Application of chlorbenazolic acid and pharmaceutically acceptable salt thereof in preventing, relieving or treating diseases related to HIF-2alpha

By using chlorobenzolic acid to activate the downstream gene of HIF-2α, the side effects and selectivity problems of existing methods for treating renal anemia and HIF-2α-related diseases were solved, and significant erythropoiesis and renal protection effects were achieved.

CN120053435APending Publication Date: 2025-05-30HUAYAO JIYUAN (SHENZHEN) PHARMACEUTICAL CO LTD
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510483885.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-04-19
Filing Date
2025-04-16
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Existing methods for the treatment of renal anemia and other HIF-2α-related diseases have cardiovascular side effects and risk of renal damage, and there is a lack of drugs that selectively activate HIF-2α.

Method used

Using chlorobenzoic acid and its pharmaceutically acceptable salts, the prevention, mitigation or treatment of HIF-2α-related diseases can be achieved by activating the VEGF and EPO genes downstream of HIF-2α.

Benefits of technology

Chlorobenzolic acid significantly increases erythrocyte production, relieves renal damage, improves renal function, and achieves a good balance between erythrocyte production and renal safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120053435A_ABST
    Figure CN120053435A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of chlorbuconazole or salt thereof in preventing, relieving or treating diseases related to HIF-2alpha. In-vitro experiments prove that the chlorbuconazole enhances the transcriptional activity of HIF-2alpha so as to promote the expression of downstream genes regulated and controlled by the HIF-2alpha; it is proved that chlorburazol has the effects of increasing erythropoiesis and relieving renal injury on an aristolochic acid-induced zebra fish chronic kidney disease model, a cisplatin-caused acute kidney injury and renal anemia model and a unilateral ureteral obstruction model. Meanwhile, the traditional Chinese medicine composition belongs to new use of old medicines, so that the medicine research and development cost and the treatment cost are saved, and the traditional Chinese medicine composition has obvious economic benefits and clinical application values.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the use of lofibazam and its pharmaceutically acceptable salts in preventing, alleviating or treating diseases related to HIF-2α. Background Art

[0002] In a hypoxic environment, the body can spontaneously undergo a hypoxic response to maintain its oxygen acquisition ability. In 1992, Semenza et al. discovered a protein that could specifically bind to the hypoxia response element (HRE) of the erythropoietin gene and affect the expression of certain genes. This protein was named hypoxia-inducible factor (HIF) (Semenza GL et al., Mol. Cell Biol., 1992, 12, 5447-5454). The target genes of HIF are very extensive and can affect the body's hematopoietic function, angiogenesis, iron ion transport, glucose utilization, resistance to oxidative stress, cell differentiation, cell survival and apoptosis, extracellular matrix homeostasis, and tumorigenesis. HIF is a heterodimer composed of α and β subunits. The α subunit is a functional subunit that is very sensitive to changes in intracellular oxygen concentration and is highly regulated, playing a role in regulating HIF activity; the β subunit is a structural subunit, also known as aryl hydrocarbon receptor nuclear transporter protein (ARNT), which is stably expressed in cells, and the mRNA transcription and protein expression levels are not affected by changes in oxygen concentration. Both the α and β subunits of HIF belong to the basic helix-loop-helix transcription factor superfamily. There are three subtypes of human HIFα: HIF-1α, HIF-2α, and HIF-3α. HIF-1α is ubiquitously distributed in the body and plays an important role in the angiogenesis process triggered by local tissue ischemia or hypoxia, but has little effect on the iron metabolism process; HIF-2α is locally distributed and plays an important role in the expression and synthesis of the EPO (erythropoietin) gene in the renal tissue. In addition, it also increases the absorption of iron in the intestine by upregulating the expression of cytochrome and divalent metal transporter-1 in the duodenum, and has the effect of reducing the expression of hepatic bactericidal peptide, playing a leading role in the iron metabolism process; the structure of HIF-3α is different from other subtypes and has no DNA binding region, so it cannot affect gene expression. Studies have shown that HIF-3α may play a negative regulatory role in HIF-mediated gene expression. Therefore, HIF-1α and HIF-2α play a certain role in the hypoxic response process. In an experiment on mice lacking HIF-1α and HIF-2α genes, the necessity of HIF-1α and HIF-2α in the hypoxic response process was confirmed. In the research and development of compounds for treating chronic renal anemia, the change of HIF-2α is more important than that of HIF-1α.

[0003] Both the HIF-2α subunit and the ARNT subunit belong to the Per-ARNT-Sim (PAS) subfamily of the basic helix-loop-helix (bHLH) family. The structures of the two subunits are similar and mainly include the bHLH at the N-terminus (DNA Bonding Domain, DBD, DNA binding region), and two adjacent PAS A and PAS B domains (Ligand Bonding Domain, LBD, ligand binding region); the C-terminus binds to transcriptional cofactors to regulate the transcription of downstream genes. It has been found that there is a cavity of approximately inside the PAS B domain of the HIF-2α subunit. After binding to the regulator, it can affect the formation of heterodimerization between the HIF-2α subunit and the ARNT subunit, thereby blocking or activating DNA binding and the transcription of target genes. HIF-2α downstream target genes such as vascular endothelial growth factor (VEGF), erythropoietin (EPO), cyclin (Cyclin1), and glucose transporter (GLUT1), etc., these genes are related to kidney diseases, renal anemia, cardiovascular diseases, infections, cancers, etc.

[0004] In patients with kidney diseases, the damaged kidney tissue will lead to EPO deficiency and insufficient iron homeostasis, which in turn causes renal anemia. Renal anemia not only seriously reduces the quality of life of patients, but also is an important factor in the occurrence and increased mortality of cardiovascular diseases. Recombinant human erythropoietin (rHuEPO) or erythropoiesis-stimulating agents (ESAs) can treat renal anemia by increasing hemoglobin levels. However, a higher hemoglobin target in clinical trials is positively correlated with the risk of cardiovascular side effects. Currently, an emerging therapy for renal anemia is to pharmacologically inhibit prolyl hydroxylase PHD to stabilize HIF-2 protein, so as to stimulate the production of endogenous EPO in renal or non-renal tissues. However, the over-upregulated HIF-1α by PHD inhibitors promotes the inflammatory pathway, accelerates heart and kidney damage, and then leads to an increased risk of pulmonary hypertension and inflammation, while the activation of HIF-2α has a protective effect. Therefore, HIF-2α selective agonists may have more therapeutic advantages.

[0005] The typical pathological change of kidney disease is renal fibrosis. Kyoung HK et al. found that long-term activation of HIF-2α helps to inhibit renal fibrosis and improve renal function. Yu et al. found that in the early stage of administration of the PHD inhibitor L-mimosine, selectively activated HIF-1α would lead to increased expression of the fibrotic factor CTGF and phosphorylated Smad, aggravating macrophage infiltration and fibrosis in renal tissue; while in the middle and late stages, mainly activating HIF-2α up-regulated the expression of EPO and VEGF, reducing renal injury. Qu et al. confirmed that knockout of HIF-2α would lead to more severe kidney injury. In summary, in acute and chronic kidney injury, over-activation of HIF-1α may exacerbate kidney injury, while HIF-2α plays a protective role.

[0006] Tafamidis (2-(3,5-dichlorophenyl)-1,3-benzoxazole-6-carboxylic acid) and Tafamidis Meglumine (2-(3,5-dichlorophenyl)-1,3-benzoxazole-6-carboxylic acid 1-deoxy-1-(methylamino)-D-glucitol salt, also known as: Tafamidis glucosamine salt) are transthyretin stabilizers, originally developed and produced by Pfizer Inc. in the United States. Vyndamax and Vyndaqel are both capsules for oral administration and contain tafamidis as the active ingredient. The U.S. Food and Drug Administration (FDA) has approved Vyndaqel and Vyndamax for the treatment of wild-type or hereditary transthyretin-mediated amyloid cardiomyopathy in adults to reduce cardiovascular mortality and cardiovascular-related hospitalizations. The EMA has approved Vyndaqel for the treatment of transthyretin amyloidosis in adult patients with stage I symptomatic polyneuropathy to delay peripheral nerve damage.

[0007] Tafamidis has been used clinically for many years and its safety has been verified. Therefore, developing other indications for it can further benefit humanity. Summary of the Invention

[0008] The present invention aims to provide the use of tafamidis and its analogs and salts thereof in preventing, alleviating or treating diseases related to HIF-2α, achieving "repurposing of old drugs", saving drug R & D costs and treatment costs, and having obvious economic benefits and clinical application values.

[0009] On the one hand, the present invention provides the use of tafamidis or its pharmaceutically acceptable salt, or a pharmaceutical composition containing tafamidis or its pharmaceutically acceptable salt in the preparation of a drug for preventing, alleviating or treating diseases related to HIF-2α activity.

[0010] In some embodiments, the pharmaceutically acceptable salt of the eplerenone is an acid addition salt or a base addition salt.

[0011] In some embodiments, the pharmaceutically acceptable salt of the eplerenone is selected from at least one of the following structures:

[0012]

[0013]

[0014]

[0015] In some embodiments, the pharmaceutically acceptable salt of the eplerenone is meglumine eplerenone.

[0016] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0017] In some embodiments, the diseases associated with HIF-2α activity include hematopoietic disorders, anemia, local ischemic states associated with surgery and their sequelae after surgery, wound healing of surgical operations, chronic kidney disease, cardiovascular diseases, infections, inflammatory diseases, cancers, and impairments of health states occurring during cancer treatment, or sequelae of acute and prolonged cerebral local ischemic states.

[0018] In some embodiments, the diseases associated with HIF-2α activity include renal anemia, primary anemia, anemia associated with tumor diseases, chemotherapy-induced anemia, anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, hypoplasia and aplastic anemia, hemolytic anemia, anemia due to iron utilization disorders (iron dysutilization anemia) or due to other endocrine disorders (such as hypothyroidism), local ischemic states and their sequelae caused by cardiac interventions using a cardiopulmonary machine (such as shunt surgery, cardiac valve transplantation), carotid artery interventions, aortic interventions, and interventions using instruments to open or penetrate the calvaria, primary glomerulonephritis, hypertensive renal arteriolosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesions (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathy (polycystic kidney, hereditary nephritis), cardiac insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension, and peripheral arterial occlusive diseases, HIV infection, rheumatoid arthritis, or diseases in the range of rheumatic forms or other disease forms regarded as autoimmune diseases after treatment with cytostatic agents, antibiotics, and radiotherapy, and impairments of health states occurring during the drug treatment of such diseases (such as stroke, birth asphyxia).

[0019] In some embodiments, the diseases related to HIF-2α activity include anemia, ischemia, vascular diseases, angina pectoris, myocardial infarction, metabolic disorders or cancer.

[0020] In some embodiments, the diseases related to HIF-2α activity include renal anemia and / or kidney diseases.

[0021] In some embodiments, the drug composition comprising clofibrate or a pharmaceutically acceptable salt thereof, or clofibrate or a pharmaceutically acceptable salt thereof, prevents, alleviates or treats diseases related to HIF-2α activity by upregulating the downstream VEGF gene regulated by HIF-2α.

[0022] In some embodiments, the drug composition comprising clofibrate or a pharmaceutically acceptable salt thereof, or clofibrate or a pharmaceutically acceptable salt thereof, prevents, alleviates or treats diseases related to HIF-2α activity by upregulating the downstream EPO gene regulated by HIF-2α.

[0023] On the other hand, the present invention provides a combination therapy, and the use of clofibrate or a pharmaceutically acceptable salt thereof, or a drug composition comprising clofibrate or a pharmaceutically acceptable salt thereof, further combined with a prolyl hydroxylase inhibitor, in the preparation of a drug for preventing, alleviating or treating diseases related to HIF-2α activity.

[0024] Beneficial effects:

[0025] Compared with the prior art, one embodiment of the present invention has at least one of the following beneficial effects:

[0026] (1) In the present invention, RT-qPCR is used to determine that clofibrate has an upregulating effect on the downstream VEGF and EPO genes regulated by HIF-2α. It is shown that clofibrate can effectively activate the expression of HIF-2α downstream target genes, and this activation effect may have potential therapeutic value for treating diseases such as ischemic diseases or anemia.

[0027] (2) In the aristolochic acid-induced zebrafish chronic kidney disease model, it is confirmed that clofibrate has the effects of increasing erythropoiesis and alleviating kidney injury. It is shown that clofibrate has a protective effect on the kidneys and also has a significant effect on improving renal anemia.

[0028] (3) In the 5 / 6 nephrectomy rat model, clofibrate increases the red blood cell count in rats with chronic kidney disease, showing potential value for treating renal anemia. At the same time, by comparing with roxadustat, it is shown that clofibrate achieves a good balance between the erythropoietic effect and kidney safety.

[0029] (4) In a cisplatin-induced kidney injury and renal anemia model, clobenic acid significantly increased the red blood cell count, hemoglobin level, and hematocrit in rats with renal anemia, showing potential for treating renal anemia. Urine analysis and omics property analysis found that clobenic acid has the effect of repairing kidney injury, with a focus on alleviating kidney fibrosis.

[0030] (5) In a kidney injury model induced by unilateral ureteral obstruction, clobenic acid showed potent effects in treating kidney injury and alleviating ischemia.

[0031] (6) Through luciferase reporter gene experiments, it was found that both clobenic acid and glucosamine clobenilate significantly enhanced the transcriptional activity of HIF-2α. Therefore, clobenic acid and its salts can be used for preventing and / or treating diseases related to HIF-2α activity.

[0032] (7) The present invention confirmed through in vitro experiments that clobenic acid enhances the transcriptional activity of HIF-2α, thereby promoting the expression of downstream genes regulated by HIF-2α; and in a zebrafish model of chronic kidney disease induced by aristolochic acid, a model of acute kidney injury and renal anemia induced by cisplatin, and a unilateral ureteral obstruction model, it was confirmed that clobenic acid has the effects of increasing erythropoiesis and alleviating kidney injury. The present invention verified through a series of experiments that clobenic acid and its salts can be used for preventing and / or treating diseases related to HIF-2α activity, especially renal anemia or kidney diseases.

[0033] Term Explanation

[0034] Certain embodiments of the present invention are now described in detail, and their examples are illustrated by the accompanying chemical formulas. The present invention is intended to cover all alternative, modified, and equivalent technical solutions, which are all included within the scope of the present invention as defined by the claims. Those skilled in the art should recognize that many methods and materials similar or equivalent to those described herein can be used to practice the present invention. The present invention is in no way limited to the methods and materials described herein. In the case where one or more of the incorporated documents, patents, and similar materials are different from or contradictory to the present application (including but not limited to the defined terms, term applications, described technologies, etc.), the present application shall prevail.

[0035] It should be further recognized that certain features of the present invention are described in multiple independent embodiments for clarity, but can also be provided in combination in a single embodiment. Conversely, various features of the present invention are described in a single embodiment for brevity, but can also be provided separately or in any suitable sub-combination.

[0036] Unless otherwise specified, all scientific and technical terms used in the present invention have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. All patents and published publications related to the present invention are incorporated herein by reference in their entirety.

[0037] In the description of this specification, the descriptions referring to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0038] In the following content, whether or not words such as "about" or "approximate" are used, all the numbers disclosed herein are approximate values. There may be differences of 1%, 2%, 5%, 7%, 8%, 10%, 15%, or 20% in the numerical value of each number. Whenever a number with an N value is disclosed, any number with a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15%, or N+ / -20% will be explicitly disclosed, where "+ / -" means plus or minus. Brief Description of the Drawings

[0039] Figure 1 It is a diagram showing the detection results of the luciferase reporter gene experiment in Example 1 of the present invention. Among them, Figure A is a diagram showing the agonistic activity results of clofibric acid on HIF-2 protein, and Figure B is the agonistic activity of meglumine clofibric acid (B) on HIF-2 protein. In the figure, Luciferase assay: fluorescence detection. Efficacy: efficacy, concentration: concentration.

[0040] Figure 2 It is a diagram showing the detection results of real-time fluorescence quantitative PCR in Example 2 of the present invention. The results show that in Example 2 of the present invention, real-time fluorescence quantitative PCR detected that clofibric acid up-regulates the transcription of HIF-2 downstream target genes VEGF and EPO. In the figure, relative mRNA level: relative mRNA level; Vehicle: matrix.

[0041] Figure 3 It is a diagram showing the detection results of improving the incidence of renal edema in Example 3. In Example 3 of the present invention, on the zebrafish model of aristolochic acid-induced kidney injury, clofibric acid improved renal edema. In the figure, control: normal control group; model: model control group; arlstolochic acid-induced model: aristolochic acid-induced model.

[0042] Figure 4 Graph showing the test results of reducing glomerular filtration in Example 3. In Example 3 of the present invention, on a zebrafish model of aristolochic acid-induced kidney injury, clofibric acid improved glomerular filtration. In the graph, control: normal control group; model: model control group; aristolochic acid-induced model: aristolochic acid-induced model.

[0043] Figure 5 Graph showing the test results of improving renal anemia in Example 3. In Example 3 of the present invention, on a zebrafish model of aristolochic acid-induced kidney injury, clofibric acid increased the signal intensity of red blood cells in the heart. In the graph, control: normal control group; model: model control group; aristolochic acid-induced model: aristolochic acid-induced model.

[0044] Figure 6 Graph showing the test results of Example 4. In Example 4 of the present invention, on a rat model of 5 / 6 nephrectomy, clofibric acid increased the number of red blood cells in rats with chronic kidney disease (A). Urine analysis showed that clofibric acid stabilized creatinine levels (B) and urine protein levels (C). In the graph, hematological analysis: blood analysis, urine analysis: urine analysis.

[0045] Figure 7 Graph showing the results of blood analysis in Example 5. In Example 5 of the present invention, on a model of cisplatin-induced kidney injury and renal anemia, clofibric acid significantly increased the number of red blood cells (A), hemoglobin level (B), and hematocrit (C) in rats with renal anemia. The kidney tissue images of cisplatin-induced rats showed (D) that clofibric acid significantly increased renal blood flow. In the graph, hematological analysis: blood analysis.

[0046] Figure 8 Graph showing the results of urine analysis in Example 5. In Example 5 of the present invention, on a model of cisplatin-induced kidney injury and renal anemia, the results of urine analysis. Clofibric acid had little effect on UTP (A), significantly increased UCREA levels (B), and decreased the UTP / UCREA ratio (p<0.05)( Figure 8 C), indicating that clofibric acid has a significant effect on improving kidney injury. In the graph, urine analysis: urine analysis.

[0047] Figure 9It is the renal pathological change diagram in Example 5. In Example 5 of the present invention, in a cisplatin-induced kidney injury and renal anemia model, clofibrate acid showed a strong effect in treating kidney injury and relieving renal anemia. Figures A, C, and E represent histological images of the kidney, which are HE staining (A) (40 times magnification), Masson trichrome staining (C) (20 times magnification), and PAS staining (E) (63 times magnification), respectively. Figures B and D represent semi-quantitative analysis of tubular injury in HE-stained sections (B) and Masson trichrome-stained sections (D). Figure F represents semi-quantitative analysis of glomerulosclerosis in PAS-stained sections. Figure G represents a representative immunohistochemical staining image of α-SMA protein expression (0.7 times to 30 times magnification). H represents semi-quantitative analysis of the positive area of α-SMA expression. Figure I represents Western blot analysis of the expression levels of α-SMA protein and EPO protein. In the figure, semiquantification of tubular injury: semi-quantitative assessment of tubular injury; semiquantificationof glomerular scleosis: semi-quantitative assessment of glomerulosclerosis; paller scores: Paller score; fibrosisarea: fibrosis area; mesangial matrix area: mesangial matrix area.

[0048] Figure 10 It is the test result diagram of Example 6. In Example 6 of the present invention, in a kidney injury model induced by unilateral ureteral obstruction, clofibrate acid showed a strong effect in treating kidney injury and relieving ischemia. Serum biochemical analysis showed the effects of clofibrate acid on CREA (A) and UREA (B). Figure C represents the kidney tissue image of the unilateral ureteral obstruction model showing (C) that clofibrate acid significantly improved kidney ischemia. Figures D and F represent histological images of the kidney, which are HE staining (D) (40 times magnification) and Masson trichrome staining (F) (20 times magnification), respectively. Figures E and G represent semi-quantitative analysis of tubular injury in HE-stained sections (E) and Masson trichrome-stained sections (G). In the figure, semiquantification of tubular injury: semi-quantitative assessment of tubular injury; paller scores: Paller score; serum CREA: serum creatinine; UREA: urea. Detailed implementation manners

[0049] To make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to constitute any limitation to the present invention. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessarily confusing the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0050] All the reagents used in the present invention can be purchased from the market or can be prepared by the methods described in the present invention.

[0051] Example 1: Luciferase Reporter Gene Experiment

[0052] Experimental principle: 786-O is a renal cancer cell line that mainly expresses HIF-2α and lacks functional HIF-1α. This characteristic makes 786-O cells an ideal model for studying the transcriptional activity of HIF-2α and related signaling pathways. The luciferase reporter gene experiment obtains a 786-O monoclonal cell line stably expressing hypoxia response element (HRE) and luciferase (Luc) activity through puromycin screening. The HIF-2α agonist promotes the formation of a dimer of HIF-2α / HIF-β, activates the HRE promoter, and the activity of luciferase can be measured by detecting the intensity of fluorescence, thereby judging the ability of the HIF-2α agonist to promote transcription.

[0053] Experimental method: 6000 stably transfected 786-O cells stably containing HRE and Luc sequences were seeded in a 96-well plate, and 100 μL of RPMI-1640 medium containing 10% fetal bovine serum was added to each well. After 24 h, the corresponding concentration of the compound was added to each well. A blank group was set as a control, and only the solvent DMSO was added to the wells in the blank group. In the initial screening of the compound, both clofibric acid and meglumine clofibrate were tested at two concentrations of 2 μM and 20 μM. When measuring the concentration gradient, there were 3 replicates for each concentration. After co-incubation for 24 hours, the culture medium was discarded, 20 μL of firefly luciferase reporter gene cell lysate (RG126M, Beyotime) was added to each well, the 96-well plate was placed on a microplate rapid oscillator and shaken for 10 min. After the shaking was completed, 10 μL of the lysate was aspirated and transferred to a white opaque plate, and then 10 μL of Steady-Lumi TM Firefly Luciferase Detection Reagent (RG058S, Beyotime) was added to each well, and finally it was placed in a microplate reader (Agilent Synergy Neo2) for luminescence detection. E 20 represents the effect of the 20 μM compound and is calculated as E 20 = fluorescence value of 20 μM well ÷ fluorescence value of blank group × 100%. E 2Indicates the effect of 2 μM compound, calculated as E 2 = Fluorescence value of 2 μM well ÷ Fluorescence value of blank group × 100%. EC 50 Is the compound concentration when the agonistic efficiency relative to the blank group increases by 50%. The agonistic efficiency of the compound is determined by calculating the concentration (EC 50 ) required for the fluorescence activity to increase by 50% relative to the fluorescence value of the blank group, as well as the maximum activation percentage (E max ). The maximum activation percentage (E max ) of the agonist refers to the ratio of the fluorescence value of the maximum effect (measured maximum response) triggered when the agonist concentration reaches the receptor-binding saturation state in a specific receptor system to the fluorescence value of the receptor system without the addition of the agonist, expressed as a percentage. In this experiment, meglumine clofibric acid was directly replaced with Vyndaqel.

[0054] The detection results showed that the agonistic efficiency of 20 μM clofibric acid was 207%, and that at 2 μM was 142%, indicating that the agonistic efficiency of clofibric acid increased with the increase in concentration, showing an obvious dose-dependence. The measured EC 50 of clofibric acid was 1.11 μM, and E max was 225% ( Figure 1 A), indicating that clofibric acid has strong agonistic activity and good pharmacodynamic effects.

[0055] The agonistic efficiency of 20 μM meglumine clofibric acid was 223%, and that at 2 μM was 122%, indicating that the agonistic efficiency of meglumine clofibric acid increased with the increase in concentration, showing an obvious dose-dependence. The measured EC 50 of meglumine clofibric acid was 0.97 μM, and E max was 228% ( Figure 1 B), indicating that meglumine clofibric acid also has strong agonistic activity and good pharmacodynamic effects.

[0056] It can be seen that clofibric acid and its pharmaceutically acceptable salts, as HIF-2α agonists, promote the formation of HIF-2α / HIF-β dimers, can enhance the binding of HIF-2α and HIF-β, and can exert the protective effect of HIF-2α.

[0057] Example 2: Real-time fluorescence quantitative (qRT-PCR) experiment

[0058] Experimental method: Renal cancer cells 786-O were seeded onto 12-well plates. After 24 h, different concentrations of clofibric acid (1 μM, 10 μM, and 20 μM respectively) were added, and the cells were co-incubated with the compound for 24 h. The vehicle group was not subjected to any operation. RNA extraction was performed using TRIZOL reagent. cDNA transcription was performed using All-in-one TMFirst-Strand cDNA Synthesis Kit (see the instruction manual for specific operation steps). SYBR reagent was used for signal calibration, and GAPDH was used as an internal reference. The qRT-PCR primers were as follows:

[0059] GAPDH_fwd, GCACCGTCAAGGCTGAGAAC;

[0060] GAPDH_rev, TGGTGAAGACGCCAGTGGA;

[0061] VEGF_fwd, AGGGCAGAATCATCACGAAGT;

[0062] VEGF_rev, AGGGTCTCGATTGGATGGCA;

[0063] EPO_fwd, AACAATCACTGCTGACACTT;

[0064] EPO_rev, AGAGTTGCTCTCTGGACAGT.

[0065] The detection results were as Figure 2 shown: Based on the matrix, 10 μM lofibra upregulated the epidermal growth factor (VEGF) gene by 0.5-fold, and 20 μM lofibra upregulated the VEGF gene by 1.4-fold ( Figure 2 ). Based on the matrix, 20 μM lofibra upregulated the erythropoietin (EPO) gene by 0.9-fold ( Figure 2 ). Different concentrations of lofibra had an upregulating effect on the expression of VEGF gene and EPO gene, indicating that lofibra could effectively activate the expression of HIF-2α downstream target genes, and this activation effect might have potential therapeutic value for treating diseases such as ischemic diseases or anemia. Statistical analysis was performed using GraphPad Prism software (version 8.0), with a two-tailed test, *P < 0.05, **P < 0.01, ***P < 0.001.

[0066] Example 3: Experiment on aristolochic acid-induced chronic kidney disease in zebrafish

[0067] 3.1. Improvement of the incidence of renal edema

[0068] Wild-type AB strain zebrafish at 2 days post-fertilization (2 dpf) were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well (experimental group). Except for the normal control group, the other experimental groups were given aristolochic acid in aqueous solution to establish a zebrafish model of renal anemia. After treatment at 28 °C for 18 h, a normal control group and a model control group were set up simultaneously. Each experimental group (tested at 20 μM, 10 μM, and 1 μM, with 3 replicates for each concentration) was given the sample of clobenzoic acid in aqueous solution respectively, and the normal control group and the model control group were given water correspondingly, with the volume of each well being 3 mL. After continued treatment at 28 °C for 30 h, each experimental group was observed under a dissecting microscope, the number of zebrafish with renal edema was counted, and the incidence of renal edema (%) in each experimental group was calculated.

[0069] 3.2. Reducing Glomerular Filtration

[0070] Wild-type AB strain zebrafish at 2 dpf were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well (experimental group). Except for the normal control group, the other experimental groups were given aristolochic acid in aqueous solution to establish a zebrafish model of renal anemia. After treatment at 28 °C for 18 h, a normal control group and a model control group were set up simultaneously. Each experimental group was given the sample of clobenzoic acid in aqueous solution (at concentrations of 0.1 μM and 1 μM respectively), and the normal control group and the model control group were given water correspondingly, with the volume of each well being 3 mL. After continued treatment at 28 °C for 4 h, each experimental group was intravenously injected with a fluorescent label (Dextran tetramethylrhodamine). After continued treatment at 28 °C for 1 day, 10 zebrafish were randomly selected from each experimental group and photographed under a fluorescence microscope. The NIS-Elements D 3.20 advanced image processing software was used to analyze and collect data, and the fluorescence intensity of the whole body of the zebrafish was analyzed. The efficacy of the sample in repairing kidney injury was evaluated based on the statistical analysis results of this index. The statistical processing results were expressed as mean ± SE. SPSS 26.0 software was used for statistical analysis, and p < 0.05 indicated that the difference was statistically significant.

[0071] 3.3. Efficacy Evaluation of Improving Renal Anemia (Heart Red Blood Cell Staining Intensity)

[0072] Randomly select 2-day post-fertilization (2dpf) wild-type AB strain zebrafish and place them in a 6-well plate, with 30 zebrafish in each well (experimental group). Except for the normal control group, the remaining experimental groups were given aristolochic acid in aqueous solution to establish a zebrafish model of renal anemia. After treatment at 28 °C for 18 h, a normal control group and a model control group were set up simultaneously. Each experimental group was given the sample of lofibazam (at concentrations of 0.1 μM and 1 μM) in aqueous solution, and the normal control group and the model control group were given water correspondingly, with a volume of 3 mL per well. After continued treatment at 28 °C for 30 h, o-dianisidine staining was performed. After the staining was completed, 10 zebrafish were randomly selected from each experimental group and photographed under a dissecting microscope. Data were collected using NIS-Elements D 3.20 advanced image processing software, and the staining intensity of red blood cells in the zebrafish heart was analyzed. The efficacy of the sample in improving renal anemia was evaluated based on the statistical significance of this index. Statistical analysis was performed using SPSS 26.0 software, and p < 0.05 indicated that the difference was statistically significant.

[0073] Result analysis:

[0074] (1) In the aristolochic acid-induced zebrafish model group, the incidence of renal edema was 100%, and the incidence of renal edema in the 1 μM lofibazam experimental group was 80% ( Figure 3 ), indicating that lofibazam has a protective effect on the kidney.

[0075] (2) The glomerular filtration rate of normal zebrafish was 100%, the glomerular filtration rate of the aristolochic acid-induced zebrafish model group was 239%, and the glomerular filtration rate of the 1 μM lofibazam experimental group was 158%, indicating that lofibazam has the function of improving glomerular filtration ( Figure 4 ).

[0076] (3) The red blood cell count in the heart of the normal zebrafish group was 100%, the red blood cell count in the heart of the aristolochic acid-induced zebrafish model group was 46%, the red blood cell count in the heart of the 0.1 μM lofibazam experimental group was 60%, and the red blood cell count in the heart of the 1 μM lofibazam experimental group was 65%, indicating that lofibazam has a significant effect on improving renal anemia ( Figure 5 ).

[0077] In the zebrafish model of chronic kidney disease induced by aristolochic acid, it was confirmed that lofibazam has the effects of increasing erythropoiesis and alleviating kidney injury.

[0078] Example 4: 5 / 6 nephrectomy (5 / 6Nx) rat model

[0079] Male Sprague-Dawley (SD) rats were used to establish a renal injury-induced anemia model by 5 / 6 nephrectomy to study the erythropoietic effect of clofibrate. After a one-week adaptation period, the rats were anesthetized with isoflurane, and the left kidney was exposed through a midline abdominal incision. Ligation threads were placed at the upper and lower third positions of the kidney, and the corresponding renal tissue outside the ligation threads was resected. After a one-week recovery period, the right kidney was removed. Eight rats were assigned to the nephrectomy group, and another eight served as non-surgical normal control group. At the fourth week, renal dysfunction in the surgically treated rats was confirmed by evaluating serum urea and creatinine levels. Clofibrate and roxadustat were dissolved in a vehicle composed of 10% dimethyl sulfoxide (DMSO), 30% polyethylene glycol 400 (PEG 400), 5% Tween-80, 1% hydrochloric acid (113.3 mM), 9% 0.1 N sodium hydroxide, and 45% normal saline. The nephrectomized rats were randomly divided into 5 / 6Nx group, clofibrate treatment group, and roxadustat treatment group (8 rats in each group) to ensure comparable baseline body weights among groups. Starting from the sixth week, the clofibrate treatment group and the roxadustat group were orally administered the corresponding compound at 10 mg / kg per day (10 mg orally per 1 kg of rat body weight) for four weeks, while the sham-operated group (Sham) and the 5 / 6 nephrectomy model (5 / 6Nx) rats were given the vehicle according to the same dosing regimen. Hematological analysis was performed weekly, and urine samples were collected on the day after the last treatment to measure urinary total protein (UTP) and urinary creatinine (UCREA). Hematological analysis (using Sysmex Europe XN-2000 automated hematology analyzer) and urine analysis (using Cobas C501 automated hematology analyzer) were both performed using commercially available kits according to the manufacturer's instructions. After sample collection, the animals were euthanized. Statistical significance was determined by one-way analysis of variance (one-way ANOVA), followed by Dunnett's test comparison with the 5 / 6Nx group (*P < 0.05, **P < 0.01, ***P < 0.001).

[0080] Result analysis:

[0081] (1) Hematological analysis showed that compared with the 5 / 6Nx group, the number of red blood cells (RBCs) in the 10 mg / kg clofibrate treatment group was significantly increased at the 4th week (7.7 ± 0.3×10 12 cells / L vs. 8.2 ± 0.3×10 12 cells / L, p < 0.05, Figure 6Figure A). Comparative analysis with the HIF-PHD inhibitor roxadustat showed significant differences in their safety profiles. Roxadustat at 10 mg / kg showed obvious erythrocytosis on day 14, and the RBCs levels all exceeded the physiological range of the healthy control group, suggesting that excessive erythropoiesis may bring the risk of thromboembolism.

[0082] (2) Renal function assessment further highlighted the therapeutic advantages of clofibrate: Urine analysis showed that the UTP excretion level in the clofibrate treatment group remained at the baseline level, while it increased significantly in the roxadustat treatment group (3.3-fold increase compared with the 5 / 6Nx group, p<0.01, Figure 6 Figures B and C), suggesting that roxadustat may cause kidney damage, while the clofibrate treatment group had basically no effect on UCREA and had an increase in the average UTP value, but it was not significant. These research results indicate that clofibrate has significant activity in erythropoiesis. Although it did not show significant renal repair activity, it showed better safety compared with roxadustat.

[0083] Example 5: A rat model of cisplatin-induced kidney injury and anemia

[0084] 5.1 Establishment of the animal model, administration, and sampling

[0085] Male SD rats, after a one-week adaptation period, were given 6 mg / kg of cisplatin by tail vein injection, and a second injection was given one week later. Two weeks later, the successful establishment of the kidney disease model was confirmed by measuring serum creatinine and urea levels. The established rat model was randomly divided into four groups: control group (n = 7), cisplatin group (n = 6), roxadustat group (n = 6), and clofibrate group (n = 6). The roxadustat group and the clofibrate group were orally administered 10 mg / kg of the corresponding compound (roxadustat or clofibrate) every day for four consecutive weeks. The rat models in the control group and the cisplatin group were given the solvent according to the same dosing regimen. Urine samples were collected on the day after the last treatment to measure UTP and UCREA. Blood analysis (using Mindray automatic hematology analyzer BC-5150) and urine analysis (using Mindray automatic biochemical analyzer BS-2000M) were measured using commercially available kits according to the manufacturer's instructions. After sample collection, the rats were euthanized. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test comparison with the cisplatin group (*P<0.05, **P<0.01, ***P<0.001).

[0086] 5.2 Renal pathology and immunohistochemical studies

[0087] Left kidney samples obtained from cisplatin-induced rats were fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin, and sectioned. The tissue sections were 4 μm thick and then subjected to histochemical staining such as hematoxylin-eosin (H&E), periodic acid Schiff (PAS), and Masson's trichrome staining. After staining, the sections were scanned using advanced three-dimensional histological imaging techniques, and high-resolution images were captured using the Pannoramic DESK / MIDI / 250 / 1000 system. To evaluate tubular injury, 10 fields of view were randomly selected from each sample at a magnification of ×40 for examination, and a semi-quantitative scoring system (Pallar score) was used to evaluate the degree of tubular injury: 0 (no injury), 1 (<25% injury), 2 (25-50% injury), 3 (50-75% injury), and 4 (>75% injury). In addition, the entire tissue section was evaluated at a magnification of ×0.7 to determine the degree of collagen fiber deposition shown by Masson's trichrome staining. The collagen fiber area was semi-quantitatively analyzed using Image-Pro Plus 6.0 software (MediaCybernetics, Rockville, MD, USA). For the evaluation of glomeruli, 20 glomeruli were randomly selected from each rat and analyzed at a magnification of ×63, with the expansion of mesangial matrix shown by PAS staining as the index. The mesangial matrix was also semi-quantitatively analyzed using Image-Pro Plus 6.0 software. Statistical significance was determined by one-way analysis of variance (one-way ANOVA), followed by Dunnett's test comparison with the cisplatin group (*P < 0.05, **P < 0.01, ***P < 0.001).

[0088] Immunofluorescence staining was performed on 4-μm-thick kidney tissue sections. The sections were dewaxed and rehydrated with ethanol, and then microwaved in 0.01 mol / L sodium citrate buffer (pH 6.0) for antigen retrieval. Subsequently, the sections were incubated overnight at 4 °C with the primary antibody against α-SMA (19245S, Cell Signaling Technology). After incubation, the sections were incubated with the HRP-conjugated secondary antibody (PK10009, Proteintech Group) for 30 minutes at room temperature and visualized using a DAB kit. After staining, the sections were scanned using advanced three-dimensional histological imaging techniques, and high-resolution images were acquired using the Pannoramic DESK / MIDI / 250 / 1000 system. The whole tissue section was evaluated at a magnification of ×0.7 to determine the positive area of α-SMA expression. The α-SMA expression area was semi-quantitatively analyzed using Image-Pro Plus 6.0 software. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test compared with the cisplatin group (*P < 0.05, **P < 0.01, ***P < 0.001).

[0089] 5.3 Western blot analysis

[0090] Kidney tissues were lysed in RIPA buffer containing protease inhibitors. Protein extracts were electrophoresed on 10% SDS-PAGE gels and then transferred to PVDF membranes. The membranes were blocked with 5% non-fat milk for 1 hour and then incubated overnight at 4 °C with primary antibodies. The primary antibodies included: α-SMA (19245S, Cell Signaling Technology), EPO (ab226956, Abcam), and NADPH (5174S, Cell Signaling Technology). Subsequently, the membranes were incubated with the corresponding secondary antibody (ab6721, Abcam). After washing, the images were detected using GE AI600. The signal intensity was quantified and normalized using NADPH as an internal reference.

[0091] Results analysis: (1) Hematological analysis at the fourth week showed that compared with the cisplatin group, clofibrate significantly improved the erythropoiesis-related parameters as shown in Table 1 below:

[0092] Cisplatin group Geldanamycin group Red blood cells (RBCs, unit: cells / L, p < 0.001; Figure 7 in Panel A of 6.3±0.3×1012 8.1±0.4×1012 Hemoglobin (HGB, unit: g / L, p < 0.05; Figure 7 in Panel B of 127.7±4.7 161.8±9.3 Hematocrit (HCT, p < 0.001; Figure 7 in Panel C) 46.2±1.8% 58.4±2.9%

[0093] Gross observation of the kidney tissues showed that the kidneys of the normal control group were healthy red, while the kidneys of the cisplatin group were significantly white discolored and edematous. In contrast, the kidneys of the roxadustat group were purplish red, while the kidneys of the clofibrate group were normal red, indicating improved kidney health (Figure 7 (in Figure D). In summary, clobenic acid showed a significant effect in treating renal anemia.

[0094] (2) Urine analysis showed that roxadustat increased the UTP level (p < 0.05) ( Figure 8 (in Figure A), indicating potential nephrotoxicity; while clobenic acid increased the UCREA level (p < 0.05) ( Figure 8 (in Figure B), and at the same time decreased the UTP / UCREA ratio (p < 0.05) ( Figure 8 (in Figure C); indicating that clobenic acid has a significant effect in treating kidney injury.

[0095] (3) Severe renal pathological changes caused by cisplatin were confirmed by periodic acid-Schiff (PAS), Masson's trichrome, and hematoxylin-eosin (H&E) staining, including glomerular mesangial expansion, interstitial fibrosis, and inflammatory cell infiltration ( Figure 9 (in Figures A, C, and E). Semi-quantitative scoring confirmed that clobenic acid significantly alleviated cisplatin-induced kidney injury ( Figure 9 (in Figures B, D, and F). Compared with roxadustat, clobenic acid treatment significantly reduced inflammatory infiltration, tubular vacuolar degeneration, and renal fibrosis.

[0096] (4) Immunohistochemical results showed ( Figure 9 (in Figures G and H), clobenic acid significantly reduced the protein level of α-smooth muscle actin (α-SMA). Western blot analysis showed that clobenic acid significantly reduced the expression of α-SMA protein, while increasing the protein level of erythropoietin (EPO) ( Figure 9 (in Figure I).

[0097] These results confirmed that clobenic acid showed a potent effect in alleviating cisplatin-induced kidney injury and renal anemia, treating kidney injury and relieving renal anemia.

[0098] Example 6: Mouse model of kidney injury and anemia caused by unilateral ureteral obstruction (UUO)

[0099] 6.1 Establishment of animal model, administration, and sampling

[0100] Establishment of animal model: Male Balb / c mice were anesthetized with isoflurane and then fixed on the operating table with medical tape. The skin in the midline of the abdomen was prepared by shaving, and the skin at the surgical site was disinfected with 75% alcohol - iodine tincture - alcohol. Then, an incision was made along the linea alba of the mouse, and the incision was fixed with an abdominal retractor. The left ureter was dissected free with a sterile cotton swab and a small curved forceps, and ligated with 3-0 suture near the upper pole of the bladder. After dropping a drop of normal saline into the abdominal cavity, the abdomen was sutured. The mice were resuscitated on a heating pad and then returned to the cage. Subsequently, they were given normal diet and water and observed to complete the model construction. In the sham operation group (Sham group), except for not ligating the ureter, the other operations were the same as those in the model group. Male Balb / c mice in the experimental group of the UUO model, after a one-week adaptation period, were continuously administered with clofibric acid (clofibric acid experimental group) or roxadustat (roxadustat experimental group) by oral gavage for three consecutive days. The dose of the first clofibric acid experimental group was 5 mg / kg / day, the dose of the second clofibric acid experimental group was 10 mg / kg / day, and the dose of the roxadustat experimental group was 10 mg / kg / day. The administration continued for seven days after the unilateral ureteral obstruction surgery. Mice in the sham operation group and the UUO control group were given the solvent according to the same dosing regimen. Serum analysis was performed after the last treatment. Serum analysis (fully automatic hematology analyzer, Mindray, BS-2000M) was performed using a commercially available kit according to the manufacturer's instructions. After sample collection, the rats were euthanized. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test comparison with the UUO control group (*P < 0.05, **P < 0.01, ***P < 0.001).

[0101] 6.2 Renal pathology study

[0102] After the left kidney samples of mice were separated, fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned. The tissue sections were 4 μm thick, and then histochemical staining such as H&E and Masson's trichrome staining was performed. After staining, the sections were scanned using advanced three-dimensional histological imaging technology, and high-resolution images were captured using the Pannoramic DESK / MIDI / 250 / 1000 system. By analyzing the H&E staining, renal tubular injury was evaluated. For each sample, 10 fields of view were randomly selected for examination at a magnification of ×40, and a semi-quantitative scoring system (Pallar score) was used to evaluate the degree of renal tubular injury: 0 (no injury), 1 (<25% injury), 2 (25-50% injury), 3 (50-75% injury), and 4 (>75% injury). In addition, the entire tissue section was evaluated at a magnification of ×0.7 to determine the degree of collagen fiber deposition shown by Masson's trichrome staining. The semi-quantitative analysis of the collagen fiber area was performed using Image-Pro Plus 6.0 software. Statistical significance was determined by one-way ANOVA, and then compared with the UUO control group using Dunnett's test (*P<0.05, **P<0.01, ***P<0.001).

[0103] The relevant results are recorded in Table 2 below.

[0104] Result analysis: Serum biochemical analysis showed that the creatinine level in the UUO group was significantly higher than that in normal rats, while there was no significant change in the creatinine level in the drug-administered groups compared with the UUO group. Comprehensive analysis of urea levels showed that compared with the urea level in the UUO control group (6.26 ± 0.14 mmol / L), the urea levels in the 10 mg / kg roxadustat experimental group (5.36 ± 0.10 mmol / L, P<0.01) and the 10 mg / kg etelcalcetide experimental group (5.28 ± 0.29 mmol / L, P<0.05) were significantly lower, indicating that both roxadustat and etelcalcetide have kidney protection effects ( Figure 10 in Figures A and B).

[0105] Gross observation showed that the etelcalcetide experimental group (5 mg / kg etelcalcetide) significantly improved the pallor of the obstructed kidney ( Figure 10 in Figure C), suggesting its potential in improving renal ischemia related to ureteral obstruction.

[0106] Histopathological evaluation by H&E staining and Pallar scoring system ( Figure 10Figures D and E in the middle showed that compared with the UUO control group (4.56±0.19), different doses of clofaconazole in the first clofaconazole experimental group (5 mg / kg clofaconazole) (2.85±0.83, P<0.05) and the second clofaconazole experimental group (10 mg / kg clofaconazole) (2.93±0.35, P<0.05) significantly alleviated renal tubular injury and significantly reduced the pathological score; while the inflammatory infiltration and renal tubular injury in the 10 mg / kg roxadustat experimental group (4.78±0.09, P=0.98) were still very serious.

[0107] Masson's trichrome staining analysis ( Figure 10 Figures F and G in the middle showed that the interstitial fibrosis was significantly reduced in the first clofaconazole experimental group (5 mg / kg clofaconazole) (17.2±2.3%, P<0.05) and the second clofaconazole experimental group (10 mg / kg clofaconazole) (17.2±2.6%, P<0.05) compared with the UUO control group (26.0±1.9%), while the 10 mg / kg roxadustat experimental group (21.8±1.6%, P=0.37) did not show a reduction in fibrosis.

[0108] These results confirm that clofazodone has a significant therapeutic effect on renal injury and ischemia caused by ureteral obstruction.

[0109] Table 2

[0110]

[0111] The method of the present invention has been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein within the content, spirit and scope of the present invention to implement and apply the technology of the present invention. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention.

Claims

1. Use of clofaconazole or a pharmaceutically acceptable salt thereof or a pharmaceutical composition comprising clofaconazole or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing, alleviating or treating a disease associated with HIF-2α activity.

2. The use according to claim 1, characterized in that The pharmaceutically acceptable salt of clofazodone is an acid addition salt or a base addition salt.

3. The use according to claim 1, characterized in that The pharmaceutically acceptable salt of clofazodone is selected from at least one of the following structures:

4. The use according to claim 1, characterized in that The pharmaceutically acceptable salt of clofazodone is 5. The use according to any one of claims 1 to 4, characterized in that: The pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

6. The use according to any one of claims 1 to 5, characterized in that: The diseases associated with HIF-2α activity include hematopoietic disorders, anemia, surgery-related ischemic states and their subsequent symptoms after surgery, surgical wound healing, chronic kidney disease, cardiovascular disease, infection, inflammatory diseases, cancer, and damage to health status occurring during cancer treatment, or the subsequent symptoms of acute and prolonged cerebral ischemic states.

7. The use according to any one of claims 1 to 5, characterized in that The diseases associated with HIF-2α activity include renal anemia, primary anemia, anemia associated with tumor diseases, chemotherapy-induced anemia, anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, dysplasia and aplastic anemia, hemolytic anemia, anemia due to iron utilization disorder (iron loss anemia) or due to other endocrine disorders (such as hypothyroidism), cardiac intervention using heart-lung machine (such as bypass surgery, heart valve transplantation), carotid artery intervention, aortic intervention and intervention using instrument opening or penetrating the skull cap, resulting in ischemic state and its continuous symptoms, primary glomerulonephritis, hypertensive renal arteriosclerosis , diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial diseases (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary renal diseases (polycystic kidney disease, hereditary nephritis), heart failure, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease, HIV infection, rheumatoid arthritis, or after the use of cytostatics, antibiotics and radiotherapy, rheumatic forms of the disease range or other forms of diseases considered as autoimmune diseases, damage to the health state during drug treatment of such diseases (e.g. stroke, birth asphyxia); Or, the disease associated with HIF-2α activity includes anemia, ischemia or ischemic disease, vascular disease, angina pectoris, myocardial infarction, metabolic disorder or cancer; Or, the disease associated with HIF-2α activity includes renal anemia and / or renal disease.

8. The use according to any one of claims 1 to 7, characterized in that The clofaconazole or its pharmaceutically acceptable salt, or the pharmaceutical composition comprising clofaconazole or its pharmaceutically acceptable salt, prevents, alleviates or treats diseases related to HIF-2α activity by upregulating the downstream VEGF gene regulated by HIF-2α.

9. The use according to any one of claims 1 to 7, characterized in that: The clofaconazole or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising clofaconazole or a pharmaceutically acceptable salt thereof, prevents, alleviates or treats diseases related to HIF-2α activity by upregulating the downstream EPO gene regulated by HIF-2α.

Citation Information

Cited By

  • Use of tafamidis in activation of RXR activity

    WO2025228442A1

  • Fused five-membered and six-membered heterocyclic compound, preparation method therefor and use thereof

    WO2026032251A1