Monoclonal Antibody Against Rift Valley Fever Virus Gn Protein and Its Application in Virus Detection

The use of monoclonal antibodies A1 and C1 through the dual-anti-sandwich ELISA method solves the simplicity and specificity of early diagnosis of rift valley fever virus, and realizes high-sensitivity Gn antigen detection of rift valley fever virus, which is suitable for the rapid diagnosis of rift valley fever virus infection.

CN120058919BActive Publication Date: 2025-07-18ZJU HANGZHOU GLOBAL SCI & TECH INNOVATION CENT +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510556661.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-07-18
Estimated Expiration
2045-04-29

AI Technical Summary

Technical Problem

The prior art is difficult to achieve rapid, simple and high specific early diagnosis of rift valley fever virus infection, especially the lack of commercial detection methods using anti-Gn monoclonal antibodies.

Method used

The dual-anti-sandwich ELISA method was used to specifically bind the rift valley heat virus Gn antigen using the high binding activity of human IgG1 subclass monoclonal antibodies A1 and C1. The monoclonal antibodies were obtained by screening through flow sorting-single-cell PCR technology, and diagnosis was performed by Western Blotting or ELISA detection.

Benefits of technology

The specific detection of Rift Valley fever virus Gn antigen is achieved, with a sensitivity of up to 781 pg/mL, low cost, no animal feeding and ascites extraction, and is suitable for early diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120058919B_ABST
    Figure CN120058919B_ABST
Patent Text Reader

Abstract

The present invention discloses monoclonal antibodies against the Gn protein of Rift Valley fever virus and their application in virus detection. By using monoclonal antibodies A1 and C1 to construct a double-antibody sandwich ELISA assay, it can specifically detect the Gn antigen of Rift Valley fever virus, and there is no cross-reaction with the Gn antigens of other Bunyaviridae viruses such as severe fever with thrombocytopenia syndrome virus. The sequences of the monoclonal antibodies are clear, and the monoclonal antibodies used can be prepared by large-scale culture, with high sensitivity and a detection limit of 781 pg / mL.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a monoclonal antibody against Rift Valley fever virus Gn protein and its application in virus detection. Background Art

[0002] Rift Valley fever is a zoonotic mosquito-borne infectious disease. Clinically, Rift Valley fever is manifested as fever, headache and muscle and joint pain. Severe cases can involve multiple organs and have a high fatality rate. Currently, there are no marketed human vaccines and specific therapeutic drugs.

[0003] The pathogen of Rift Valley fever is Rift Valley fever virus (RVFV). The RVFV genome is a single-stranded negative-sense RNA virus, which consists of three segments, namely L, M, and S. The L segment encodes RNA polymerase. The M segment encodes envelope glycoproteins Gn and Gc. Gn is mainly responsible for the binding of the virus to host cells, while Gc plays a key role in membrane fusion. After the virus enters the body, it first replicates in the invaded local tissues, transfers to local lymph nodes through the lymphatic system for further replication, and then enters the bloodstream to form viremia, which generally lasts for 4-7 days. Subsequently, symptoms of infection and intoxication such as fever may occur, and focal infections of multiple organs can be caused.

[0004] Currently, the laboratory diagnostic methods for virus infection mainly include virus isolation, nucleic acid detection, antigen detection, serological detection, etc. Among them, virus isolation is the gold standard for the diagnosis of virus infection, but this method requires high laboratory conditions and a long cultivation time. Although the virus nucleic acid detection method is more sensitive and rapid than the traditional virus isolation and culture method, it has high requirements for equipment and personnel. Serum IgM detection starts to appear 5-6 days after virus infection, and IgG appears 14 days after virus infection, so rapid detection cannot be achieved. It is imperative to establish a simple and easy-to-implement diagnostic reagent that can specifically detect early Rift Valley fever virus infection, which is of significance for the rapid detection of suspected infected populations.

[0005] The Gn protein of Rift Valley fever virus is a relatively conserved envelope glycoprotein, which is mainly highly expressed in infected cells, has strong antigenicity, and exists in the early peripheral blood of virus-infected patients or animals. Therefore, detecting Gn antigen in the serum of acute-phase patients can be used for the early diagnosis of Rift Valley fever virus infection.

[0006] The Gn protein of Rift Valley fever virus is encoded by the M gene of Rift Valley fever virus and mediates the receptor recognition process of the virus. The Gn protein is a type I transmembrane protein and is anchored to the membrane surface of the virus particle through a helical structure at the C-terminus. The extracellular region of the Gn protein can be divided into a head region (154-469 aa) and a stem region (470-582 aa). Research reports show that the neutralizing epitopes of the Gn protein are mainly concentrated in the head region, and the head region consists of three regions, namely domain I, domain II, and domain III. Currently, the main binding regions of known Rift Valley fever virus neutralizing antibodies are domain I and domain III.

[0007] The methods for detecting the virus by antigen capture ELISA can be divided into two categories. One category uses polyclonal antibodies as capture antibodies or detection antibodies. There are significant differences in such methods among different batches of antiserum, making it difficult to repeat and achieve laboratory standardization. The other category uses monoclonal antibodies to detect the virus. Currently, there is no commercial kit for detecting Rift Valley fever virus using monoclonal antibodies against Gn.

[0008] The invention application with the publication number CN114409770A discloses a human monoclonal antibody against Rift Valley fever virus and its application, which discloses 8 human monoclonal antibodies that can effectively treat mice infected with RVFV and prevent the infection of mice by RVFV. However, when used for treatment, it is not disclosed that it can be used for ELISA detection. Summary of the Invention

[0009] The present invention provides a double-antibody sandwich ELISA method for detecting Rift Valley fever virus Gn antigen based on two highly binding monoclonal antibodies A1 and C1. In the kit of the present invention, monoclonal antibody A1 and monoclonal antibody C1 are both immunoglobulins of the human IgG1 subclass, and both monoclonal antibodies can specifically bind to Rift Valley fever virus Gn antigen. The monoclonal antibodies are obtained by immunizing rhesus monkeys with an adenovirus vector Rift Valley fever candidate vaccine and recombinant Gn antigen, screening for the variable region genes of highly binding monoclonal antibodies from peripheral blood using flow sorting-single cell PCR technology, and obtaining two recombinant monoclonal antibodies A1 and C1 of the human IgG1 subclass through genetic engineering technology.

[0010] The present invention first provides monoclonal antibodies against the Gn protein of Rift Valley fever virus, which are monoclonal antibody A1 and / or monoclonal antibody C1.

[0011] Among them, the amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody A1 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-115 of the sequence shown in SEQ ID NO:1; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-37, 55-57, and 94-102 of the sequence shown in SEQ ID NO:2;

[0012] The amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody C1 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-101 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-38, 56-58, and 95-103 of the sequence shown in SEQ ID NO:4.

[0013] Among them, monoclonal antibody A1 and / or monoclonal antibody C1 represent one or a combination of both of monoclonal antibody A1 and monoclonal antibody C1.

[0014] Preferably, the amino acid sequence of the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:1, and the amino acid sequence of the light chain is shown in SEQ ID NO:2.

[0015] Preferably, the amino acid sequence of the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:4.

[0016] The present invention also provides a coding gene encoding the monoclonal antibody against the Gn protein of Rift Valley fever virus. The gene sequence encoding the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody A1 is shown in SEQ ID NO:6;

[0017] The gene sequence encoding the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody C1 is shown in SEQ ID NO:8.

[0018] The present invention also provides the application of the monoclonal antibody against the Gn protein of Rift Valley fever virus in the preparation of a detection kit for detecting Rift Valley fever virus Gn antigen.

[0019] The present invention also provides a detection kit for detecting Rift Valley fever virus Gn antigen, which includes the monoclonal antibody against Rift Valley fever virus Gn protein. When the monoclonal antibody is one of monoclonal antibody A1 or monoclonal antibody C1, detection methods such as Western Blotting can be directly used for detection, or an additional secondary antibody that specifically binds to the constant region of the antibody can be used for detection methods such as ELISA. When the monoclonal antibody is a combination of monoclonal antibody A1 and monoclonal antibody C1, a double antibody sandwich ELISA detection method can be used for detection.

[0020] Preferably, the detection kit is a double antibody sandwich ELISA detection kit, wherein the monoclonal antibody is monoclonal antibody A1 and monoclonal antibody C1, and one of monoclonal antibody A1 and monoclonal antibody C1 serves as the capture antibody and the other serves as the detection antibody, and the detection antibody is labeled.

[0021] The capture antibody is used to bind to the antigen to capture the antigen to be detected; the detection antibody is used to bind to the antigen again after the antigen is captured by the captured antigen and is used for detection by means such as color development or fluorescence. It can be that monoclonal antibody A1 serves as the capture antibody and monoclonal antibody C1 serves as the detection antibody, or vice versa, monoclonal antibody A1 serves as the detection antibody and monoclonal antibody C1 serves as the capture antibody.

[0022] Preferably, the label used to label the monoclonal antibody in the detection antibody is peroxidase, phosphatase or luciferase.

[0023] More preferably, the peroxidase is horseradish peroxidase.

[0024] The present invention also provides the application of the detection kit in detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes.

[0025] The present invention also provides a double antibody sandwich ELISA detection method for detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes, using the detection kit, and the double antibody sandwich ELISA detection method includes the following steps:

[0026] S1, coating an enzyme-labeled plate with the capture antibody;

[0027] S2, performing blocking with a blocking solution;

[0028] S3, discarding the blocking solution, washing with a buffer solution, then adding the sample to be detected, and incubating;

[0029] S4, washing with a buffer solution, then adding the detection antibody, and incubating;

[0030] S5, developing color and detecting.

[0031] Preferably, the double antibody sandwich ELISA detection method includes the following steps:

[0032] (1)Coating: Monoclonal antibody A1 was diluted to 2 μg / mL with coating buffer and coated on the enzyme-linked immunosorbent assay (ELISA) plate at 100 μL / well and incubated overnight at 4°C;

[0033] (2)Blocking: The plate was washed 4 times with PBST, and 5% skim milk powder prepared with PBS was added at 100 μL / well and blocked at 37°C for 2 h;

[0034] (3)Sample addition: The blocking solution was discarded, the plate was washed 4 times with PBST, and the test sample was added and incubated at 37°C for 60 min;

[0035] (4)Addition of enzyme-labeled antibody: The plate was washed 4 times with PBST, and horseradish peroxidase-labeled monoclonal antibody C1 (0.5 μg / mL) diluted with 1% BSA was added at 100 μL / well and reacted at 37°C for 60 min;

[0036] (5)Color development: The plate was washed 4 times with PBST, and single-component TMB color development solution was added at 100 μL / well and developed at 37°C in the dark for 10 min;

[0037] (6)Termination: 2 M H2SO4 was added to terminate the reaction at 50 μL / well;

[0038] (7)Reading: The OD was measured with an ELISA reader 450-630nm .

[0039] Result determination criterion: The ratio of the OD 450-630nm (S) of the test sample and the OD 450-630nm (N) of the negative control was used as the criterion for determining positivity. When S / N ≥ 2.1, it was determined to be positive, that is, the test sample contained Rift Valley fever virus; otherwise, it was determined to be negative, that is, the test sample did not contain Rift Valley fever virus.

[0040] The capture antibody A1 and the detection antibody C1 described in the present invention were screened from a group of monoclonal antibodies against the Gn protein of Rift Valley fever virus, which could specifically bind to Rift Valley fever virus, had no cross-reaction with other viruses of the Bunyaviridae family such as severe fever with thrombocytopenia syndrome virus, and had a high sensitivity to Rift Valley fever virus, which was beneficial to the early diagnosis of Rift Valley fever virus. At the same time, the monoclonal antibody sequence in this method was clear and could be obtained by large-scale fermentation, without the need for animal breeding and ascites extraction processes, and the cost was low.

[0041] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0042] The present invention provides a double-antibody sandwich ELISA detection kit for detecting Rift Valley fever virus Gn antigen. When using this kit for double-antibody sandwich ELISA detection, it can specifically detect Rift Valley fever virus Gn antigen, has no cross-reaction with Gn antigens of other Bunyaviridae viruses such as severe fever with thrombocytopenia syndrome virus. The monoclonal antibody sequences are clear, and the used monoclonal antibodies can be cultured and prepared on a large scale. It has high sensitivity and a detection limit of 781 pg / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 It is the SDS-PAGE result of truncated RVFV-Gn protein.

[0044] Figure 2 It is the SDS-PAGE result of RVFV-Gn specific binding antibodies A1 and C1.

[0045] Figure 3 It is the ELISA result curve (EC 50 assay) of A1 and C1 for specific binding activity to RVFV-Gn.

[0046] Figure 4 It is the ELISA result curve of A1-C1 antibody pair for detecting RVFV-Gn protein.

[0047] Figure 5 It is the ELISA binding diagram of two monoclonal antibodies with recombinant Rift Valley fever virus Gn antigen (RVFV-Gn) and severe fever with thrombocytopenia syndrome virus Gn antigen (SFTSV-Gn) respectively.

[0048] Figure 6 It is the detection standard curve at the optimal concentrations of two antibodies in the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0049] Example 1: Obtaining truncated RVFV-Gn protein

[0050] In this study, the head region (154-469aa) of Gn protein was intercepted for eukaryotic expression and purification, which laid the foundation for subsequent booster immunization of rhesus monkeys, sorting of Gn protein-specific memory B cells, and screening of Gn protein-binding antibodies.

[0051] The open reading frame (MORF) corresponding to the M gene of Rift Valley fever virus MP-12 strain (GenBank: DQ380208.1) was codon-synthesized by Shanghai Sangon Biotech Co., Ltd. Primers were designed based on this template to amplify the gene of truncated Gn protein. At the same time, the tPA signal peptide (ATGGACGCCATGAAGCGGGGCCTCTGCTGTGTTCTGCTGCTCTGCGGCGCCGTGTTCGTGAGTAACTCG) and Strep II tag (TTACTTTTCGAACTGCGGGTGGCTCCAGGCAGATCCTCCAGATCCTCCTCCAGATCCTCCTCCCTTTTCGAACTGCGGGTGGCTCCAAGCGGA) were added to the N-terminus and C-terminus of the truncated Gn protein respectively by PCR. Restriction enzyme cleavage sites Eco R I and Not I and the homologous arms of pCAGGs vector were added to both ends of the upstream and downstream primers. Then, the target gene was ligated to the linear pCAGGs vector digested with double enzymes ( Eco R I and Not I) by homologous recombination method. After obtaining the recombinant plasmid containing the truncated Gn protein, it was transfected into Expi293F cells, and the truncated Gn protein was purified using an affinity chromatography column (Strep Trap XT). Its expression and purity were identified by SDS-PAGE. The purified Gn protein was as Figure 1 shown, with a size of about 40 kDa.

[0052] Example 2: Obtaining monoclonal antibodies against RVFV-Gn protein

[0053] Obtaining RVFV-Gn binding monoclonal antibodies: First, a recombinant human adenovirus type 4 expressing RVFV-Gn protein was constructed. The specific method was as follows: The open reading frame (MORF) of the M gene of Rift Valley fever virus MP-12 strain (GenBank: DQ380208.1) synthesized after codon optimization was cloned into plasmid pUC57 to obtain pUC57-opMORF. Based on this template, restriction enzyme cleavage site Swa I and the homologous arms of pAd4 vector were added to both ends of the target gene by PCR. Then, the plasmid pAd4 digested with restriction endonuclease Swa I was homologously recombined with the target gene to obtain a recombinant human adenovirus type 4 expressing Rift Valley fever virus Gn protein.

[0054] The rhesus monkeys were immunized twice with the purified truncated Gn protein. The immunization protocol was as follows: At the first immunization, 1×10 8Recombinant human adenovirus type 4 expressing the Gn protein of Rift Valley fever virus was used to immunize rhesus monkeys by intramuscular injection; the rhesus monkeys were immunized again in the same manner and at the same dose on the 28th day after the first immunization. Finally, on the 56th and 182nd days after the first immunization, 0.25 mg of Gn protein was thoroughly mixed with 0.25 mg of aluminum adjuvant (purchased from Invivogen, vac-alu-50), and the rhesus monkeys were boost-immunized by intramuscular injection.

[0055] Blood was collected intravenously on the 210th day after the first immunization. The antibody titer in the serum was detected by ELISA. Peripheral blood was collected, and Gn-specific B cells were sorted by flow cytometry. Antibody genes were cloned by single-cell PCR technology, and linear expression cassettes were constructed. The heavy and light chains were co-transfected into 293T cells. After culturing for 48 h, the supernatant was collected. Then, ELISA was used to detect whether the supernatant contained binding antibodies against the Gn protein. The full-length genes of the heavy and light chains of the screened positive antibodies were cloned into the eukaryotic expression plasmid pCDNA3.4 by homologous recombination, transfected into the suspension cell Expi293F for large-scale expression, and purified by Protein A affinity column (HiTrapTM Protein A HP). Finally, two monoclonal antibodies A1 and C1 with good binding activity against the Gn protein were obtained. Their expression and purity were identified by SDS-PAGE, and the results were as Figure 2 shown.

[0056] The amino acid sequence of the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:1, and the amino acid sequence of the light chain is shown in SEQ ID NO:2. The gene sequence encoding the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody A1 is shown in SEQ ID NO:6. The amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody A1 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-115 of the sequence shown in SEQ ID NO:1, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-25, 34-50, 59-96, and 116-126 of the sequence shown in SEQ ID NO:1; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region of monoclonal antibody A1 are shown as the amino acid sequences at positions 27-37, 55-57, and 94-102 of the sequence shown in SEQ ID NO:2, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-26, 38-54, 58-93, and 103-112 of the sequence shown in SEQ ID NO:2;

[0057] The amino acid sequence of the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:4. The gene sequence encoding the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody C1 is shown in SEQ ID NO:8. The amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody C1 are shown in the amino acid sequences at positions 26-33, 51-58, and 97-101 of SEQ ID NO:3 sequence, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown in the amino acid sequences at positions 1-25, 34-50, 59-96, and 102-112 of SEQ ID NO:3 sequence; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region are shown in the amino acid sequences at positions 27-38, 56-58, and 95-103 of SEQ ID NO:4 sequence, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown in the amino acid sequences at positions 1-26, 39-55, 59-94, and 104-113 of SEQ ID NO:4 sequence.

[0058] Example 3: Determination of the binding activity of monoclonal antibodies A1 and C1

[0059] 1. Coat an ELISA plate with purified RVFV-Gn protein (2 μg / mL, 100 μL / well) overnight at 4 °C. After washing 4 times with PBST, block it with 5% skim milk powder at 37 °C for 2 h;

[0060] 2. After washing 4 times with PBST, add monoclonal antibodies A1 and C1 against the Gn protein antigen with an initial concentration of 9 μg / mL, and dilute them in a gradient of 1:3, and incubate at 37 °C for 1 h;

[0061] 3. After washing 4 times with PBST, add HRP-labeled goat anti-human IgG antibody (Sigma, AP113P), the antibody dilution ratio is 1:5000, 100 μL / well, and incubate at 37 °C for 1 h;

[0062] 4. After washing 4 times with PBST, add 100 μL of single-component TMB chromogenic solution, develop color at 37 °C for 10 min, add 50 μL of ELISA stop solution, and finally read the OD 450-630nm value with an ELISA reader.

[0063] Taking the monoclonal antibody concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curves of monoclonal antibodies A1 and C1 to RVFV-Gn are as Figure 3 .

[0064] Table 1 ELISA binding EC of monoclonal antibodies A1 and C1 to RVFV-Gn antigen50

[0065]

[0066] Table 1 shows the EC 50 values of monoclonal antibodies A1 and C1.

[0067] Example 4: Detection Sensitivity Experiment of Antibody Pair A1-C1

[0068] To establish a double-antibody sandwich ELISA method for the detection of Gn antigen, it is necessary to conduct a detection sensitivity experiment on the screened antibody pair. Monoclonal antibody A1 is used as the capture antibody, and monoclonal antibody C1 is used as the detection antibody (in this application, the detection monoclonal antibody is obtained by the direct HRP labeling method).

[0069] Experimental method:

[0070] 1. Coat the capture antibody A1 at a concentration of 2 μg / mL on a 96-well ELISA plate, and set two duplicate wells. Incubate overnight at 4°C. The next day, wash the plate 4 times with PBST and block it with 5% skim milk powder at 37°C for 2 hours.

[0071] 2. After blocking, wash the plate 4 times with PBST, and add RVFV-Gn protein (concentration gradients are 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, 1.562 ng / mL, 0.781 ng / mL, 0 ng / mL) as the primary antibody, 100 μL per well, and incubate at 37°C for 1 hour.

[0072] 3. After the incubation of the primary antibody, wash the plate 4 times with PBST, and add HRP-labeled C1 as the secondary antibody (concentration is 2 μg / mL), and incubate at 37°C for 1 hour.

[0073] 4. After the incubation of the secondary antibody, wash the plate 4 times with PBST, add 100 μL of single-component TMB chromogenic solution, develop color at 37°C for 10 minutes, add 50 μL of stop solution, and measure the absorbance at OD 450-630nm to determine the binding activity.

[0074] Table 2 shows the OD 450-630nm values of antibody pair A1-C1 for detecting RVFV-Gn. The ratio of the OD 450-630nm value S of the sample to be tested and the OD 450-630nm value N of the negative control is used as the standard for determining the detection positivity. When S / N ≥ 2.1, it is determined as positive, that is, the sample to be tested contains RVFV-Gn; otherwise, it is determined as negative, that is, the sample to be tested does not contain RVFV-Gn.

[0075] Table 2 OD values of antibody pair A1-C1 for detecting RVFV-Gn450-630nm Value

[0076]

[0077] Using the RVFV-Gn concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curve of A1-C1 and RVFV-Gn was obtained as Figure 4 (The scale interval of the X-axis is shown in the form of Log10 growth, so the data when the RVFV-Gn concentration is 0 is not shown in the figure).

[0078] Example 5: Detection specificity of antibodies

[0079] Two monoclonal antibodies A1 and C1 were respectively subjected to a binding test with recombinant Rift Valley fever virus Gn antigen and Severe fever with thrombocytopenia syndrome virus (SFTSV) Gn antigen. By detecting the OD 450-630nm value, it was determined whether A1 and C1 had detection specificity.

[0080] Experimental method:

[0081] 1. Coat an ELISA plate (2 μg / mL, 100 μL / well) with SFTSV-Gn protein (Gn antigen of SFTSV, purchased from ACROBiosystems, GNN-S52H3) overnight at 4 °C. After washing 4 times with PBST, block it with 5% skim milk powder at 37 °C for 2 h;

[0082] 2. After washing 4 times with PBST, add monoclonal antibodies A1 and C1 against RVFV-Gn protein antigen with an initial concentration of 200 ng / mL, and dilute them in a gradient of 1:2. Incubate at 37 °C for 1 h;

[0083] 3. After washing 4 times with PBST, add HRP-labeled goat anti-human IgG antibody (Sigma, AP113P), with an antibody dilution ratio of 1:5000, 100 μL / well, and incubate at 37 °C for 1 h;

[0084] 4. After washing 4 times with PBST, add 100 μL of single-component TMB chromogenic solution, develop color at 37 °C for 10 min, then add 50 μL of ELISA termination solution, and finally read the OD 450-630nm value with an ELISA reader.

[0085] The binding experiments of the two monoclonal antibodies A1 and C1 with RVFV-Gn antigen were the same as in Example 3. The results of Example 3 were integrated and compared with the results of this example. Using the monoclonal antibody concentration as the X-axis and OD 450-630nmTaking the Y-axis, the binding curves of monoclonal antibodies A1 and C1 with RVFV-Gn and SFTSV-Gn are as follows Figure 5 .

[0086] Figure 5 The binding curves of monoclonal antibodies A1 and C1 with RVFV-Gn antigen and SFTSV-Gn antigen are respectively shown. The results show that monoclonal antibodies A1 and C1 can specifically bind to RVFV-Gn antigen and do not bind to SFTSV-Gn antigen, indicating detection specificity.

[0087] Example 6: Optimization of the double-antibody sandwich ELISA detection protocol

[0088] When the antibody pair A1-C1 detects RVFV-Gn, the OD value of the blank well is relatively large, which is related to the concentration of the HRP-labeled antibody added. To establish a double-antibody sandwich ELISA method for the detection of RVFV-Gn antigen, it is necessary to optimize the addition amount of the monoclonal antibody during the detection process. 450-630nm The specific optimization plan is as follows: reduce the addition amount of the HRP-labeled antibody C1.

[0089] Experimental operation:

[0090] 1. Coat antibody A1 at a concentration of 2 μg / mL on a 96-well ELISA plate, and set two duplicate wells. Incubate overnight at 4°C. The next day, wash the plate 4 times with PBST and block it with 5% skim milk powder at 37°C for 2 hours.

[0091] 2. After blocking, wash the plate 4 times with PBST, add RVFV-Gn protein, diluted with 1% BSA, 100 μL / well, and incubate at 37°C for 1 hour. The initial concentration of the RVFV-Gn protein after dilution is 50 ng / mL, and it is serially diluted 2-fold, with concentrations of 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, 1.562 ng / mL, 0.781 ng / mL, 0.390 ng / mL, 0.195 ng / mL, 97.5 pg / mL, 48.75 pg / mL, and 0 ng / mL respectively.

[0092] 3. After incubation, wash the plate 4 times with PBST, add HRP-labeled antibody C1 as the secondary antibody, 100 μL / well, and incubate at 37°C for 1 hour. The concentrations of the secondary antibody are 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, and 0.125 μg / mL respectively.

[0093]

[0094] ​4. After the incubation of the secondary antibody, wash the plate 4 times with PBST, add the single-component TMB chromogenic solution, 100 μL / well, incubate at 37 °C for 10 min, add 50 μL of the stop solution, and measure the absorbance at OD 450-630nm .

[0095] Table 3 shows the OD 450-630nm values for detecting RVFV-Gn with different concentrations of HRP-C1. As the concentration of the HRP-labeled antibody decreases, the OD 450-630nm value of the blank well (without adding RVFV-Gn protein) gradually decreases. Generally, it is required that the OD 450-630nm value of the blank well < 0.10.

[0096] It can be seen from Table 3 that when the concentration of HRP-C1 is 1 μg / mL and 0.5 μg / mL, the sensitivity for detecting Gn protein is 0.39 ng / mL, while when the concentration of HRP-C1 is 0.25 μg / mL and 0.125 μg / mL, the sensitivity for detecting Gn protein is 0.781 ng / mL. Therefore, select the HRP-labeled antibody concentration under the condition that the blank OD 450-630nm value is less than 0.10 and the detection sensitivity is 0.39 ng / mL to make the kit, that is, the coating antibody A1 is 2 μg / mL and the detection antibody HRP-C1 is 0.5 μg / mL.

[0097] Table 3 OD 450-630nm values for detecting RVFV-Gn with different HRP-C1 concentrations

[0098]

[0099] Figure 6 For the condition that the detection antibody HRP-C1 is 0.5 μg / mL, with the RVFV-Gn concentration as the X value and the OD 450-630nm value as the Y value, use ELISA calc for calculation, and the fitting model selects the logistic curve (four parameters) to obtain the fitting curve.

[0100] Example 7: Sensitivity of double-antibody sandwich ELISA for detecting RVFV-Gn in serum

[0101] The purpose of the present invention is to detect whether there is Rift Valley fever virus in human serum. Therefore, it is necessary to determine the detection sensitivity of this double-antibody sandwich ELISA for RVFV-Gn in human serum.

[0102] The specific implementation method is to dilute the RVFV-Gn protein with single-person serum (serum of healthy volunteers) stored in the laboratory to detect the detection range of this double-antibody sandwich ELISA in this situation.

[0103] Table 4 OD values of RVFV-Gn in serum detected by double antibody sandwich ELISA 450-630nm Value

[0104]

[0105] Table 4 shows the OD values of RVFV-Gn in serum detected by double antibody sandwich ELISA 450-630nm Value. It can be seen from Table 4 that the detection sensitivity of this double antibody sandwich ELISA for detecting RVFV-Gn in human serum decreased compared with that in 1% BSA, but still reached 781 pg / mL.

Claims

1. A monoclonal antibody against the Gn protein of Rift Valley fever virus, characterized in that, It is monoclonal antibody A1 and / or monoclonal antibody C1, wherein, the amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody A1 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-115 of the sequence shown in SEQ ID NO:1; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-37, 55-57, and 94-102 of the sequence shown in SEQ ID NO:2; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody C1 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-101 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-38, 56-58, and 95-103 of the sequence shown in SEQ ID NO:

4.

2. The monoclonal antibody against the Gn protein of Rift Valley fever virus according to claim 1, wherein The amino acid sequence of the heavy chain of monoclonal antibody A1 is shown as SEQ ID NO:1, and the amino acid sequence of the light chain is shown as SEQ ID NO:2; The amino acid sequence of the heavy chain of monoclonal antibody C1 is shown as SEQ ID NO:3, and the amino acid sequence of the light chain is shown as SEQ ID NO:

4.

3. The coding gene for the monoclonal antibody against the Rift Valley fever virus Gn protein as claimed in claim 2, characterized in that, The gene sequence encoding the heavy chain of monoclonal antibody A1 is shown as SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody A1 is shown as SEQ ID NO:6; The gene sequence encoding the heavy chain of monoclonal antibody C1 is shown as SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody C1 is shown as SEQ ID NO:

8.

4. Use of the monoclonal antibody against Rift Valley fever virus Gn protein according to any one of claims 1-3 in the preparation of a detection kit for detecting Rift Valley fever virus Gn antigen.

5. A detection kit for detecting the Gn antigen of Rift Valley fever virus, characterized in that, Comprising the monoclonal antibody against Rift Valley fever virus Gn protein according to any one of claims 1-3.

6. The detection kit according to claim 5, characterized in that, The detection kit is a double-antibody sandwich ELISA detection kit, wherein the monoclonal antibodies are monoclonal antibody A1 and monoclonal antibody C1, one of monoclonal antibody A1 and monoclonal antibody C1 is used as a capture antibody, and the other is used as a detection antibody, and the detection antibody is labeled.

7. The detection kit according to claim 6, wherein The label used for labeling the monoclonal antibody in the detection antibody is peroxidase, phosphatase or luciferase.

8. The detection kit according to claim 7, wherein The peroxidase is horseradish peroxidase.

9. Use of the detection kit according to any one of claims 6-8 in the detection of Rift Valley fever virus Gn antigen for non-diagnostic purposes.

10. A double-antibody sandwich ELISA detection method for detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes, characterized in that, Using the detection kit according to any one of claims 6-8, the double-antibody sandwich ELISA detection method comprises the following steps: S1, coating an enzyme-labeled plate with a capture antibody; S2, performing blocking with a blocking solution; S3, discarding the blocking solution, washing with a buffer solution, then adding a sample to be detected, and incubating; S4, washing with a buffer solution, then adding a detection antibody, and incubating; S5, developing color and detecting.

Citation Information

Patent Citations

  • Humanized monoclonal antibody of rift valley fever virus and application thereof

    CN114409770A

  • Anti-vista (B7H5) antibodies

    CN109069626A

  • Anti-pvrig antibodies and methods of use

    US20160244521A1