Application of histone demethylase KDM2B in medicine for treating cervical cancer

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of histone demethylase KDM2B in a medicine for treating cervical cancer. A novel factor influencing the growth and metastasis of cervical cancer cells is provided, and an experimental foundation is laid for researching the action mechanism of KDM2B serving as a chemotherapeutic drug influencing the growth and metastasis of tumor cells. By means of the mechanism, a specific targeted therapy scheme can be designed and applied to preparation of KDM2B overexpression preparation drugs, so that the KDM2B overexpression preparation drugs target RelAK37 methylation, accurate individualized treatment is carried out on cervical cancer patients, and the KDM2B overexpression preparation drugs have important application prospects in clinical treatment.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of histone demethylase KDM2B in drugs for treating cervical cancer. Background Art

[0002] Cervical cancer is the fourth most common cancer among women globally and the second leading cause of cancer-related deaths in women. In 2020, there were approximately 110,000 new cases and approximately 60,000 death cases of cervical cancer in China. It is mainly caused by persistent infection with high-risk human papillomavirus (HPV), but the development from HPV infection to cervical cancer is the result of the combined action of multiple stages, multiple pathways, and multiple molecular factors. Vaccination against HPV is the most effective way to prevent HPV infection and cervical cancer. Currently, the treatment methods include traditional cisplatin / paclitaxel chemotherapy, bevacizumab targeted therapy, and immunotherapy (immune checkpoint inhibitors), but the effective rate in cervical cancer patients is less than 50%. Therefore, in-depth research on new specific regulatory molecules and their signal transduction pathways in the occurrence and development of cervical cancer is of great significance for determining new targets for the diagnosis and treatment of cervical cancer, developing new targeted drugs, and improving the survival rate and quality of life of cervical cancer patients.

[0003] Nuclear factor-κB (NF-κB) is a class of nuclear transcription factors widely present in eukaryotic cells. Research has shown that the abnormal activation of the NF-κB pathway is closely related to the occurrence, development, poor prognosis, increased invasive and metastatic ability, and change in resistance to chemotherapy drugs of cervical cancer. However, the mechanism of abnormal NF-κB pathway in each stage of the occurrence and development of cervical cancer has not been fully elucidated. In solid tumors, the abnormal activation of NF-κB is usually due to the abnormality of its upstream regulatory pathway. The post-translational level change of NF-κB family member RelA after entering the nucleus is one of the important mechanisms for regulating the activity of the NF-κB pathway, and its abnormal regulation is closely related to the occurrence of tumors. In recent years, the methylation modification of lysine sites of RelA has become an important mechanism for regulating NF-κB activity. Different lysine sites of RelA can be modified by different lysine methyltransferases and demethylases, inhibiting or activating the NF-κB pathway through different mechanisms.

[0004] KDM2B (Lysine-specific demethylase 2B), also known as JHDM1B, FBXL10, and NDY1, is localized in the nucleus and is a member of the histone demethylase family. It can specifically demethylate histone H3K36me2, H3K4me3, and H3K79me. It consists of four different domains: the JmjC domain, the CxxC domain, the PHD domain, and the F-box domain. The JmjC domain is essential for H3K36me2 demethylation; the CxxC zinc finger domain is a DNA-binding domain that can specifically recognize CpG islands and recruit the Polycomb repressive complex 1 (PRC1) to target genes; the PHD domain can act as an E3 ligase or a histone modification reader domain; the F-box domain plays the role of a linker protein between the target protein and the E3 ubiquitin ligase. Therefore, KDM2B is a protein with multiple action targets. More and more evidence shows that the functions and mechanisms of KDM2B in the occurrence and development of different tumors are very complex. Especially in female tumors, it can exhibit various contradictory cytological effects such as promoting or inhibiting cell proliferation, maintaining cancer cell stemness, and inhibiting cell invasion and metastasis through different mechanisms. The function and mechanism of action of KDM2B in the occurrence and development of cervical cancer have not been fully elucidated. Summary of the Invention

[0005] The first object of the present invention is to provide the application of histone demethylase KDM2B in drugs for treating cervical cancer.

[0006] The second object of the present invention provides a new protein that specifically interacts with RelA - histone demethylase KDM2B, which can down - regulate the methylation level of RelA K37 and inhibit the apoptosis, migration, and invasion of cervical cancer cells by inhibiting the activity of the NF - κB pathway.

[0007] The object of the present invention also lies in providing the application of histone demethylase KDM2B in drugs for treating the growth and metastasis of cervical cancer. By overexpressing histone demethylase KDM2B, it inhibits the methylation of RelA K37 and the activity of the NF - κB pathway, providing a new drug target selection for effectively improving the clinical efficacy of cervical cancer and precisely targeting the treatment of cervical cancer.

[0008] Furthermore, the drug is a KDM2B overexpression preparation drug.

[0009] The present invention also includes the application of histone demethylase KDM2B in improving the sensitivity of precise treatment of cervical cancer. The KDM2B protein demethylates RelA K37, providing a new target and treatment strategy for increasing the selection of chemotherapy drugs for cervical cancer.

[0010] The principle of the present invention is as follows: at the molecular level, first, it is confirmed that there is an endogenous and exogenous interaction between KDM2B and RelA in cervical cancer cells; it is confirmed that overexpression of KDM2B can inhibit the transcriptional activity of NF-κB and selectively regulate NF-κB downstream target genes; then it is detected that KDM2B can inhibit RelA methylation, and inhibits NF-κB activity by affecting RelA K37. Further, through in vitro methylation experiments, mass spectrometry analysis, and detection of RelA K37 mutants, it is confirmed that RelA K37 is the key target for KDM2B to play a role in cervical cancer cells. Finally, at the cellular level, using the RelA K37 mutant, through a series of cytological experiments, it is found that after overexpression of KDM2B, it does inhibit the apoptosis, migration, and invasion of cervical cancer cells by targeting demethylation of RelA K37.

[0011] The beneficial effects of the present invention are as follows: it provides a new factor affecting the growth and metastasis of cervical cancer cells, laying an experimental foundation for studying the mechanism of action of KDM2B as a chemotherapeutic drug affecting the growth and metastasis of tumor cells. Using this mechanism, specific targeted treatment regimens can be designed and applied to the preparation of KDM2B overexpression preparation drugs, making them target RelA K37 methylation, and implementing precise individualized treatment for cervical cancer patients, which has important application prospects in clinical treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Diagram showing the exogenous and endogenous interaction between KDM2B and RelA

[0013] In the figure, A. Immunoprecipitation experiment to detect the interaction between exogenous KDM2B and RelA in cervical cancer cell line HeLa, B. Immunoprecipitation experiment to detect the interaction between endogenous KDM2B and RelA in cervical cancer cell line HeLa;

[0014] Figure 2 Diagram showing KDM2B inhibiting the transcriptional activity of NF-κB and regulating NF-κB downstream target genes

[0015] In the figure, A. Dual-luciferase reporter gene experiment to detect the effect of KDM2B on the transcriptional activity of NF-κB in cervical cancer cell line HeLa, B. Real-time fluorescence quantitative PCR (qPCR) experiment to identify the expression level of NF-κB downstream target genes (GAPDH gene as an internal reference gene);

[0016] Figure 3 Diagram showing Western blot detecting KDM2B downregulating RelA methylation;

[0017] Figure 4 Experimental result diagram of RelA K37 being the targeting site for KDM2B to inhibit NF-κB activity

[0018] Design and construction of mutants with different methylation sites of A.RelA in the figure, and B.detection of the effect of KDM2B on the transcriptional activity of mutants with different methylation sites of RelA in cervical cancer cells HeLa by dual-luciferase reporter gene assay;

[0019] Figure 5 In vitro methylation experiment and mass spectrometry analysis to verify that RelA K37 is the targeted site of KDM2B demethylation;

[0020] Figure 6 Construction and identification of a stable cell line of HeLa cells with RelA knockout (RelA KO);

[0021] Figure 7 Western blot detection to confirm that KDM2B inhibits RelA methylation by targeting RelA K37;

[0022] Figure 8 KDM2B inhibits NF-κB activity by targeting RelA K37;

[0023] Figure 9 KDM2B inhibits apoptosis of cervical cancer cells by targeting RelA K37;

[0024] Figure 10 KDM2B inhibits migration of cervical cancer cells by targeting RelA K37;

[0025] Figure 11 KDM2B inhibits invasion of cervical cancer cells by targeting RelA K37. Specific implementation manners

[0026] The following are descriptions of the preferred embodiments of the present invention. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0027] Example 1 KDM2B has exogenous and endogenous interactions with RelA

[0028] 1.1 KDM2B has exogenous interactions with RelA

[0029] (1) Use conventional methods of molecular biology to construct exogenous expression plasmids pLV-Neo-Flag-KDM2B and pCMV-Myc-RelA.

[0030] (2) Seed cervical cancer cells HeLa into a 10 cm culture dish for culturing. When the cell density reaches 70%-80%, transfection can be carried out.

[0031] (3) Take a sterilized 1.5 mL centrifuge tube and sequentially add serum-free and antibiotic-free medium, plasmid pLV-Neo-Flag-KDM2B and pCMV-Myc-RelA, and transfection reagent TurboFect Transfection Reagent in proportion. Gently pipette to mix well. Let it stand at room temperature for 20 min. The mass-volume ratio of the serum-free and antibiotic-free medium, plasmid, and transfection reagent is 100 μL medium: 1 μg plasmid: 2 μL transfection reagent.

[0032] (4) After 20 min, add the mixed solution to HeLa cells.

[0033] (5) At 48 h after transfection, harvest the cells and lyse the cells using 1.5 mM NETN lysis buffer. Take 30 μL of the cell lysate as lysate, add 1 μg of Flag antibody to the remaining cell lysate for incubation, and then add 35 μL of Agarose for immunoprecipitation.

[0034] (6) Detect the expression of Myc-RelA and Flag-KDM2B and the enrichment degree in the antibody-precipitated complex by Western blot.

[0035] 1.2 KDM2B has an endogenous interaction with RelA

[0036] (1) Prepare two dishes (10 cm) of HeLa cells. After they are confluent, harvest the cells, lyse the cells, and extract nuclear proteins.

[0037] (2) Take 30 μL of the cell lysate as lysate, divide the remaining cell lysate into two equal parts. Add 1 μL of IgG to the control group and 4 μL of KDM2B antibody to the experimental group for incubation, and then add 35 μL of Agarose for immunoprecipitation.

[0038] (3) Detect the expression of KDM2B and RelA and the enrichment degree in the antibody-precipitated complex by Western blot.

[0039] Specific steps of the Co-IP immunoprecipitation experiment:

[0040] (1) At 48 h after cell transfection, collect the cells. Digest with trypsin and neutralize with medium. Wash the culture flask with pre-cooled PBS, transfer the cells to a 15 mL centrifuge tube, and centrifuge at 1,000 rpm for 3 min.

[0041] (2) Discard the supernatant, then wash the cells with pre-cooled PBS, and at the same time transfer the cells to a 1.5 mL EP tube, centrifuge at 1,000 rmp for 3 min at 4 °C. Discard the supernatant PBS.

[0042] (3) Prepare cell lysis buffer, the components are 150 mM NETN Buffer, protease inhibitors (2 μg / ml Aprotinin, 2 μg / ml Leupeptin, 50 μg / ml PMSF, added before use), 1 M DTT, 1 M NaF, and 0.1 M Na 3 VO 3 Add 700 μL of pre-cooled cell lysis buffer to each tube of cells, and pipette gently to mix evenly (be careful not to form a large amount of foam). On a rotary mixer, gently shake and lyse for 35 min. (If the protein to be detected is a nuclear protein, ultrasonic treatment is required after lysis, the conditions are 40 W, ultrasound for 2 s, stop for 2 s, repeat 4 times)

[0043] (4) When the cells are fully lysed, the protein can be released. Centrifuge to separate cell debris, the conditions are 12,000 rpm, 10 min, 4 °C.

[0044] (5) Pre-clearing: Aspirate the supernatant and transfer it to a new pre-cooled 1.5 mL centrifuge tube on ice. Add 30 μL of Agarose. Fix the centrifuge tube on a rotary mixer and gently shake for 30 - 60 min.

[0045] (6) Centrifuge at 500 × g for 1 min, 4 °C. Aspirate 30 μL of the supernatant into a new 1.5 mL centrifuge tube as lysate. Add 30 μL of 2×SDS Loading Buffer and boil for 10 min. Transfer the remaining supernatant to a new pre-cooled 1.5 mL centrifuge tube on ice.

[0046] (7) Add 1 - 2 μL of the corresponding antibody and rotate slowly at 4 °C for 2 h.

[0047] (8) Add 25 μL of Agarose to capture the antibody and enrich the antigen at the same time. Fix the centrifuge tube on a rotary mixer and gently shake at 4 °C for more than 4 h or overnight.

[0048] (9) Centrifuge at 500 × g for 2 min, 4 °C. The precipitate at the bottom of the tube is the agarose bead - antigen - antibody complex, discard the supernatant.

[0049] (10) Add 1 mL of pre-cooled NETN buffer and wash three times, each time for 10 min, centrifuge at 500 × g for 2 min, 4 °C.

[0050] (11) Collect the Agarose precipitate. After three washes, aspirate the supernatant completely and add 30 μL of NETN lysis buffer.

[0051] (12) Add 30 μL of 2×SDS Loading Buffer and boil at 100 °C for 10 min.

[0052] (13) Western blot detection.

[0053] According to the method of Example 1.1, whether there is an interaction between exogenously expressed KDM2B and RelA was detected by plasmid transfection and immunoprecipitation Co-IP. In HeLa cells, plasmids of RelA with Myc tag and KDM2B with Flag tag were exogenously expressed, and IP was performed using Flag antibody. The experimental results showed that Myc-RelA was detected in the IP complex co-transfected with Flag-KDM2B, confirming that exogenously expressed KDM2B and RelA can interact in HeLa cells ( Figure 1 as shown in A). According to the method of Example

[0054] 1.2, IP was performed using KDM2B antibody, and RelA was also detected in the IP complex, confirming the interaction between endogenous RelA and KDM2B ( Figure 1 as shown in B).

[0055] Example 2 KDM2B inhibits the transcriptional activity of NF-κB and regulates NF-κB downstream target genes

[0056] 2.1 KDM2B inhibits the transcriptional activity of NF-κB

[0057] The effect of KDM2B on the transcriptional activity of NF-κB in HeLa cells was detected by dual-luciferase reporter gene assay.

[0058] (1) Cells were seeded in 24-well plates, with 3 replicates in each group, and each data was repeated 3 times. When the cells grew to 70%-80%, the target gene plasmid pCMV-Myc-KDM2B plasmid, the reporter gene plasmid pNF-κB-Luc and RL were co-transfected. We transfected the pCMV-Myc-KDM2B plasmid at gradients, 0, 0.1, 0.2, 0.4 μg / well respectively, the NF-κB reporter gene plasmid 0.08 μg / well, and RL 0.1 ng / well.

[0059] (2) After 6 h of transfection, the medium was replenished, and the medium was changed after 24 h.

[0060] (3) TNF-α (10 ng / mL) was added for treatment 6 h before harvesting the cells. After 36-48 h of transfection, the medium in the 24-well plates was discarded completely, and 90 μL of the prepared 1x Passive Lysis Buffer was added to each well, and lysed at room temperature on a shaker for 30 min.

[0061] (4) Take 30 μL of the lysate from each well and add it to the measurement plate, and use the Dual-Luciferase Reporter Assay System (0000334817) to detect it on the machine.

[0062] (5) Add the remaining lysate to 2×SDS Loading Buffer, boil it in water for 10 min, and detect the protein level by Western blot.

[0063] (6) Statistically analyze the obtained data: calculate the average value of the fluorescence intensity of each group. Take the fluorescence intensity of the cells in the first group as 1, and calculate the relative fluorescence intensity of the cells in each group, that is, the relative NF-κB activity.

[0064] 2.2 KDM2B regulates NF-κB downstream target genes

[0065] (1) Transfect HeLa cells with pCMV-Myc-KDM2B plasmid or control plasmid.

[0066] (2) After 48 h, extract RNA by the Trizol method.

[0067] (3) Perform reverse transcription according to the following reaction system:

[0068]

[0069] The conditions for reverse transcription are as follows: 37 °C, 15 min; 98 °C, 5 min; 4 °C, ∞.

[0070] (4) Use real-time fluorescence quantitative PCR (qPCR) experiment to identify the expression levels of NF-κB downstream target genes (A20, cIAP1, cIAP2, TNF-α, IL-8, DUSP5, and CCL20) in cells (GAPDH gene is used as an internal reference gene). The relevant primer list for the qPCR experiment is as follows.

[0071] Table qPCR primer sequences

[0072]

[0073]

[0074] Note: The primers were synthesized by BGI.

[0075] (5) The fluorescent dye used in this laboratory is SybrGreen 2×FAST qPCR Mastermix from Kapa. Dilute the reverse-transcribed cDNA, add 120 μL of water, and mix well; the reaction system is as follows:

[0076]

[0077] The running program is as follows: 95°C, 2 min; 95°C, 15 s; 58°C, 20 s; 72°C, 30 s; a total of 40 cycles; 60°C, 1 min.

[0078] (6) Measure the mRNA expression level of NF-κB downstream target genes by qPCR, and use the mRNA of GAPDH as a reference.

[0079] According to the method of Example 2.1, using the reporter gene assay, KDM2B was transfected into HeLa cells in gradients. Whether or not treated with TNF-α, it was found that with the increase in the transfection amount, KDM2B could inhibit the transcriptional level of NF-κB in a gradient-dependent manner ( Figure 2 as shown in A). According to the method of Example 2.2, use qPCR technology to detect the effect of KDM2B on the mRNA levels of some target genes in the NF-κB signaling pathway. The experimental results showed that in HeLa cells, overexpression of KDM2B could significantly inhibit the mRNA levels of NF-κB downstream target genes such as cIAP-1, cIAP-2, A20, and DUSP5 ( Figure 2 as shown in B).

[0080] Example 3 Western blot detection of KDM2B downregulating RelA methylation

[0081] (1) Transfect pLV-Neo-Flag-KDM2B or control plasmid into HeLa cells. After 36 h of transfection, add or not add TNF-α (10 ng / mL) and treat for 6 h.

[0082] (2) Harvest the cells 48 h after transfection and lyse the cells using 1.5 mM NETN lysis buffer.

[0083] (3) Take 30 μL of cell lysate as input, add the remaining cell lysate to 1 μg of pan-methylated antibody for incubation, and then add 35 μL of Agarose for immunoprecipitation.

[0084] (4) Detect the basal level expression of Flag-KDM2B and RelA and the enrichment degree of RelA in the antibody-precipitated complex by Western blot.

[0085] According to the method of Example 3, using the pan-methylated antibody, it was detected by Western blot that overexpression of KDM2B could inhibit the methylation level of RelA with or without TNF-α treatment, but did not affect the protein level of RelA ( Figure 3 as shown).

[0086] Example 4: RelA K37 is the targeted site where KDM2B inhibits NF-κB activity

[0087] (1) Mutants of 5 methylation sites of RelA were constructed using molecular cloning technology. The primer sequences of the RelA mutants are shown in Table 2

[0088] Table 2 Primer sequences of RelA mutants

[0089]

[0090] (2) HeLa cells were seeded in 24-well plates and co-transfected with RelA siRNA. When the cells grew to 70%-80%, they were transfected with ZNF496, wild-type and mutant RelA plasmids, and co-transfected with pNF-κB-Luc and RL-related reporter gene plasmids

[0091] (3) After 36 h, the cells were lysed and reporter gene detection was performed

[0092] According to the method of Example 4, using the mutants of 5 methylation sites of RelA constructed, the effect of KDM2B on the transcriptional activity of NF-κB was detected by reporter gene experiment. It was found that KDM2B could inhibit the transcriptional activities of K218R, K221R, K314R and K315R, but the inhibitory ability on the transcriptional activity of K37R was significantly reduced ( Figure 4 as shown). It is suggested that K37 of RelA plays an important role in the regulation of the NF-κB pathway activity by KDM2B

[0093] Example 5: In vitro methylation experiment and mass spectrometry analysis verify that RelA K37 is the targeted site of KDM2B demethylation

[0094] (1) First, the methylated short peptide of RelA, Gly-Met-Arg-Phe-Arg-Tyr-Lys(Me)-Cys-Glu-Gly, with a purity of 98% and a quantity of 5 mg, was synthesized by Guoping Pharmaceutical

[0095] The unmethylated short peptide, Gly-Met-Arg-Phe-Arg-Tyr-Lys-Cys-Glu-Gly, with a purity of 98% and a quantity of 5 mg

[0096] (2) Transfect the wild-type plasmid of KDM2B, pLV-Neo-Flag-KDM2B, and its enzymatic activity mutant plasmid, pLV-Neo-Flag-KDM2B-H242A, into HeLa cells and harvest the cells after 48 h. Lyse the cells with lysis buffer for 30 min and then perform ultrasonic disruption. After centrifugation, take the supernatant, add magnetic beads pre-incubated with Flag antibody for 3 h, and incubate for 5 h. Then wash the beads with 150 mM NETN, 3 times, 10 min for each time. Resuspend the magnetic beads bound with proteins, add the synthesized peptide segments, and incubate overnight.

[0097] (3) Extract the peptide segments, perform ultrafiltration using a 10 kDa ultrafiltration tube, centrifuge at 13,700×g for 1 h at 4 °C. Collect the ultrafiltrate and dry it using a centrifugal concentrator dryer.

[0098] (4) Prepare desalting columns simultaneously. Pierce the C18 membrane with a syringe needle, two layers, push it into a T-400 pipette tip, compact it, place it on an EP tube with a prepared column-shaped white pipette tip holder, aspirate 100% acetonitrile, 100 μL for each column, add it with a pipette tip with a long tip, add it along the bottom without bubbles.

[0099] (5) Activate: 100 μL of 0.1% acetonitrile (CAN), centrifuge at 1,300 rpm at room temperature for 3 min, and discard the effluent. 100 μL of 50% CAN, centrifuge at 1,300 rpm at room temperature for 3 min, and discard the effluent.

[0100] (6) Equilibrate: 100 μL of 0.1% trifluoroacetic acid (TFA), centrifuge at 1,300 rpm at room temperature for 3 min, and discard the effluent. Repeat this step once.

[0101] (7) Re-dissolve with 100 μL of 0.1% TFA and vortex to fully dissolve the peptide segment sample. Slowly aspirate and blow the sample 5 - 10 times, centrifuge at 1,300 rpm at room temperature for 3 min, and collect the effluent. Repeat this step once.

[0102] (8) Wash: 100 μL of 0.1% TFA, centrifuge at 1,300 rpm at room temperature for 3 min, and collect the effluent. Repeat this step once.

[0103] (10) Elute: Replace with a new imported centrifuge tube, 50 μL of 50% acetonitrile (containing 0.1% TFA, prepared with mass spectrometry-grade water), centrifuge at 1,300 rpm at room temperature for 3 min. The eluted effluent is the required sample, and it can be eluted again, 100 μL of 50% acetonitrile (containing 0.1% TFA, prepared with mass spectrometry-grade water), centrifuge at 1,300 rpm at room temperature for 3 min.

[0104] (11) Dry: Approximately 1 h, transfer it to the mass spectrometry room for loading, and write down the numbering sequence clearly.

[0105] (12) Construct a peptide library of RelA, then search the database using pFind for the data, analyze the LC-MS results of the samples, and obtain the secondary spectra.

[0106] According to the method of Example 5, in order to clarify that KDM2B down-regulates the methylation of RelA K37 through its demethylase activity and at the same time determine whether KDM2B can directly catalyze the demethylation of RelA K37Me, a short peptide with K37 methylation of RelA and an unmethylated short peptide were constructed by the company. The synthesized peptides were subjected to an in vitro demethylation reaction using IP KDM2B and its enzyme activity mutants, and then mass spectrometry analysis was performed. Mass spectrometry can sensitively detect the difference in molecular weights between methylated peptides and unmethylated peptides. Construct a database of RelA peptides, search the detected data using pFind, and the methylated peptides will be marked in red. According to the secondary spectra obtained after database searching, it can be seen that after the methylated peptide is mixed with KDM2B, the methylation modification of RelA K37 disappears (K is not marked in red); after being mixed with the KDM2B mutant, the methylation of RelA K37 still exists (K is marked in red) ( Figure 5 as shown). This indicates that KDM2B plays a demethylation role on RelA K37. Example 6 Construction and identification of a stable cell line of HeLa cells with RelA knockout (RelA KO) 6.1 Construction of the knockout plasmid

[0107] The method used is the CRISPR-Cas9 technology to construct a gene knockout cell line. The CRISPR guide sequence is from the website http: / / crispr-era.stanford.edu / CalculateAction.action, and the RelA sgRNA primer sequences are Oligo1: CACCGGATCTCCACATAGGGGCCAG; Oligo2: CCTGGCCCCTATGTGGAGATCCAAA.

[0108] (1) Vector digestion: Digest 5 μg of the lenti-CRISPR-v2 vector with BsmBI enzyme and dephosphorylate it at 37 °C for 30 min.

[0109] (2) Electrophorese the vector digested in step (1) and perform gel extraction.

[0110] (3) Phosphorylate and anneal the synthesized gRNA sequence. Annealing program: 37 °C for 30 min, 95 °C for 5 min, and cool down to 25 °C at 5 °C / min.

[0111] (4) Dilute the oligos obtained after annealing in step (3) 200-fold.

[0112] (5) Ligation reaction, 10 min at room temperature.

[0113] (6) Transformation: Transform the ligated vector into Stabl3 Escherichia coli.

[0114] (7) Pick colonies, extract plasmids and send for sequencing.

[0115] 6.2 Construction of stable cell lines

[0116] (1) Prepare HEK293T cells.

[0117] (2) When the cells reach 60 - 70% confluence, perform transfection with a transfection ratio of pSPAX2:pMD2G:X (the constructed gRNA vector) = 3:2:5.

[0118] (3) Change the medium 6 h after transfection and replenish the medium 24 h later (add a little more medium).

[0119] (4) Collect the virus solution: Transfer the medium to a new 15 mL centrifuge tube 48 h later, centrifuge at 1,000 rpm for 3 - 5 min, and filter out cell debris with a 0.22 μm filter (can be stored at -80 °C).

[0120] (5) Add the filtered virus solution to the cells we previously seeded (a confluence of 30% is optimal for seeding cells). After 24 h of virus infection, discard the virus solution and change to a medium containing 20% serum for 2 - 3 days. Then change to a medium with puro (the concentration of puro varies for different cell lines) for screening, and continuously screen for 1 - 2 weeks until almost no cell death occurs (a group of cells not infected with the virus can be set as a reference).

[0121] (6) Collect some cells and identify the knockout effect by Western blot.

[0122] 6.3 Selection of monoclonal cells

[0123] (1) Digest the screened and identified cells with trypsin, terminate with medium, and centrifuge.

[0124] (2) Resuspend with 1 mL PBS and filter the cells through a filter membrane. Sort single cells into a 96 - well plate for culture by flow cytometry (the medium in the 96 - well plate should contain puro) and replenish the medium on time.

[0125] (3) After 2 - 3 weeks, clones can be seen. Digest with trypsin and transfer to a 24 - well plate for continued culture (change to normal medium).

[0126] (4) When the 24 - well plate is full, digest with trypsin, divide into two parts, continue to culture one half, and lyse the other half of the cells with ATM lysis buffer to extract proteins, and use Western blot for knockout identification.

[0127] (5) Expand the identified monoclonal cells and cryopreserve them for storage.

[0128] According to the method of Example 6, a stable RelA knockout (RelA KO) HeLa cell line was obtained, and the knockout effect was obvious ( Figure 6 ) as shown.

[0129] Example 7 Western blot detection confirmed that KDM2B inhibits RelA methylation by targeting RelA K37

[0130] RelA knockout (RelA KO) HeLa cells were transfected with pLV-Neo-Flag-KDM2B and empty vector control, pCMV-Myc-RelA, pCMV-Myc-RelA K37R, and empty vector control plasmids respectively. After 36 h, the cells were harvested, lysed with 1.5 mM NETN lysis buffer for 35 min, centrifuged after sonication, and the supernatant was taken. 40 μL of the supernatant was used as lysate, and 4 μL of pan-methylated antibody was added to the remaining supernatant and incubated at 4 °C for 2 h. Then 35 μL of Agarose was added and incubated for more than 6 h. Western blot was used to detect the enrichment level of RelA.

[0131] According to the method of Example 7, the effect of KDM2B on the methylation levels of RelA and its K37R mutant in cervical cancer cells was detected using pan-methylated antibody. The results showed that KDM2B had no obvious effect on the expression level of RelA, but could significantly inhibit the methylation level of RelA and had no effect on the methylation level of RelA K37R ( Figure 7 ). This indicated that KDM2B down-regulated the methylation level of RelA by reducing the methylation of K37R.

[0132] Example 8 KDM2B inhibits NF-κB activity by targeting RelA K37

[0133] Seed 2×10 4 RelA KO HeLa cells in a 24-well culture plate. After 18 h, pLV-Neo-Flag-KDM2B and empty vector control, pCMV-Myc-RelA, pCMV-Myc-RelA K37R, and empty vector control plasmids, the NF-κB reporter gene plasmid and the pRL-TK Renilla luciferase reporter plasmid were transfected into the cells. After 48 h, the cells were harvested, and the luciferase activity in the lysate was measured using a Glomax 96 microplate luminometer and a dual-luciferase reporter assay system. The expressions of RelA and KDM2B were confirmed by Western blot.

[0134] According to the method of Example 8, using HeLa cells with RelA knockout, wild-type RelA and the mutant RelA K37R with a mutated K37 methylation site were complemented, and at the same time, a KDM2B overexpression vector was transfected. The reporter gene experiment found that after complementing wild-type RelA, KDM2B could inhibit the activity of the NF-κB pathway, while after complementing RelA K37R, the ability of KDM2B to inhibit the activity of the NF-κB pathway was weakened. This indicates that KDM2B inhibits the transcriptional activity of the NF-κB pathway through RelA K37 methylation( Figure 8 as shown).

[0135] Example 9 KDM2B inhibits apoptosis of cervical cancer cells by targeting RelA K37

[0136] (1) Add RelA KO HeLa cells to a 24-well plate (2×10 5 cells per well), and culture them in an incubator at 37°C and 5% CO2 for 18 h.

[0137] (2) Co-transfect pCMV-Myc-KDM2B, pCMV-Myc-RelA, pCMV-Myc-RelA K37R and their empty vector control plasmids into RelA KO HeLa cells. Culture for 48 h.

[0138] (3) Then collect the old medium, and digest the cells with trypsin. Add the previously collected medium to terminate the digestion, and transfer it to a new centrifuge tube. Centrifuge at 800 rpm for 3 min at 4°C to collect the precipitate. After suspending the cells with PBS, centrifuge at 800 rpm for 3 min at 4°C to collect the precipitate.

[0139] (4) Suspend the cell pellet in each centrifuge tube with 195 μL of Annexin V-fluorescein isothiocyanate (Annexin V-FITC) binding solution. Add 5 μL of Annexin-FITC dye and 10 μL of propidium iodide (PI) to each tube, and incubate at room temperature for 15 min.

[0140] (5) Detect the changes in cell apoptosis of the stained cells by flow cytometry.

[0141] According to the method of Example 9, a cell apoptosis experiment was carried out. It was found that after complementing wild-type RelA, KDM2B could promote apoptosis of cervical cancer cells; after complementing RelA K37R, the pro-apoptotic effect of KDM2B on cervical cancer was weakened( Figure 9 as shown). It shows that KDM2B inhibits apoptosis of cervical cancer cells by targeting RelA K37.

[0142] Example 10 KDM2B inhibits migration and invasion of cervical cancer cells by targeting RelA K37

[0143] (1) Digest the cells cultured for 48 h after transfection, and centrifuge at 800 rpm for 3 min.

[0144] (2) Discard the culture medium, wash once with PBS, and resuspend the cells with serum-free medium. Count the cells using a cell counter, take the required number of cells, and make up to 200 μL with serum-free medium.

[0145] (3) Add 600 μL of medium containing 20% serum to the lower chamber of a 24-well plate, and place the Transwell chamber on it.

[0146] (4) Add the cell suspension from (2). Place it in an incubator at 37 °C and 5% CO 2 and culture for 36 h.

[0147] (5) Take out the Transwell chamber, discard the culture medium, wipe off the cells on the upper layer of the chamber with a cotton swab, wash 3 times with PBS, and fix with methanol.

[0148] (6) Wash 2 times with PBS, stain with 0.1% crystal violet diluted with PBS, rinse with running water after staining, and air dry.

[0149] (7) Observe and count randomly in five fields of view under a 400-fold microscope, and perform statistical analysis.

[0150] The Transwell chamber used in the invasion experiment is slightly different, and its upper side is coated with Matrigel. After adding cells to the chamber, the cells will secrete matrix metalloproteinases to decompose the Matrigel, and then enter the lower chamber containing the medium. Therefore, the cells are counted to identify the invasion ability of the cells.

[0151] According to the method of Example 10, cell migration and invasion experiments were carried out. The results showed that after re-supplementing wild-type RelA, KDM2B could inhibit the migration and invasion abilities of cervical cancer cells; after re-supplementing RelA K37R, the inhibitory effects of KDM2B on the migration and invasion abilities of cervical cancer cells were weakened (as shown in Figure 10 and 11 respectively). It shows that KDM2B inhibits the migration and invasion of cervical cancer cells by targeting RelA K37.

Claims

1. Application of histone demethylase KDM2B in the treatment of cervical cancer.

2. The use according to claim 1, characterized in that: The histone demethylase KDM2B inhibits the activity of the NF-κB pathway by downregulating the methylation level of RelAK37, thereby inhibiting the apoptosis, migration and invasion of cervical cancer cells.

3. Application of histone demethylase KDM2B in drugs for the treatment of cervical cancer growth and metastasis.

4. The use according to claim 3, characterized in that: By overexpressing histone demethylase KDM2B, RelAK37 methylation is inhibited, and the activity of the NF-κB pathway is inhibited, providing new drug target selection for effectively improving the clinical efficacy of cervical cancer and accurately targeting the treatment of cervical cancer.

5. The use according to claim 3, wherein the drug is a histone demethylase KDM2B overexpression preparation drug.

6. Application of histone demethylase KDM2B in improving the sensitivity of precision treatment of cervical cancer.

7. The use according to claim 6, characterized in that Histone demethylase KDM2B provides a new target and therapeutic strategy for increasing the selection of chemotherapeutic drugs for cervical cancer by demethylating RelAK37.

Images