Application of carbon metabolism inhibitor in preparation of medicine for treating toxic diffuse goiter

Abstract

The invention discloses application of a carbon metabolism inhibitor in preparation of a medicine for treating toxic diffuse goiter, and belongs to the technical field of biological medicine. Experiments find that compared with HC (healthy control), the number (or proportion) of pTh17 in PBMCs (peripheral blood mononuclear cells) of a GD patient is remarkably increased, and one-carbon metabolism in CD4 + T cells of the GD patient is also enhanced for the first time, and subsequent experiments prove that when SAM is added to simulate a methionine enhancement effect (namely one-carbon metabolism is enhanced), conversion from non-pTh17 to pTh17 can be promoted, and the number of pTh17 is increased; one-carbon metabolism is reprogrammed (namely, one-carbon metabolism is inhibited) by knocking down the Mat2a gene to block metabolic production of SAM or delivering cycloleucine to reduce the concentration of SAM, CD4 + T cells can be promoted to be differentiated into non-pTh17 cells, the CD4 + T cells can be inhibited from being differentiated into pTh17 cells, and finally the purpose of treating GD is achieved.

Description

Technical Field

[0001] The present invention relates to the field of biological medicine technology, and particularly relates to the application of one-carbon metabolism inhibitors in the preparation of drugs for treating Graves' disease. Background Art

[0002] Graves' disease, also known as Graves' Disease (GD), is a common organ-specific autoimmune disease and the most common cause of hyperthyroidism, accounting for about 85% of hyperthyroid patients. The clinical manifestations of GD are mainly hypermetabolism caused by excessive secretion of thyroid hormones and thyroid hyperplasia, etc. The damage can involve all organs of the body. If the treatment is improper, it will lead to progressive organ dysfunction of the body, and eventually complications such as hyperthyroid heart and thyroid crisis will endanger life. The incidence rate of GD has been increasing year by year in recent years, and there is a trend of getting younger.

[0003] The pathogenesis of GD is very complex, and its etiology has not been fully elucidated. At present, the following three treatment methods are mainly used clinically, including: antithyroid drugs, radioactive iodine, and surgical treatment. However, antithyroid drugs have a long course of treatment, are prone to recurrence, and have side effects such as liver damage and leukopenia. Radioactive iodine and surgical treatment will cause permanent hypothyroidism, and patients need to take medicine for life to maintain normal physiological functions, which brings economic pressure and a decline in the quality of life to patients and their families.

[0004] Therefore, exploring the pathogenesis of GD and finding new GD treatment drugs with high and stable efficacy and few side effects are urgent matters in this field. Summary of the Invention

[0005] In view of the problems of unstable efficacy, easy recurrence, and large side effects of existing GD treatment drugs, the present invention provides the application of one-carbon metabolism inhibitors in the preparation of drugs for treating Graves' disease. The one-carbon metabolism inhibitor can reprogram the one-carbon metabolism signaling pathway in CD4 + T cells, promote the differentiation of CD4 + T cells into non-pTh17 cells, inhibit their differentiation into pTh17 cells, and ultimately achieve the purpose of treating Graves' disease, with stable efficacy, providing a new perspective and method for the treatment of GD.

[0006] Based on the above, the present invention first provides the application of one-carbon metabolism inhibitors in the preparation of drugs for treating Graves' disease.

[0007] Preferably, the one-carbon metabolism inhibitor is a substance that can specifically or non-specifically interfere with, block, or regulate key molecules or steps in the one-carbon metabolism signaling pathway.

[0008] Preferably, the one-carbon metabolism inhibitor comprises at least one of a SAM-mediated methylation inhibitor, a SHMT1 inhibitor, a SHMT2 inhibitor, a MAT2A inhibitor, a SAHH inhibitor and a BHMT enhancer.

[0009] Preferably, the MAT2A inhibitor is shRNA, and the shRNA includes the sequence shown in SEQ ID NO.1.

[0010] Preferably, the SAHH inhibitor comprises adenosine dialdehyde.

[0011] Preferably, the inhibitor of SAM-mediated methylation comprises cycloleucine.

[0012] Preferably, the one-carbon metabolism inhibitor reprograms CD4 + One-carbon metabolism signaling pathway in T cells, thereby promoting CD4 + T cells differentiate into non-pTh17 cells and inhibit their differentiation into pTh17 cells, ultimately achieving the goal of treating toxic diffuse goiter.

[0013] Another aspect of the present invention provides a method for preparing a nanocarrier loaded with cycloleucine, the method comprising:

[0014] Step S1, weighing amphiphilic cPHRS and cycloleucine, placing them in a dimethylformamide solvent, and completely dissolving them by ultrasound;

[0015] Step S2, under stirring, adding the mixed solution obtained in step S1 dropwise into distilled water, and continuing stirring at 20° C. to 25° C. for 12 hours;

[0016] Step S3, dialyzing the solution obtained in step S2 at 4° C. for 24 hours, and then freeze-drying the solution to obtain the nanocarrier loaded with cycloleucine.

[0017] Preferably, the mass ratio of cPHRS to cycloleucine is 3:1 to 5:1.

[0018] Another aspect of the present invention provides a nanocarrier loaded with cycloleucine, wherein the nanocarrier is prepared by the aforementioned preparation method.

[0019] Compared with the prior art, the beneficial effects of the present invention include at least:

[0020] Distinct from the prior art, the present invention is no longer limited to traditional immunosuppressive or immunomodulatory methods. Instead, from the perspective of metabolism, it delves deep into the pathogenesis of GD and finally reveals for the first time the key role of one-carbon metabolism in the differentiation of pTh17 in GD. Specifically, through experiments, the present invention found that compared with HC (healthy control), the number (or proportion) of pTh17 in the PBMCs of GD patients was significantly increased, and the one-carbon metabolism in the CD4 + T cells of GD patients was also enhanced. Moreover, through experiments, it was found that adding SAM to simulate the methionine enhancement effect (i.e., enhancing one-carbon metabolism) could promote the transformation of non-pTh17 into pTh17 and increase the number of pTh17.

[0021] Furthermore, based on the above findings, the present invention proposes a new strategy for treating GD by regulating one-carbon metabolism, providing new theoretical support for the pathogenesis and treatment methods of GD. And the present invention proves through experiments that reprogramming one-carbon metabolism (i.e., inhibiting one-carbon metabolism) by knocking down the Mat2a gene to block the metabolism of SAM or delivering cyclo-leucine to reduce the concentration of SAM can promote the differentiation of CD4 + T cells into non-pTh17 cells and inhibit their differentiation into pTh17 cells, ultimately achieving the purpose of treating GD. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Showing the comparison results of the proportions of pTh17 and non-pTh17 and the levels of related cytokines in the PBMCs of GD patients and HC, wherein:

[0023] A - D show the comparison of the expression of IL-17A and IFN-γ in gated CD4 + T cells in the PBMCs of GD patients and HC;

[0024] E - F show the concentrations of IL-17A and IFN-γ in the culture supernatants of the PBMCs of GD patients and HC measured by enzyme-linked immunosorbent assay;

[0025] G shows the expression levels of IL-17A, T-bet, Ror-c and IFN-γ in the PBMCs of GD patients and HC detected by real-time fluorescence quantitative PCR;

[0026] H shows the fluorescence images of the immunolocalization of IL-17A and IFN-γ in the PBMCs of GD patients and HC.

[0027] Figure 2 Showing the correlation analysis of the proportion of pTh17 and non-pTh17 with the progression of GD, wherein:

[0028] A represents the analysis of the relationship between the pTh17 / non-pTh17 ratio (classified by equal quantity) and the concentrations of FT3, FT4, TT3, TT4, TRAb, and TPO-Ab using Fisher's exact test;

[0029] B - G show the correlation analysis between the pTh17 / non-pTh17 ratio and FT3, FT4, TT3, TT4, TRAb, and TPO-Ab.

[0030] Figure 3 It represents the results of RNA sequencing and subsequent differential gene analysis of PBMCs from GD patients and HC, where:

[0031] A represents the differential genes between GD patients and HC;

[0032] B represents the results of principal component analysis;

[0033] C represents the results of gene ontology enrichment analysis of differentially expressed genes;

[0034] D - E represent the relative abundances of proteins involved in the one-carbon metabolic pathway in PBMCs of GD patients and HC, representative results (mean ± standard deviation) of two independent experiments with 6 samples per group, *P < 0.05, using the Mann - Whitney U test;

[0035] F - G represent the analysis of the expression levels of SHMT1, SHMT2, BHMT, MAT2A, and MTR in PBMCs of HC and GD patients by real-time fluorescence quantitative PCR reaction. The enriched expression levels in HC and GD patients are marked in the figure. The data represent the mean of three biological replicates; G shows the representative results (mean ± standard error) of two independent experiments with 4 samples per group, *P < 0.05, **P < 0.01, using the Mann - Whitney U test.

[0036] Figure 4 It represents the effect of adding SAM to simulate the enhancement of methionine on cell differentiation, where:

[0037] A represents the analysis of the expression of IL-17A and IFN-γ by flow cytometry;

[0038] B - C represent the percentages of IL-17A + IFN-γ + cells and IL-17A + IFN-γ - cells under the pTh17 differentiation medium;

[0039] D - E represent the percentages of IL-17A + IFN-γ+ Cells and IL-17A + IFN-γ - Percentage of cells; Each group in B-E shows representative results of 3 samples (mean ± SEM), ***P < 0.001, Mann-Whitney U test was used;

[0040] F-G show the expression levels of IL-17A, T-bet, Ror-c and IFN-γ analyzed by real-time fluorescence quantitative PCR reaction, and the concentrations of IL-17A and IFN-γ analyzed by enzyme-linked immunosorbent assay; Each group shows representative results of two independent experiments, with 3 samples per group in each experiment (mean ± SD), **P < 0.01, ***P < 0.001, Mann-Whitney U test was used;

[0041] H shows the protein expression levels of T-bet, Stat-3, phosphorylated Stat-3 and glyceraldehyde-3-phosphate dehydrogenase measured by Western blotting. Each group shows representative results of two independent experiments, with 3 samples per group in each experiment (mean ± SD), *P < 0.05, Mann-Whitney U test was used.

[0042] Figure 5 Indicates that knockdown of Mat2a blocks the effect of one-carbon metabolism on cell differentiation, where:

[0043] A-B show the expression of IL-17A and IFN-γ analyzed by flow cytometry;

[0044] C shows the results of the concentration of IL-17A in the culture supernatant detected by enzyme-linked immunosorbent assay; Each group in B-C shows representative results of three independent experiments, with 3 samples per group in each experiment (mean ± SD), *P < 0.05, Mann-Whitney U test was used;

[0045] D shows the gene ontology enrichment analysis of differentially expressed genes;

[0046] E shows the volcano plot analysis of differentially expressed genes;

[0047] F shows the expression levels of IL-17A, IFN-γ, IL-10, IL-22, TGF-β and IL-9 in pTh17 transfected with shCtrl and shMat2a analyzed by real-time fluorescence quantitative PCR reaction. Each group shows representative results of two independent experiments, with 3 samples per group in each experiment (mean ± SD), *P < 0.05, **P < 0.01, ***P < 0.001, ANOVA and Bonferroni multiple comparison tests were used;

[0048] G represents the amount of methylated histone (H3K4me3) bound to Blimp-1 detected from the immunoprecipitate by real-time fluorescence quantitative PCR reaction;

[0049] H represents the results of measuring the protein expression levels of Blimp-1, IFN-γ, and glyceraldehyde-3-phosphate dehydrogenase using Western blotting;

[0050] I represents a schematic diagram of the mechanism by which one-carbon metabolism promotes IFN-γ expression by inhibiting Blimp-1.

[0051] Figure 6 represents the effect of delivering nano-cyclic leucine to reprogram one-carbon metabolism on cell differentiation, where:

[0052] A represents a schematic diagram of nano-cyclic leucine packaging and targeting Th17 cells;

[0053] B represents CD4 + T cells treated with nano-cyclic leucine (Nano-CL), and the results are representative of three independent experiments;

[0054] C represents the expression of IL-17A, T-bet, Ror-c, and IFN-γ analyzed by qPCR;

[0055] D represents the concentration of IL-17A and IFN-γ analyzed by ELISA;

[0056] E-F represents the expression of IL-17A and IFN-γ analyzed by flow cytometry, and the results are representative of two independent experiments with three samples in each group (mean ± standard deviation), **P<0.01, using ANOVA and Dunn's multiple comparison test;

[0057] G-H represents the expression of IL-17A and IFN-γ analyzed by flow cytometry after co-culture with a blank vector control or 10M Nano-CL in pTh17 differentiation medium with or without an additional 10M SAM added, and the results are representative of two independent experiments with three samples in each group (mean ± standard deviation), ***P<0.001, using ANOVA and Bonferroni's multiple comparison test. Detailed implementation mode

[0058] The technical solutions of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0059] Term description

[0060] PBMCs cells: refer to peripheral blood mononuclear cells, which are a population of cells with a single nucleus in peripheral blood, mainly including T cells, B cells, NK cells, monocytes, and dendritic cells.

[0061] CD4 + T cells: Also known as helper T cells (Th), they are a type of T cell with a CD4 protein tag on their surface. CD4 + T cells can be further divided into different subsets according to their functions, such as Th1, Th2, Th17, etc. Among them, Th17 includes pTh17 cells and non-pTh17 cells.

[0062] pTh17 cells: refer to a type of pathogenic Th17 cells that can simultaneously express IL-17A and IFN-γ (denoted as IL-17A + IFN-γ + ).

[0063] non-pTh17 cells: refer to a type of Th17 cells that only express IL-17A and do not express IFN-γ (denoted as IL-17A + IFN-γ - ), that is, non-pathogenic Th17 cells.

[0064] The "proportion of pTh17" described in this article refers to the quantitative ratio of pTh17 in CD4 + T cells, or the quantitative ratio of pTh17 to non-pTh17 cells.

[0065] As mentioned above, the pathogenesis of GD is complex and has not been fully elucidated yet. The existing GD treatment drugs mainly rely on traditional immunosuppressive or immunomodulatory drugs, and these drugs often have problems such as unstable efficacy and easy recurrence when treating GD. Therefore, it is urgent to explore the pathogenesis of GD and find new GD treatment drugs with high and stable efficacy and few side effects.

[0066] To achieve the above purpose, the present invention has conducted a large number of studies and for the first time found in the studies that compared with HC (healthy controls), the number (or proportion) of pTh17 in PBMCs cells of GD patients is significantly increased, and CD4 of GD patients +One-carbon metabolism in T cells is also enhanced. Experiments have demonstrated that adding SAM to mimic the methionine enhancement effect (i.e., enhancing one-carbon metabolism) can promote the transformation of non-pTh17 to pTh17 and increase the number of pTh17; while reprogramming one-carbon metabolism (i.e., inhibiting one-carbon metabolism) by knocking down the Mat2a gene to block the production of SAM metabolism or delivering cyclo-leucine to reduce the concentration of SAM can promote CD4 + T cells to differentiate into non-pTh17 cells and inhibit their differentiation into pTh17 cells, ultimately achieving the purpose of treating GD.

[0067] Based on the above, the present invention first provides the use of one-carbon metabolism inhibitors in the preparation of drugs for treating Graves' disease. Preferably, the one-carbon metabolism inhibitor is a substance that can specifically or non-specifically interfere with, block or regulate key molecules or steps in the one-carbon metabolism signaling pathway.

[0068] In some embodiments, the one-carbon metabolism inhibitor includes at least one of inhibitors of SAM-mediated methylation, SHMT1 inhibitor, SHMT2 inhibitor, MAT2A inhibitor, SAHH inhibitor, and BHMT enhancer.

[0069] As a specific example, the inhibitor of MAT2A is shRNA, and the shRNA includes the sequence shown in SEQ ID NO.1, which can target and knock down the MAT2A gene, resulting in a decrease in MAT2A expression.

[0070] As a specific example, the SAHH inhibitor includes adenosine dialdehyde. Adenosine dialdehyde (AdOx) is a purine nucleoside analog, mainly acting as an inhibitor of S-adenosylhomocysteine hydrolase (SAHH), and its inhibition constant (Ki) is 3.3 nM. SAHH is a key enzyme involved in the metabolism of SAM (S-adenosylmethionine), responsible for hydrolyzing S-adenosylhomocysteine (SAH) into homocysteine and adenosine. Inhibiting the activity of SAHH can increase the level of S-adenosylhomocysteine in cells, thereby indirectly inhibiting the activity of methyltransferases and affecting the methylation processes of DNA, RNA, and proteins.

[0071] As a specific example, the inhibitor of SAM-mediated methylation includes cyclo-leucine. Cyclo-leucine is an inhibitor of SAM-mediated methylation, which can affect gene expression and tumor growth by reducing the SAM concentration and influencing DNA methylation.

[0072] Based on the foregoing, the present invention further provides a method for preparing a nano-carrier loaded with cyclo-leucine, and the method includes:

[0073] Step S1, weigh amphiphilic cPHRS and cyclo-L-leucine and place them in a dimethylformamide solvent, and completely dissolve them by ultrasonic treatment;

[0074] Step S2, under stirring, dropwise add the mixed solution obtained in Step S1 into distilled water, and continue stirring at 20°C to 25°C for 12 hours;

[0075] Step S3, dialyze the solution obtained in Step S2 at 4°C for 24 hours, and then perform freeze-drying treatment to obtain the nano-carrier loaded with cyclo-L-leucine.

[0076] Preferably, the mass ratio of cPHRS to cyclo-L-leucine is 3:1 to 5:1.

[0077] On the other hand, the present invention also provides a nano-carrier loaded with cyclo-L-leucine, and the nano-carrier is prepared by the foregoing preparation method.

[0078] Next, the process and results of the research of the present invention will be described in detail in combination with experimental data:

[0079] Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt the conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related fields in the technical field.

[0080] The experimental methods used in the following examples are all carried out according to the conventional conditions or the conditions recommended by the manufacturer, unless otherwise specified.

[0081] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. Among them, Mal-PEG-Hz was purchased from Shanghai Yalebio Co., Ltd.; KR6C (KRRRRRRC), cRGD cyclic peptide and O-benzotriazole-N,N′,N′-tetramethyluronium hexafluorophosphate (HATU) were purchased from GL Biochem (Shanghai) Co., Ltd.; N-BOC-2-maleimidodiethylamine (BOC-Mal) was purchased from HEOWNS Biochem (Tianjin) Co., Ltd. (China); stearic acid (SA), 5-formyl-2,4-dimethyl-1H-pyrrole-3-carboxylic acid (FDHPCA), trifluoroacetic acid (TFA), N,N-diisopropylethylamine (DIPEA), N,N-dimethylformamide (DMF) and anhydrous methanol were purchased from Shanghai Macklin Biochemical Co., Ltd. (China).

[0082] Investigation of the pathogenesis of GD in Example 1 and result analysis

[0083] As described above, the pathogenesis of GD is complex and has not been fully elucidated. One of the generally recognized pathogenesis of GD is abnormal immune factors. However, the exact mechanism driving GD autoimmunity remains poorly understood. To explore the exact mechanism driving GD autoimmunity, the present invention conducted the following exploration and analysis:

[0084] 1. The increase in the number of pTh17 in GD patients leads to an imbalance in the ratio of pTh17 to non-pTh17

[0085] The present invention first isolated and collected PBMCs cells from HC population (i.e., healthy controls) and GD patients (20 cases each). After purification by Ficoll, the cells were treated with 750 ng / mL ionomycin, 50 ng / mL phorbol ester, and GolgiPlug at 37 °C for 4 - 6 hours, and then fixed and permeabilized with the staining buffer set from eBioscience or BD Cytofix / Cytoperm, and stained with fluorescent antibodies. After washing, the expression levels of IL-17A and IFN-γ in the cells were detected using the FACSCanto II flow cytometer from BD Biosciences. The results showed that compared with HC, the proportion of pTh17 in GD patients was significantly increased ( Figure 1 A and B of Figure 1 ), while the proportion of non-pTh17 showed no significant difference ( Figure 1 C of

[0086] ), and the ratio of pTh17 to non-pTh17 in PBMCs of GD patients was significantly higher than that in the HC population ( Figure 1 D of + ). Figure 1 In addition, enzyme-linked immunosorbent assay, real-time fluorescence quantitative PCR and other detection methods were used to detect the concentrations or expression levels of IL-17A, IFN-γ and related transcription factors in the culture supernatants of PBMCs from GD patients and HC population. The results showed that compared with the HC population, the levels of IL-17A, IFN-γ and related transcription factors in the sera of GD patients were all significantly increased (

[0087] Figure 1 E - G of + ). Confocal microscopy further confirmed the increased level of IFN-γ in IL-17A + PBMCs of GD patients ( Figure 1 H of

[0087]

[0087] Figure 1 ), that is, the number of pTh17 in PBMCs of GD patients increased.

[0087] Therefore, based on the above findings, the present invention further performed a correlation analysis between the clinical characteristics of GD and the ratio of pTh17 / non-pTh17. The concentrations of FT3, FT4, TT3, TT4, TRAb, and TPO-Ab in the sera of 20 GD patients were detected by radioimmunoassay and chemiluminescence method. Fisher's exact test was used to analyze the relationship between the ratio of pTh17 / non-pTh17 (classified according to equal quantity) and the concentrations of FT3 (critical value: 1.46 nmol / L), FT4 (critical value: 22.5 nmol / L), TT3 (critical value: 2.926 nmol / L), TT4 (critical value: 167.31 nmol / L), TRAb (critical value: 1.75 IU / L), and TPO-Ab (critical value: 34 IU / L). The results are as Figure 2 shown that the ratio of pTh17 / non-pTh17 is closely related to multiple thyroid function indexes, including the levels of FT3, FT4, TT3, TT4, TRAb, and TPO-Ab.

[0088] 2. Enhanced one-carbon metabolism in CD4 + T cells of GD patients

[0089] Meanwhile, the present invention also isolated total RNA from CD4 + T cells of 4 GD patients and 4 healthy controls (HC) using RNeasy MiniKit (Qiagen), and analyzed the differentially expressed genes ([[]] Figure 3 A) between GD patients and HC through DEGs; further performed principal component analysis on the samples, and it can be seen that different samples can be clearly divided into two groups ([[]] Figure 3 B); and performed gene ontology enrichment analysis on the differentially expressed genes using the genecloud platform ([[]] Figure 3 C). The results showed that CD4 + T cells of GD patients have unique gene characteristics, among which cytokine-mediated signaling pathways, especially the IFN-γ signaling pathway, are significantly enriched, and the one-carbon metabolism signaling pathway is also highly enriched in CD4 + T cells of GD patients.

[0090] It should be noted that the one-carbon metabolism cycle pathway (i.e., the one-carbon metabolism signaling pathway) is as Figure 3 shown in Figure D of this pathway. This pathway mainly supports the differentiation and function of T cells by providing intermediate products necessary for nucleotide synthesis, methylation reactions, and redox balance. This pathway integrates the folate and methionine cycles and produces metabolites such as S-adenosylmethionine (SAM), which are crucial for DNA, RNA, and histone methylation, thus regulating gene expression during T cell differentiation.

[0091] Based on the above research, PBMCs cells of 6 samples each from GD patients and HC were further extracted in the present invention, and the relative abundances of proteins involved in the one-carbon metabolic pathway in the cells were detected. The results showed that, compared with HC, the ratio of SAM to S-adenosylhomocysteine (SAH) in the cells of GD patients increased significantly ( Figure 3 of E); the expressions of serine hydroxymethyltransferase 1 (SHMT1), serine hydroxymethyltransferase 2 (SHMT2), betaine-homocysteine methyltransferase (BHMT), 5-methyltetrahydrofolate-homocysteine methyltransferase (MTR), and methionine adenosyltransferase 2A (MAT2A) in PBMCs of HC and GD patients were also analyzed by real-time fluorescence quantitative polymerase chain reaction. The results showed that, compared with HC, the expressions of key regulators SHMT1, SHMT2, MTR, and MAT2A that promoted one-carbon metabolism were up-regulated in the cells of GD patients, while the expression of the negative regulator BHMT was down-regulated ( Figure 3 of F and G).

[0092] 3. Adding SAM to simulate the methionine enhancement effect can promote the transformation of non-pTh17 to pTh17

[0093] According to the above research results, the present invention speculated that the enhancement of one-carbon metabolism promoted the differentiation and formation of pTh17, promoted the transformation of non-pTh17 to pTh17, and ultimately led to the occurrence and development of GD. To verify this conjecture, the following experiments were carried out in the present invention. By adding SAM to simulate the methionine enhancement effect, the influence on the differentiation of pTh17 / non-pTh17 was evaluated:

[0094] Naive CD4 was isolated from PBMCs of healthy controls (HC) +T cells and differentiated in polarization medium for 3 days, then divided into two groups and given culture conditions that contribute to differentiation into non-pTh17 or pTh17. For the non-pTh17 differentiation group, the cells were cultured in a medium containing 2 μg / mL plate-bound anti-human CD3 (OKT3, eBioscience, 16-0037-81), 2 μg / mL anti-human CD28 (CD28.2, eBioscience, 16-0289-81), 10 ng / mL IL-6 (eBioscience, 200-06-1MG), 10 ng / mL TGF-β (eBioscience, PHG9202), and 10 μM SAM; for the pTh17 cell differentiation group, the cells were cultured under conditions containing 2 μg / mL plate-bound anti-human CD3 (OKT3, eBioscience, 16-0037-81), 2 μg / mL anti-human CD28 (CD28.2, eBioscience, 16-0289-81), 20 ng / mL IL-6 (eBioscience, 200-06-1MG), 10 ng / mL IL-1β (eBioscience, 200-01B-50UG), 10 ng / mL IL-23 (eBioscience, 200-23-1MG), and 10 μM SAM. It should be noted that control groups without SAM addition were included in both groups.

[0095] After the culture was completed, the expressions of IL-17A and IFN-γ were analyzed by flow cytometry. It was found that under the pTh17 culture conditions with SAM addition, SAM could significantly increase the + IFN-γ + proportion of pTh17 and decrease the + IFN-γ - proportion of non-pTh17 ( Figure 4 A-C), however, in the non-pTh17 differentiation medium, SAM treatment had no significant effect on the cell proportion ( Figure 4 D-E).

[0096] In addition, the expression levels of pTh17-related cytokines and transcription factors in cells under the pTh17 culture conditions with SAM addition were also determined by methods such as real-time fluorescence quantitative PCR and enzyme-linked immunosorbent assay. The results showed that compared with the pTh17 culture control group (NC) without SAM addition, SAM significantly increased the expression levels of pTh17-related cytokines and transcription factors ( Figure 4 F-G), as well as the activities of the key transcription factors T-bet and STAT3 ( Figure 4 H).

[0097] From the above results, it can be seen that the present invention discovers that by adding SAM to simulate the methionine enhancement effect, that is, enhancing one-carbon metabolism, it can promote the transformation of non-pTh17 to pTh17, resulting in an imbalance in the ratio of pTh17 to non-pTh17, and ultimately leading to the occurrence and development of GD. Based on this discovery, the present invention subsequently conducted research experiments on the effect of reprogramming one-carbon metabolism on pTh17 differentiation.

[0098] Example 2 Knocking down the Mat2a gene can inhibit the differentiation of CD4 + T cells into pTh17 by blocking one-carbon metabolism

[0099] Based on the above results of adding SAM to enhance one-carbon metabolism and thus promoting pTh17 differentiation, and according to the upstream signaling pathway of SAM in the one-carbon metabolism pathway ( Figure 3 D), in this example, the shMat2a plasmid was used to knock down the Mat2a gene in cells to block the production of SAM metabolism, thereby blocking the one-carbon metabolism pathway, and evaluating the effect of this method on pTh17 differentiation.

[0100] Naive CD4 + T cells were isolated from the PBMCs of healthy controls (HC), and the control plasmid (shCtrl) or shMat2a plasmid was transfected into naive CD4 + T cells using the Mouse T Cell Nucleofector Kit (Amaxa) by nucleofection (program X-01; Amaxa). The transfected cells were activated or cultured in pTh17 differentiation medium 3 hours after nucleofection. Among them, the sequences of shMat2a and shCtrl were synthesized by Generay and cloned into the pLKO.1 vector. The hairpin sequence of shMat2a is: TAACCCGACTTGCCCTCGCTCGAGGTGCTAAGTGGCAACC TTAGGGAG (SEQ ID NO.1); the hairpin sequence of shCtrl is: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG (SEQ IDNO.2).

[0101] After the culture was completed, the expressions of IL-17A and IFN-γ were analyzed by flow cytometry, and the concentration of IL-17A in the culture supernatant was detected by enzyme-linked immunosorbent assay. The results showed that after knocking down the Mat2a gene with the shMat2a plasmid in this example, the proportion of IL-17A + IFN-γ + pTh17 cells ( Figure 5 A - B) and the transcript of IL-17A (Figure 5 of C).

[0102] After collecting the cells after the transfection culture and extracting RNA, sequencing was performed, and gene ontology enrichment analysis and volcano plot analysis were carried out on the differentially expressed genes. The results showed that multiple pathways related to cytokine production, immune response, and cytokine response were significantly enriched after knocking down Mat2a ( Figure 5 of D). Moreover, knocking down Mat2a also led to the downregulation of pathogenic cytokines such as IL-23, IL-17A, and T-bet, and the upregulation of inhibitory cytokines ( Figure 5 of E). These changes were further confirmed by real-time fluorescence quantitative PCR reaction ( Figure 5 of F).

[0103] In addition, anti-H3K4me3 or IgG was immunoprecipitated from the cells after the transfection culture. The amount of methylated histone (H3K4me3) bound to Blimp-1 was detected by real-time fluorescence quantitative PCR from the immunoprecipitate, using Rp130 as an internal reference. It was found that the inhibition of Mat2a reduced the level of methylated histone on the Blimp-1 promoter ( Figure 5 of G), which is a key mechanism for regulating pTh17 by transcriptional inhibition of IFN-γ. Western blot analysis further supported these findings, showing that the disruption of one-carbon metabolism reduced the expression of IFN-γ and promoted the expression of Blimp-1 ( Figure 5 of H and I).

[0104] The above results indicate that in this example, knocking down the Mat2a gene with the shMat2a plasmid can block the one-carbon metabolic pathway, thereby promoting the differentiation of CD4 + T cells into non-pTh17 cells and inhibiting their differentiation into pTh17 cells, ultimately achieving the purpose of treating GD.

[0105] Example 3 Nano-cycloleucine inhibits the differentiation of CD4 + T cells into pTh17 by reprogramming one-carbon metabolism

[0106] In this example, a pH-sensitive nuclear-targeted nanocarrier was constructed to deliver cycloleucine into the nucleus of CD4 + T cells to evaluate the effect of this method on pTh17 differentiation.

[0107] Preparation of Nano-Cycloleucine Carrier (Nano-CL): Weigh 8 mg of freeze-dried amphiphilic cPHRS and cycloleucine (CL, purchased from sigma, A48105), and completely dissolve them in 1 mL of dimethylformamide (DMF) under sonication. Subsequently, while continuously and vigorously stirring, add the dissolved DMF solution dropwise to 15 mL of distilled water, and continue stirring at 20 °C - 25 °C for 12 hours. Then, dialyze the distilled water at 4 °C for 24 hours to completely remove the organic solvent. After that, freeze-dry the amphiphilic cPHRS nanocarrier loaded with cycloleucine to complete the preparation.

[0108] It should be noted that the cPHRS is a cRGD-PEG-Hyd-R6-SA polymer, and the preparation method refers to the reference document "Nuclear-targeted nanocarriers based on pH-sensitive amphiphiles for enhancedGNA002 delivery and chemotherapy", which is as follows:

[0109] (1) Synthesis of Boc-R6-SA: Dissolve N-BOC-2-aminoethyl maleimide (Boc-Mal) (0.1823 g, 0.75 mmol) and KR6C (KRRRRRRC, an 8-peptide, K represents lysine, R represents arginine, C represents cysteine) (0.3 g, 0.25 mmol) in 12 mL of N,N-dimethylformamide (DMF), and react at 20 - 25 °C for 8 hours to obtain mixed solution 1. Dissolve stearic acid (SA, 0.284 g, 1 mmol), O-benzotriazole-N,N′,N′-tetramethyluronium hexafluorophosphate (HATU, 0.38 g, 1 mmol) and N,N-diisopropylethylamine (DIPEA, 0.330 mL, 2 mmol) in 12 mL of DMF, and react at 20 - 25 °C for 0.5 hours under nitrogen to obtain mixed solution 2. Then, add mixed solution 1 dropwise to mixed solution 2, and stir and react at 20 - 25 °C for 0.5 hours under nitrogen. Subsequently, use a dialysis tube (MWCO 1000 Da) to dialyze the reactants with deionized water for 2 days, and obtain Boc-R6-SA after freeze-drying.

[0110] (2) NH 2Synthesis of -R6-SA: The synthesized Boc-R6-SA was dissolved in 5 mL of dichloromethane, and 5 mL of trifluoroacetic acid (TFA) was added dropwise to the solution in an ice bath. Then, the resulting mixed solution was reacted at 30 °C for 1 hour and then rotary evaporated at 30 °C to concentrate the mixture into a viscous solution. After precipitation in cold diethyl ether, the crude product (NH 2 -R6-SA) was collected and dried under vacuum.

[0111] (3) Synthesis of CHO-R6-SA: 5-Formyl-2,4-dimethyl-1H-pyrrole-3-carboxylic acid (FDHPCA, 0.1253 g, 0.75 mmol), HATU (0.285 g, 0.75 mol), and DIPEA (0.247 ml, 1.5 mmol) were dissolved in 12 ml of DMF and reacted at 20 - 25 °C for 0.5 hour under a nitrogen atmosphere. Then, the synthesized NH 2 -R6-SA (previously dissolved in 12 mL of DMF in an ice bath) was added dropwise. Under a nitrogen atmosphere, the resulting mixed solution was stirred at 20 - 25 °C for 0.5 hour. Then, the reactant was dialyzed against DMF for 1 day using a dialysis tube (MWCO 1000 Da), and then dialyzed against deionized water for 1 day using the same dialysis tube. Finally, CHO-R6-SA was obtained after lyophilization.

[0112] (4) Synthesis of cRGD-PEG-Hz: The cRGD cyclic peptide (cyclo(Arg-Gly-Asp-DTyr-Cys)) (0.297 g, 0.5 mmol) and Mal-PEG-Hz (maleimide-polyethylene glycol-hydrazide, 1 g, 0.5 mmol) were dissolved in 12 mL of distilled water and reacted at 20 - 25 °C for 12 hours. Subsequently, the mixture was dialyzed against deionized water for 2 days using a dialysis tube (MWCO 1000 Da). Finally, cRGD-PEG-Hz was collected by lyophilization.

[0113] (5) Synthesis of cPHRS: cRGD-PEG-Hz (0.9728 g, 0.375 mmol) and the synthesized CHO-R6-SA (0.5015 g, 0.25 mmol) were dissolved in 18 mL of anhydrous methanol. Then, the mixture was reacted at 28 °C for 48 hours. Subsequently, the mixture was dialyzed against deionized water for 2 days using a dialysis tube (MWCO 3000 Da). Finally, cPHRS was obtained after lyophilization.

[0114] CD4 + T cells were isolated from the peripheral blood mononuclear cells of GD patients and then cultured in pTh17 differentiation medium supplemented with 10 M nano-cycloleucine carrier (Nano-CL), with a blank nano-carrier included as a control.

[0115] After the culture was completed, DAPI fluorescent dye was added for nuclear staining, and the distribution of Nano-CL was observed by fluorescence microscopy (DAPI fluorescent dye was used for nuclear staining, and Cy3 fluorescent dye was used to label Nano-CL). The results showed that the Nano-CL prepared in this example could rapidly release the drug in an acidic environment (pH 5.0) and successfully deliver cyclo-leucine to the nucleus of CD4 + T cells ( Figure 6 A-B). Further, the expression levels of pathogenic transcription factors and related cytokines in the two groups of cells were measured by real-time fluorescence quantitative PCR and enzyme-linked immunosorbent assay. The results showed that after co-culture with Nano-CL, the expression levels of pathogenic transcription factors ( Figure 6 C) and related cytokines ( Figure 6 D) could be effectively reduced, thereby inhibiting the differentiation of CD4 + T cells into pTh17 cells, and the inhibitory effect was dose-dependent ( Figure 6 E and F), and this inhibitory effect could be reversed by supplementing SAM ( Figure 6 G and H).

[0116] The above results indicated that the nano-cyclo-leucine carrier (Nano-CL) prepared in this example delivered cyclo-leucine into CD4 + T cells, which could reprogram the one-carbon metabolism in the cells, and then promoted the differentiation of CD4 + T cells into non-pTh17 cells and inhibited their differentiation into pTh17 cells, ultimately achieving the purpose of treating GD.

[0117] In summary, the present invention first found through experiments that compared with HC (healthy control), the number (or proportion) of pTh17 in PBMCs cells of GD patients was significantly increased, and the one-carbon metabolism in CD4 + T cells of GD patients was also enhanced. Subsequently, experiments proved that adding SAM to simulate the methionine enhancement effect (i.e., enhancing one-carbon metabolism) could promote the transformation of non-pTh17 to pTh17 and increase the number of pTh17; while reprogramming one-carbon metabolism (i.e., inhibiting one-carbon metabolism) by knocking down the Mat2a gene to block the production of SAM metabolism or delivering cyclo-leucine to reduce the concentration of SAM could promote the differentiation of CD4 + T cells into non-pTh17 cells and inhibit their differentiation into pTh17 cells, ultimately achieving the purpose of treating GD.

[0118] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be recognized that the above description should not be construed as a limitation of the present invention. After those skilled in the art have read the above content, various modifications and alternatives to the present invention will be obvious. Therefore, the protection scope of the present invention shall be defined by the appended claims.

Claims

1. Application of one-carbon metabolism inhibitors in the preparation of drugs for the treatment of toxic diffuse goiter.

2. The use according to claim 1, characterized in that The one-carbon metabolism inhibitor is a substance that can specifically or non-specifically interfere with, block or regulate key molecules or steps in the one-carbon metabolism signal pathway.

3. The use according to claim 2, characterized in that The one-carbon metabolism inhibitor includes at least one of a SAM-mediated methylation inhibitor, a SHMT1 inhibitor, a SHMT2 inhibitor, a MAT2A inhibitor, a SAHH inhibitor and a BHMT enhancer.

4. The use according to claim 3, characterized in that The MAT2A inhibitor is shRNA, and the shRNA includes the sequence shown in SEQ ID NO.

1.

5. The use according to claim 3, characterized in that The SAHH inhibitors include adenosine dialdehyde.

6. The use according to claim 3, characterized in that Such inhibitors of SAM-mediated methylation include cycloleucine.

7. The use according to any one of claims 1 to 6, characterized in that The one-carbon metabolism inhibitor reprograms CD4 + One-carbon metabolism signaling pathway in T cells, thereby promoting CD4 + T cells differentiate into non-pTh17 cells and inhibit their differentiation into pTh17 cells, ultimately achieving the goal of treating toxic diffuse goiter.

8. A method for preparing a nanocarrier loaded with cycloleucine, characterized in that: The method comprises: Step S1, weighing amphiphilic cPHRS and cycloleucine, placing them in a dimethylformamide solvent, and completely dissolving them by ultrasound; Step S2, under stirring, adding the mixed solution obtained in step S1 dropwise into distilled water, and continuing stirring at 20° C. to 25° C. for 12 hours; Step S3, dialyzing the solution obtained in step S2 at 4° C. for 24 hours, and then freeze-drying the solution to obtain the nanocarrier loaded with cycloleucine.

9. The preparation method according to claim 8, characterized in that: The mass ratio of cPHRS to cycloleucine is 3:1 to 5:

1.

10. A nanocarrier loaded with cycloleucine, characterized in that: The nanocarrier is prepared by the preparation method according to claim 8 or 9.

Images