2) in the skin lesions.

[0007] Kallikrein 5 (KLK5) is a serine protease mainly expressed in the epidermal layer of the skin. It participates in the desquamation of the stratum corneum and the regulation of skin barrier function. In rosacea, KLK5 promotes the abnormal decomposition of CAMP through overactivation, thereby generating LL37 with inflammatory properties. The overactivity of KLK5 can also directly induce skin inflammatory reactions.

[0008] Chemokine ligand 1 (CXCL1) belongs to the chemokine subfamily and is involved in the occurrence and development of many inflammatory diseases, including inducing angiogenesis and recruiting neutrophils. CXCL1 is significantly correlated with the disease severity of rosacea.

[0009] Tumor necrosis factor (TNF-α) is mainly secreted by macrophages and is involved in regulating a wide range of biological processes, including cell proliferation, differentiation, and apoptosis. Macrophages play an important role in the pathogenesis of rosacea, and TNF-α is closely related to the inflammatory process of rosacea.

[0010] Matrix metalloproteinase 9 (MMP9) belongs to the gelatinase in the matrix metalloproteinases. It can cause cell aggregation, inflammatory tissue damage, and extracellular matrix degradation in the pathogenesis of rosacea, exacerbating the inflammatory response. Existing rosacea treatment drugs such as tetracycline have a certain ability to inhibit the matrix metalloproteinase family.

[0011] Interleukin-6 (IL-6) is an important pro-inflammatory cytokine. During the immune response, various immune cells including macrophages can produce IL-6. IL-6 is one of the important indicators reflecting the severity of inflammation. There is a significant positive correlation between the elevated level of IL-6 in rosacea patients and the severity of rosacea symptoms.

[0012] Chemokine ligand 2 (CCL2) is an important signaling substance mediating the inflammatory response and can promote the migration of macrophages to the inflammatory site. The expression of CCL2 increases in rosacea patients, which may be related to the skin inflammation of rosacea.

[0013] One aspect of the present invention relates to the application of myriocin in alleviating rosacea.

[0014] Another aspect of the present invention relates to the application of a drug comprising myriocin in alleviating rosacea. Myriocin can be used as the sole active ingredient or as one of the active ingredients.

[0015] The third aspect of the present invention relates to the application of a drug comprising myriocin in alleviating the skin lesions of a rosacea-like mouse model. The drug administration method can be oral, intraperitoneal injection, or subcutaneous injection.

[0016] The fourth aspect of the present invention relates to a method for constructing the above-mentioned rosacea-like mouse model. When constructing the rosacea-like mouse model, an antimicrobial peptide LL37 polypeptide at 640 μM is injected intradermally into the back of the mouse once a day to obtain the animal model.

[0017] The fifth aspect of the present invention relates to an animal model for verifying that myriocin can improve rosacea-like symptoms.

[0018] The sixth aspect of the present invention lies in providing a cell model for verifying that myriocin can improve the inflammatory phenotype of rosacea.

[0019] Preferably, the cell model is obtained by stimulating HaCaT cells with 4 μM antimicrobial peptide LL37 polypeptide for 12 h.

[0020] The seventh aspect of the present invention lies in a myriocin that can reduce pro-inflammatory factors related to rosacea, and the pro-inflammatory factors are KLK5, CXCL1, TNF-α, MMP9, IL-6, and CCL2.

[0021] The present invention proves through cell models and animal models that myriocin can significantly improve rosacea-like inflammation and can reduce the levels of pro-inflammatory factors related to rosacea (KLK5, CXCL1, TNF-α, MMP9, IL-6, CCL2) in rosacea-like skin lesions. Description of the Drawings

[0022] Figure 1 For lipidomics analysis to reveal changes in sebum components of rosacea patients; A: PLS-DA score plot and validation plot of the healthy control group and the rosacea group; B: Volcano plot of differential lipids between the healthy control group and the rosacea group; C: Cluster heat map of differential lipids between the healthy control group and the rosacea group; D: Enrichment pathway map of differential lipids between the healthy control group and the rosacea group.

[0023] Figure 2 For myriocin, a serine palmitoyltransferase inhibitor, to relieve LL37-induced rosacea-like inflammation; A: Overview of the sphingolipid pathway; B: Statistical analysis of the expression of key metabolic enzyme genes in the sphingolipid pathway in the skin of the healthy control group and rosacea skin lesions in the GSE65914 database; C: Comparison of the skin lesion phenotypes on the backs of 4 groups of mice, n = 5 - 7; D: Statistical analysis of the erythema scores on the backs of 4 groups of mice; Comparison of HE staining of skin lesions on the backs of 4 groups of mice and statistical analysis of the inflammatory cell infiltration count; E: Extracting RNA from the skin lesions on the backs of 4 groups of mice, reverse transcription, and qRT-PCR to detect differences in the expression of inflammatory factors.

[0024] Figure 3 For the expression results of myriocin to relieve the expression of inflammatory factors CXCL1, CCL2, and IL-6 in LL37-induced HaCaT cells. Detailed Embodiments

[0025] The following is a further detailed description through specific embodiments:

[0026] The following experiments used Student's t-test to evaluate the significance of differences. For the analysis among multiple groups of samples, one-way analysis of variance (ANOVA) was used for comparison. A p-value < 0.05 was considered significant (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

[0027] 1. Materials and Methods

[0028] 1.1 Collect facial sebum samples from 20 patients with rosacea and 18 healthy volunteers

[0029] (1) Inclusion criteria:

[0030] ① Patients with rosacea should meet the diagnostic criteria for rosacea; ② Females, aged 18 to 40 years old, with a BMI of 18.5 - 23.9; ③ Without severe organic diseases or mental diseases, without metabolic diseases such as diabetes and hyperlipidemia; ④ Have not consumed or taken foods or drugs that may interfere with the intestinal flora, such as alcohol, probiotic drugs, and antibiotics, in the past 4 weeks; ⑤ Can regularly visit the hospital for follow-up and cooperate with the doctor to complete skin examinations, collection of facial sebum microorganisms, and blood collection; ⑥ Voluntarily participate and sign the informed consent form.

[0031] Healthy volunteers should meet criteria ② - ⑥.

[0032] (2) Sebum collection:

[0033] ① Label the cryotubes; ② Wipe with 70% isopropyl alcohol cotton pads and wait for drying from 8:00 to 11:00 in the morning; ③ The experimenter wears sterile gloves and uses degreasing forceps to paste the Sebutape test paper on the patient's cheek area and remove it after 1 h and place it in the sample tube.

[0034] (3) Perform lipidomics sequencing analysis on the facial sebum samples to screen for differential lipids.

[0035] Figure 1 For the results of lipidomics sequencing analysis of facial sebum samples, to screen for differential lipids, it was found that the lipid composition of the facial skin of rosacea was dysregulated, and the abundance of sphingolipid metabolites increased significantly. Specifically, Figure 1 The upper figure of A is the PLS-DA score plot: the abscissa represents the first principal component PC1, and the ordinate represents the second principal component PC2. Each point in the figure represents a sample, and the degree of dispersion of the two color symbols represents the distribution trends of the two groups of samples on the PC1 and PC2 axes respectively. Figure 1 The lower figure of A is the permutation test plot: Intercept.R2 and Intercept.Q2 are used to measure whether the model is overfitted. The experimental results show that the difference between the two groups is significant, and Q2 < 0 indicates that there is no overfitting in the model, and the analysis of differential metabolites is relatively accurate.

[0036] Figure 1 Figure B is a volcano plot of differential metabolites, which is used to display differential metabolites (univariate statistical test). The fold change of metabolic ions in the comparison group is used as the abscissa, and -log10(q-value) is used as the ordinate for display. The experimental results show that there are a total of 310 up-regulated differential metabolites and 54 down-regulated differential metabolites in the two groups in the figure.

[0037] Figure 1 Figure C is a clustering heat map of differential metabolites, which represents the expression of differential metabolites in samples of different groups (the vertical column of group C represents the healthy control group, and the vertical column of group R represents the rosacea group). After normalizing the intensity values of each metabolite (horizontal row), it is displayed with a heat map. The experimental results show that the differential metabolites of sebum in the rosacea group are mainly related to sphingolipid metabolism, such as SPB 18:0;2O, 2-aminooctadecane-1,3-diol (dihydrosphingosine); SPB 18:1;2O, 2-amino-4-octadecene-1,3-diol (sphingosine); Cer 17:1;2O / 16:1, ceramide non-hydroxy fatty acid sphingosine; Cer 17:1;2O / 28:3;2O, ceramide esterified ω-hydroxy fatty acid sphingosine, etc., and the abundances of these sphingolipid-related metabolites are significantly higher than those in the normal group.

[0038] Figure 1 Figure D is a KEGG bubble plot of differential metabolites. The results of KEGG enrichment analysis are displayed as a scatter plot using ggplot2: Rich Factor represents the number of differential metabolites located in this KEGG / the total number of metabolites located in this KEGG. The smaller the P value, the higher the KEGG enrichment degree. The experimental results show that the differential metabolites of sebum in the two groups are enriched in pathways such as sphingolipid signaling pathway, glycerophospholipid, and sphingolipid metabolism. Figure 1In D, Apoptosis: Apoptosis; Phosphatidylinositol signaling system: Phosphatidylinositol signaling system; Sphingolipid signaling pathway: Sphingolipid signaling pathway; Insulin resistance: Insulin resistance; AGE-RAGE signaling pathway in diabetic complications: AGE-RAGE signaling pathway in diabetic complications; Leishnanlasis: Leishmaniasis; Fatty acid degradation: Fatty acid degradation; Steroid biosynthesis: Steroid biosynthesis; Glycerolipid metabolism: Glycerolipid metabolism; Inositol phosphate metabolism: Inositol phosphate metabolism; Glycerophospholipid metabolism: Glycerophospholipid metabolism; Sphingolipid metabolism: Sphingolipid metabolism; Metabolic pathways Fatty acid metabolism: Metabolic pathways Fatty acid metabolism; Fatty acid metabolism: Fatty acid metabolism; Neurotrophin signaling pathway: Neurotrophin signaling pathway; Long-term depression: Long-term depression; Ovarian steroidogenesis: Ovarian steroidogenesis; Adipocytokine signaling pathway: Adipocytokine signaling pathway; Regulation of lipolysis in adipocytes: Regulation of lipolysis in adipocytes; Fat digestion and absorption: Fat digestion and absorption; Bile secretion: Bile secretion; Vitamin digestion and absorption: Vitamin digestion and absorption; Cellular Process: Cellular Process; Environmental Information Processing: Environmental Information Processing; Human Diseases: Human Diseases; Organismal Systems: Organismal Systems.

[0039] Figure 2A is a schematic diagram of the sphingolipid synthesis pathway. Serine and palmitic acid are two substrates for sphingolipid synthesis. Several key enzymes in the sphingolipid metabolic pathway include serine palmitoyltransferase SPTLC (the rate-limiting enzyme in sphingomyelin metabolism), ceramide synthase CERS, dihydroceramide desaturase DEGS, sphingosine kinase SPHK, etc. Figure 2 In A, Palmitic acid: palmitic acid; PalmitoyI-CoA: palmitoyl coenzyme A; Serine: serine; 3-Keto-sphinganine (3-KDS): 3-ketodihydrosphingosine; Sphinganine (DHS / SA): dihydrosphingosine; Dihydroceramide (DH-Cer): dihydroceramide; Ceramide (Cer): ceramide; Complex Sphingolipids: complex sphingolipids; sphingomyelin: sphingomyelin; Ceramidase: ceramidase; Sphingosine (SPH): sphingosine; sphingosine-1-phosphate (S1P): sphingosine-1-phosphate.

[0040] Figure 2 B is the statistical analysis of the expression levels of key enzyme genes involved in the sphingolipid metabolic pathway in the skin lesions of the rosacea group and the normal control group in the GSE65914 public database. ***: p < 0.001. The experimental results show that the key enzymes in the sphingolipid metabolic pathway (including SPTLC3, CERS4, DEGS2, ACER3, SPHK1, SPHK2) are significantly highly expressed in the rosacea skin lesions (group C represents the healthy control group, and group R represents the rosacea group).

[0041] The serine palmitoyltransferase inhibitor myriocin was selected for subsequent analysis and experiments.

[0042] 1.2 Animal experiments

[0043] The animal model used was rosacea-like dermatitis induced by intradermal injection of LL37 polypeptide: SPF-grade BALB / C female mice (Guangzhou Jicui Yakang Co., Ltd.) at 7 - 8 weeks of age were intradermally injected with LL37 (Sangon Biotech Co., Ltd.) at a concentration of 640 μM on the back, injected intradermally twice continuously, 50 μL each time, with an interval of 24 h, to construct a rosacea-like dermatitis mouse model.

[0044] The mice were randomly divided into 3 groups, namely:

[0045] Control group + blank matrix group (n = 5, Control+Vehicle). Rosacea model group + blank matrix group (n = 7, LL37+Vehicle). Rosacea model group + myriocin at 1.5 mg / kg per dose group (n = 7, LL37+Myriocin).

[0046] Two days before the experiment, the backs of the mice were shaved and depilated. In the myriocin administration group, myriocin was intraperitoneally injected into normal mice one week in advance, with the dose and administration frequency being 1.5 mg / kg per dose, once every other day. One week later, 640 μM of LL37 was administered to the model group and the myriocin administration group together, with 50 μL injected intradermally into the back twice, with a 24-hour interval between injections. The control group mice were injected with an equal volume of PBS at the same location. The mice were euthanized 36 hours after the last intradermal injection. Photos of the skin lesions were taken, and the skin of the dermatitis site was collected to evaluate the degree of erythema and the area of skin lesions, and used for subsequent HE staining and qPCR detection.

[0047] The mouse skin was immediately immersed in 10% formalin after being removed, fixed for at least 48 hours, dehydrated, embedded in paraffin, and cut into tissue sections with a thickness of 4 μm. Then the sections were deparaffinized, stained with hematoxylin and eosin, sealed with neutral gum and dried. The tissue morphology was observed under a standard optical microscope, and the number of inflammatory cells was counted for statistical analysis. Figure 2 C shows the comparison of the back skin lesion phenotypes and HE staining of the three groups of mice, n = 5 - 7. The experimental results show that myriocin significantly improved the dermatitis phenotype induced by LL37 in mice and significantly inhibited the degree of inflammatory cell infiltration in the skin lesions.

[0048] Figure 2 The upper graph of D shows the statistical results of the erythema scores of each group. Figure 2 The lower graph of D shows the statistical results of the inflammatory cell infiltration count in the back skin lesions of each group of mice. The horizontal and vertical coordinates represent the grouping and erythema score / inflammatory cell infiltration count, respectively. The experimental results show that myriocin significantly improved the degree of erythema of dermatitis induced by LL37 in mice and significantly inhibited the degree of inflammatory cell infiltration in the skin lesions.

[0049] Figure 2E detected the mRNA levels of pro-inflammatory factors (Il6, Tnfa, Ccl2, Klk5, Mmp9) in the skin tissues of mice in each group by qRT-PCR. Actin was used as the internal reference gene. * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001. Each column represents a group, and the height of the column represents the relative expression level of the gene. The higher the column, the higher the gene expression. The column groups are "control group + blank matrix group (n = 5, Control + Vehicle)", "rosacea model group + blank matrix group (n = 7, LL37 + Vehicle)", and "rosacea model group + 1.5 mg / kg / time myriocin group (n = 7, LL37 + Myriocin)" in sequence. The experimental results show that myriocin significantly reduces the expression of inflammatory factors (KLK5, CXCL1, TNF-α, MMP9, IL-6, CCL2) in the skin lesions of LL37-induced rosacea in mice.

[0050] At the animal level, this invention studied the effect of myriocin on LL37-induced rosacea-like dermatitis on the backs of mice. This invention found that intraperitoneal injection of myriocin significantly improved the erythema degree of the LL37-induced rosacea model in mice, reduced the infiltration of inflammatory cells, and decreased the expression of inflammatory factors (KLK5, CXCL1, TNF-α, MMP9, IL-6, CCL2).

[0051] 1.3 Reverse transcription and real-time fluorescence quantitative PCR detection

[0052] Total RNA was isolated from cells or skin lesions using TRIzol reagent; 2 μg of RNA was transcribed into cDNA using a reverse transcription kit (Takara, RR037A), and qPCR experiments were performed using FastStart Universal SYBR Green Master on an Applied Biosystems 7500 machine to detect changes in rosacea-related inflammatory genes.

[0053] (1) Reverse transcription

[0054] Thaw the reagents in the reverse transcription kit and place them on ice. Prepare the reverse transcription system:

[0055] Table 1: Reverse transcription system

[0056]

[0057]

[0058] Mix well with a pipette, collect the sample at the bottom of the tube using a desktop mini centrifuge, and place it on a PCR instrument. Set the PCR program: 37 °C for 15 min, 85 °C for 5 sec, 4 °C forever to end the reaction, and store the cDNA sample obtained by reverse transcription at -20 °C.

[0059] (2) Real-time fluorescence quantitative PCR

[0060] Use FastStart Universal SYBR Green Master (Rox) real-time fluorescence quantitative PCR reagent, repeat each sample three times, and add samples according to the following system (where cDNA can be loaded after dilution by the same multiple):

[0061] Table 2: Real-time fluorescence quantitative PCR reaction system

[0062] Name Dosage SYBR Green Master (ROX) 5 μl Primer Mix (10 μM) 0.4 μl cDNA 2 μl <![CDATA[ddH 2 O]]> 2.6 μl

[0063] After adding samples on ice, briefly centrifuge and collect the solution at the bottom of the tube, and perform amplification according to the following RT-qPCR amplification program:

[0064] Table 3: Amplification program

[0065]

[0066]

[0067] The sequences of other primers are shown in the following table:

[0068] Table 4: Sequences of other primers

[0069] Gene Forward primer Reverse primer Human-ACTIN AGGTCTTTGCGGATGTCCACGT CACCATTGGCAATGAGCGGTTC Hum-CXCL1 AGCTTGCCTCAATCCTGCATCC TCCTTCAGGAACAGCCACCAGT Hum-IL6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG Hum-CCL2 AGAATCACCAGCAGCAAGTGTCC TCCTGAACCCACTTCTGCTTGGG Mus-Actin CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG Mus-Il6 TACCACTTCACAAGTCGGAGGC CTGCAAGTGCATCATCGTTGTTC Mus-Ccl2 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT Mus-Tnfa GGTGCCTATGTCTCAGCCTCTT GCCATAGAACTGATGAGAGGGAG Mus-Klk5 ATGGGCAATGGCTACCCTG GTTCGGTTCCAGAGGGGTT Mus-Mmp9 CTGGACAGCCAGACACTAAAG CTCGCGGCAAGTCTTCAGAG

[0070] After the reaction, confirm the amplification curve and melting curve of RT-qPCR. The Ct value of the sample is the average of three replicates. Use the ΔΔCt method to perform relative quantification of the target gene. The relative expression level of the target gene = 2 -ΔΔCt , ΔΔCt = (Ct of target gene - Ct of internal reference gene) in the experimental group - (Ct of target gene - Ct of internal reference gene) in the control group. Using Actin as the internal reference gene and the blank group as the control group, perform relative quantification of each target gene.

[0071] 1.4 Cell experiment: Preliminary study on the effect of the sphingolipid de novo synthesis inhibitor myriocin on the rosacea cell model induced by LL37.

[0072] HaCaT cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum and penicillin / streptomycin, and cultured in an incubator at 37°C with 5% carbon dioxide. Before the experiment, they were seeded into 12-well plates. Myriocin (Catalog No.: HY-N6798, batch: 230536) provided by MCE was dissolved in DMSO to prepare a 5 mM stock solution. The rosacea cell model was obtained by stimulating HaCaT cells with 4 μM antimicrobial peptide LL37 for 12 h.

[0073] When the cell density reached about 70%, they were divided into 6 groups according to the experimental purpose:

[0074] The Vehicle group was the solvent control group (medium + Vehicle). Vehicle was the solvent DMSO.

[0075] The Myriocin-1 group was the Myriocin control group (medium + 1 μM Myriocin).

[0076] The Myriocin-5 group was the Myriocin control group (medium + 5 μM Myriocin).

[0077] The LL37+Vehicle group was the rosacea model control group (medium + 4 μM LL37 + Vehicle).

[0078] The LL37+Myriocin-1 group was the Myriocin experimental group (medium + 4 μM LL37 + 1 μM Myriocin).

[0079] The LL37+Myriocin-5 group was the Myriocin experimental group (medium + 4 μM LL37 + 5 μM Myriocin).

[0080] After treatment for 12 h, RNA was collected and stored in a -80°C refrigerator until the expression of inflammatory factors was detected by qPCR.

[0081] Figure 3 To investigate the effect of different concentrations of Myriocin (1 μM / 5 μM) on the expression of pro-inflammatory genes (CXCL1, CCL2, IL6) in HaCaT cells treated with LL37: After treating HaCaT cells with Myriocin, RNA was extracted from each group of cells, and the changes in the above indicators were measured using qPCR.

[0082] The experimental results are as Figure 3 shown. The horizontal and vertical coordinates represent the grouping and mRNA expression levels, respectively. The experimental results show that different concentrations of Myriocin significantly inhibited the expression of inflammatory factors in LL37-induced HaCaT cells, including CXCL1, IL-6, CCL2, etc.

[0083] The preferred specific embodiments of the present invention have been described in detail above. It should be understood that those of ordinary skill in the art can make many modifications and variations based on the concept of the present invention without creative efforts. Therefore, all technical solutions that can be obtained by those skilled in the art in the technical field according to the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art shall fall within the protection scope determined by the claims.

Claims

1. The application of myriocin in relieving rosacea.

2. Use of a drug comprising myriocin in alleviating rosacea.

3. Use of a drug comprising myriocin in alleviating skin lesions in a rosacea-like mouse model.

4. The use according to claim 3, characterized in that: The rosacea-like mouse model is a rosacea-like dermatitis induced by intradermal injection of LL37 peptide.

5. The method for constructing a rosacea-like mouse model according to claim 3, characterized in that: When constructing the rosacea-like mouse model, 640 μM of the antimicrobial peptide LL37 polypeptide was intradermally injected into the back of the mouse once a day to obtain the animal model.

6. An animal model for verifying that myriocin can improve rosacea-like symptoms.

7. A cell model for verifying that myriocin can improve the inflammatory phenotype of rosacea.

8. The method for constructing a cell model according to claim 7, characterized in that: The cell model was obtained by stimulating HaCaT cells with 4 μM antimicrobial peptide LL37 polypeptide for 12 hours.

9. A myriocin capable of reducing pro-inflammatory factors associated with rosacea, characterized in that: The pro-inflammatory factors are KLK5, CXCL1, TNF-α, MMP9, IL-6, and CCL2.

Images