Trichoderma erinaceum A18 and culture medium and preparation method of culture medium

Abstract

A cellulose-degrading bacterium (Trichoderma erinaceum) A18 and a culture medium and a preparation method of the culture medium, the bacterium is preserved in Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC No. 65616, the bacterium is screened from soil and fallen leaves in Nanning City. The culture medium comprises a seed culture medium and an enzyme production culture medium, components of the seed culture medium are as follows: sodium carboxymethyl cellulose 10 g / L, protein peptone 3 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L and calcium chloride 0-0.3 g / L; components of the enzyme production culture medium are as follows: sodium carboxymethyl cellulose 8-12 g / L, protein peptone 2-3 g / L, yeast powder 0.2-3 g / L, ammonium sulfate 0.2-2 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L and zinc chloride 0.002 g / L. After the seed culture medium and the enzyme production culture medium are configured with distilled water, the seed culture medium and the enzyme production culture medium are placed in a high-pressure sterilization pot and sterilized at 121 DEG C, inoculation is carried out according to a proportion, and anaerobic culture is carried out in a closed state. The cellulose-degrading bacterium A18 can effectively improve cellulose endoenzyme activity by using the application.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a cellulose-degrading bacterium, a culture medium, and a method for preparing the culture medium. Background Technology

[0002] Roughage contains a large amount of cellulose, which has low value as a direct feed ingredient. Reducing the cellulose content of roughage can improve its feeding value. Trichoderma has a strong ability to produce cellulose and has advantages such as a relatively complete and highly active cellulase system, and the fact that most of its enzymes are extracellular enzymes that are easy to purify. It is superior to other microorganisms in cellulose degradation. At the same time, fungi are rich in cell protein, and fungal fermentation improves the nutritional value of roughage more significantly than bacterial fermentation. During the fermentation of roughage, lactic acid bacteria play a role in producing lactic acid and acetic acid to lower the pH of the feed. Using acid-resistant cellulose-degrading bacteria is more conducive to secreting cellulases with high enzyme activity at low pH, thus making the cellulose reduction effect better. Chinese patent CN103820361B discloses a thermophilic cellulose-degrading bacterium and its application. This strain has cellulase activity and can degrade cellulose in the presence of an auxiliary carbon source. It can grow in a temperature range of 50-85℃ and a pH range of 5.5-8.0, with an optimum pH of 6.5. However, its optimum pH is relatively high. During the fermentation of roughage, lactic acid bacteria produce lactic acid and acetic acid, which lowers the pH, resulting in poor cellulose degradation. Therefore, developing a culture medium that can enhance the activity of cellulose endonuclease in acid-tolerant cellulose-degrading bacteria is beneficial for improving the fermentation effect of cellulose-degrading bacteria on roughage. Summary of the Invention

[0003] To address the problem of high cellulose content in roughage, this invention provides a cellulose-degrading bacterium, a culture medium, and a method for preparing the culture medium. This culture medium effectively enhances the cellulase activity of the cellulose-degrading bacterium (Trichoderma erinaceum) A18. This allows Trichoderma erinaceum A18 to secrete cellulases that maintain high activity even at pH 4.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: a cellulose-degrading bacterium (Trichoderma erinaceum) A18, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 11, 2024, with accession number GDMCC No. 65616. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0005] The cellulose-degrading bacterium (Trichoderma erinaceum) A18 was screened from soil and fallen leaves in Nanning City.

[0006] The properties of the cellulose-degrading bacterium (Trichoderma erinaceum) A18 are as follows:

[0007] The strain possesses cellulase activity and can degrade cellulose in the presence of an auxiliary carbon source. It can grow in a temperature range of 20-35℃ and a pH range of 4.0-7.0, with an optimal pH of approximately 4.8. After 2 days of cultivation on PDA solid medium, its colony characteristics are: white, irregular filamentous fungi; with continued cultivation, the white color gradually transforms into a dark green. The ITS region of this strain was amplified by PCR using universal primers (ITS1-6F)5′-GGAAGTAAAAGTCGTAACAA-3′ and (ITS4-2R)5′-TCCTCCGCTTATTGATATGC-3′. A phylogenetic tree was constructed using MEGA11 software after comparison with the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). A phylogenetic tree was constructed based on the ITS sequence of strain A18. Strain A18 (sam ple A18) is most closely related to strain Trichoderma erinaceum, with a breakthrough value of 99. Therefore, strain A18 can be considered as Trichoderma erinaceum, and is named Trichoderma erinaceum A18.

[0008] The screening and identification of the cellulose-degrading bacterium (Trichoderma erinaceum) A18 includes the following steps:

[0009] (1) The collected soil and fallen leaves were mixed with physiological saline, soaked, filtered, plated on PDA medium, and cultured and purified until single colonies were obtained.

[0010] (2) Single colonies obtained were inoculated onto Congo red agar and those that formed obvious clear zones were screened again.

[0011] (3) Inoculate colonies that form obvious transparent zones into filter paper strip culture medium and perform secondary screening. For those with a high degree of filter paper strip disintegration, determine the activity of cellulase endonuclease.

[0012] (4) After the test, those with high cellulase activity will be screened out for safety assessment.

[0013] (5) The relatively safe strains were sequenced by ITS, a phylogenetic tree was constructed and preserved.

[0014] A culture medium for enhancing the activity of cellulase A18 from the cellulodegrading bacterium *Trichoderma erinaceum*, comprising a seed culture medium and an enzyme-producing culture medium. The seed culture medium consists of: sodium carboxymethyl cellulose 10 g / L, peptone 3 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L, and calcium chloride 0–0.3 g / L. The enzyme-producing culture medium consists of: sodium carboxymethyl cellulose 8–12 g / L, peptone 2–3 g / L, yeast extract 0.2–3 g / L, ammonium sulfate 0.2–2 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L, and zinc chloride 0.002 g / L.

[0015] The method for preparing a culture medium for enhancing the activity of A18 cellulase in cellulose-degrading bacteria (Trichoderma erinaceum) includes the following steps:

[0016] (1) Prepare the seed culture medium and enzyme production culture medium with distilled water and put them into an autoclave for sterilization at 121°C for 20 min.

[0017] (2) Cellulose-degrading bacteria (Trichoderma erinaceum) A18 were placed in PDA medium for activation and propagation. After the plate was covered, the plate was rinsed with sterile water to obtain a suspension and placed in a 4°C refrigerator for later use.

[0018] (2) The suspension was inoculated into the seed culture medium at a ratio of 2% and cultured anaerobically in a sealed container for 2 days;

[0019] (3) After the seed culture medium is completed, inoculate it into the enzyme-producing culture medium at a ratio of 2% to 6%, and culture it in a closed anaerobic environment for 5 days;

[0020] (4) After culturing in the enzyme-producing medium, the cellulase activity was measured.

[0021] The method for determining the activity of cellulase in cellulose-degrading bacteria is performed according to the following steps:

[0022] (1) After the enzyme-producing culture medium is cultured, the bacterial solution obtained is centrifuged at 6000 r / min for 15 min to obtain crude enzyme solution;

[0023] (2) Add 0.25 ml of crude enzyme solution to 0.75 ml of sodium citrate buffer solution with a concentration of 10 g / L sodium carboxymethyl cellulose. Divide the solution into control tubes and test tubes. Add 0.75 ml of 3,5-dinitrosalicylic acid reagent to the control tubes at the same time. Do not add any reagent to the test tubes. Place them in a 50°C water bath for 30 min.

[0024] (3) Immediately after the water bath is completed, add 0.75 ml of 3,5-dinitrosalicylic acid reagent to the test tube. Then place the control tube and the test tube in boiling water for 5 min. After cooling, zero the blank tube at a wavelength of 540 nm and record the absorbance of the test tube.

[0025] (4) Prepare glucose standard solution and process it according to steps (2) and (3) to establish a standard curve for glucose standard solution;

[0026] (5) Substitute the absorbance obtained in step (3) into the glucose standard curve to calculate the glucose content in the crude enzyme solution, and calculate the cellulase activity of the crude enzyme solution according to the following formula:

[0027] Cellulose endopeptidase activity

[0028] The method for determining the activity of cellulase endopeptidase in cellulodegrading bacteria, in step (2), is as follows: 9.6g of citric acid is dissolved in 900ml of distilled water, the pH is adjusted to 4 with sodium hydroxide, and the volume is brought to 1L.

[0029] The method for determining the activity of cellulase endopeptidase in cellulodegrading bacteria, in step (2), is as follows: 5.3 g / L of 3,5-dinitrosalicylic acid and 9.9 g / L of sodium hydroxide are dissolved in 708 ml of deionized water by heating; then 153 g / L of potassium sodium tartrate, 3.8 ml / L of melted phenol, and 4.15 g / L of sodium metabisulfite are added and dissolved completely, and the mixture is made up with deionized water.

[0030] The method for determining the activity of cellulase in cellulose-degrading bacteria, wherein the concentration of the glucose standard solution in step (4) is 1 mg / mL.

[0031] The present invention has the following beneficial effects:

[0032] The culture medium described in this invention for improving the activity of cellulase in cellulose-degrading bacteria can effectively enhance the activity of cellulase in cellulose-degrading bacteria (Trichoderma erinaceum) A18, enabling cellulose-degrading bacteria (Trichoderma erinaceum) A18 to secrete cellulases that still have strong activity at pH=4. Attached Figure Description

[0033] Figure 1 This is an example of filter paper strip disintegration screening of the cellulose-degrading bacterium (Trichoderma erinaceum) A18 described in this invention.

[0034] Figure 2 This is the safety test result of the cellulose-degrading bacterium (Trichoderma erinaceum) A18 described in this invention.

[0035] Figure 3 This is a phylogenetic tree of the cellulose-degrading bacterium (Trichoderma erinaceum) A18 described in this invention, based on ITS sequencing results. Detailed Implementation

[0036] The technical solution of the present invention will be further described below through embodiments.

[0037] Example 1

[0038] Screening and identification of cellulose-degrading bacteria (Trichoderma erinaceum) A18

[0039] The collected soil and fallen leaves were mixed with physiological saline at a ratio of 1:9, soaked for 30 minutes, filtered through four layers of gauze, plated on PDA medium, and cultured and purified until single colonies were obtained.

[0040] After culturing A18 on PDA solid medium for 2 days, its colony characteristics are: white irregular filamentous fungi, and with continued culturing, the white color will gradually turn into dark green.

[0041] The obtained single colonies were inoculated onto Congo red agar medium containing 10 g / L sodium carboxymethyl cellulose (CMC-Na), 1 g / L K2PO4, 1 g / L (NH4)2SO4, 0.2 g / L MgSO4·7H2O, 0.02 g / L CaCl2, and 15 g / L agar. Those that formed a clear transparent zone were then screened again.

[0042] Colonies exhibiting clear transparent zones were inoculated into filter paper strip culture medium containing filter paper strips (1×6cm), 1g / L KH₂PO₄, 0.1g / L NaCl, 0.3g / L MgSO₄·7H₂O, 0.01g / L FeCl₃, 0.1g / L CaCl₂, and pH 7.2–7.4. A second screening was then performed, and the results are shown below. Figure 1 For those filter paper strips that showed a high degree of disintegration, cellulase activity was measured, and the results are shown in Table 1.

[0043] Table 1 Cellulase activity of screened strains

[0044]

[0045] After testing, those with high cellulase activity will be screened for safety assessment. (See attached document.) Figure 2

[0046] The relatively safe strains were subjected to ITS sequence sequencing, and a phylogenetic tree was constructed. (See...) Figure 3 And preserve them.

[0047] The ITS region of this strain was amplified by PCR using universal primers (ITS1-6F)5′-GGAAGTAAAAGTCGTAACAA-3′ and (ITS4-2R)5′-TCCTCCGCTTATTGATATGC-3′. The phylogenetic tree was constructed using MEGA11 software after comparison with the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Based on the ITS sequence of strain A18, a phylogenetic tree was constructed. Strain A18 (sample A18) is most closely related to strain *Trichoderma erinaceum*, with a breakthrough value of 99. Therefore, strain A18 is considered to be *Trichoderma erinaceum*, and named *Trichoderma erinaceum* A18. It was deposited at the Guangdong Provincial Microbial Culture Collection Center on December 11, 2024, with accession number GDMCCNo. 65616. Address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0048] The sequence of A18 is as follows:

[0049] AGTCTGGGTATTACCGAGTTTACACTCCCAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGT

[0050] CACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTACTGTA

[0051] GTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACG

[0052] GATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG

[0053] TGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCA

[0054] TTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGGAACCCCTCAGACGGGATCCCGGCCC

[0055] CGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCG

[0056] GCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTG

[0057] AACTTAAGCATATCAATAAGGGAAAGGAAAAGAACGGAAGGGAAGA.

[0058] Example 2

[0059] This embodiment is an example of a method for preparing a culture medium for improving the activity of cellulase endonucleases in cellulodegrading bacteria according to the present invention, comprising the following steps:

[0060] (1) Prepare the seed culture medium and enzyme production culture medium with distilled water and put them into an autoclave for sterilization at 121°C for 20 min.

[0061] (2) Place the cellulose-degrading bacteria (Trichoderma erinaceum) A18 in PDA medium and pour it into the medium for activation and propagation. After the mycelium has grown, use a 1000ul pipette tip to draw 1ml of sterile water to rinse the surface of the medium. Repeat this several times until there are no obvious colonies on the surface. Then draw the bacterial solution into sterile water and put it in a 4℃ refrigerator for later use.

[0062] (3) The suspension was inoculated into the seed culture medium at a ratio of 2% and cultured anaerobically in a sealed container for 2 days;

[0063] (4) After the seed culture medium is completed, inoculate it into the enzyme-producing culture medium at a ratio of 2% and culture it in a closed anaerobic environment for 5 days.

[0064] (5) After culturing in the enzyme-producing medium, the cellulase activity was measured.

[0065] The enzyme production results in the culture medium were determined using the 3,5-dinitrosalicylic acid method in a buffer solution at pH 4. The results are listed in Table 1.

[0066] Table 2 Cellulase Activity in Example 2

[0067]

[0068] As shown in Table 1, the cellulase activity of Example 2 was 2.93 U / mL, while that of Comparative Example 1 was 1.62 U / mL. This represents an 80.86% increase compared to Comparative Example 1.

[0069] Example 3

[0070] This embodiment is another example of the method for preparing a culture medium for improving the activity of cellulase in cellulose-degrading bacteria according to the present invention, comprising the following steps:

[0071] (1) Prepare the seed culture medium and enzyme production culture medium with distilled water and put them into an autoclave for sterilization at 121°C for 20 min.

[0072] The seed culture medium consisted of: sodium carboxymethyl cellulose 10 g / L, peptone 3 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L, calcium chloride 0.3 g / L, and normal pH.

[0073] The enzyme-producing culture medium consisted of: sodium carboxymethyl cellulose 8 g / L, peptone 3 g / L, yeast extract 0.2 g / L, ammonium sulfate 2 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L, calcium chloride 0.3 g / L, zinc chloride 0.002 g / L, pH 5.8.

[0074] (2) Place the cellulose-degrading bacteria (Trichoderma erinaceum) A18 in PDA medium and pour it into the medium for activation and propagation. After the mycelium has grown, use a 1000ul pipette tip to draw 1ml of sterile water to rinse the surface of the medium. Repeat this several times until there are no obvious colonies on the surface. Then draw the bacterial solution into sterile water and put it in a 4℃ refrigerator for later use.

[0075] (3) The suspension was inoculated into the seed culture medium at a ratio of 2% and cultured anaerobically in a sealed container for 2 days;

[0076] (4) After the seed culture medium is completed, inoculate it into the enzyme-producing culture medium at a ratio of 2% and culture it in a closed anaerobic environment for 5 days.

[0077] (5) After culturing in the enzyme-producing medium, the cellulase activity was measured.

[0078] The enzyme production results in the culture medium were determined using the 3,5-dinitrosalicylic acid method in a buffer solution at pH 4. The results are listed in Table 2.

[0079] Table 3 Cellulase Activity in Example 3

[0080]

[0081] As shown in Table 2, the cellulase activity of Example 3 was 2.89 U / mL, while that of Comparative Example 1 was 1.62 U / mL. This represents an increase of 78.40% compared to Comparative Example 1.

[0082] Example 4

[0083] This embodiment is yet another example of the method for preparing a culture medium for improving the activity of cellulase endonucleases in cellulosic bacteria according to the present invention, comprising the following steps:

[0084] (1) Prepare the seed culture medium and enzyme production culture medium with distilled water and put them into an autoclave for sterilization at 121°C for 20 min.

[0085] The seed culture medium consisted of: sodium carboxymethyl cellulose 10 g / L, peptone 3 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L, calcium chloride 0.3 g / L, and normal pH.

[0086] The enzyme-producing culture medium consisted of: sodium carboxymethyl cellulose 8 g / L, peptone 3 g / L, yeast extract 0.2 g / L, ammonium sulfate 2 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L, calcium chloride 0.3 g / L, zinc chloride 0.002 g / L, pH 5.8.

[0087] (2) Place the cellulose-degrading bacteria (Trichoderma erinaceum) A18 in PDA medium and pour it into the medium for activation and propagation. After the mycelium has grown, use a 1000ul pipette tip to draw 1ml of sterile water to rinse the surface of the medium. Repeat this several times until there are no obvious colonies on the surface. Then draw the bacterial solution into sterile water and put it in a 4℃ refrigerator for later use.

[0088] (3) The suspension was inoculated into the seed culture medium at a ratio of 2% and cultured anaerobically in a sealed container for 2 days;

[0089] (4) After the seed culture medium is completed, inoculate it into the enzyme-producing culture medium at a ratio of 2% and culture it in a closed anaerobic environment for 5 days.

[0090] (5) After culturing in the enzyme-producing medium, the cellulase activity was measured.

[0091] The enzyme production results in the culture medium were determined using the 3,5-dinitrosalicylic acid method in a buffer solution at pH 4. The results are listed in Table 3.

[0092] Table 4 Cellulase Activity in Example 4

[0093]

[0094] As shown in Table 3, the cellulase activity of Example 4 was 7.65 U / mL, while that of Comparative Example 1 was 1.62 U / mL. This represents an increase of 372.22% compared to Comparative Example 1.

[0095] The experimental results above show that:

[0096] 1. The addition of metal ions to the culture medium significantly promoted the activity of cellulase endonucleases.

[0097] The addition of metal ions to the culture medium significantly promoted the activity of cellulase endonuclease, Ca 2+ The effects on microorganisms are multifaceted, Ca 2+ As an essential nutrient element for microbial growth and metabolism, calcium participates in various physiological functions such as cell permeability regulation, signal regulation, and gene expression. A certain concentration of calcium... 2+ It can also promote mitochondrial ATP synthesis and hyphal branching, thereby promoting microbial growth. 2+ It can also, to some extent, offset excess Mg 2+ It inhibits cellulase synthesis.

[0098] Zn 2+ Zinc finger proteins can participate in the synthesis of zinc finger proteins, a class of proteins containing zinc finger domains that are widely distributed in fungi. These proteins participate in cell proliferation, differentiation, and apoptosis, as well as the recognition of DNA, RNA, and proteins. Zinc finger proteins with transcription factor functions constitute the largest proportion of the zinc finger protein family, including positive transcription factors of zinc finger cellulase genes (XYR1, ACE2, ACE3) and negative transcription factors of zinc finger proteins (CRE1, ACE1, RCE1). This indicates that Zn... 2+ The effect on cellulase production is two-sided; studies have shown that at low concentrations of Zn... 2+ Under certain conditions, it can enhance the capabilities of XYR1 and ACE3, while Zn 2+ It can promote the binding of substrates to the enzyme's active site, but excessive Zn... 2+ It will inhibit the growth of mycelium, and at the same time, Zn 2+ When Zn levels rise, not only do the mRNA levels of XYR1, ACE2, and ACE3 increase, but the mRNA level of CRE1, a transcription factor that inhibits cellulase production, also increases. Therefore, excessively high Zn levels... 2+ This may lead to a decrease in the yield of cellulase, which in turn affects the activity of cellulase in the system.

[0099] 2. Effects of nitrogen source combination on cellulase activity

[0100] We found that the combination of three nitrogen sources in the culture medium has an effect on the activity of cellulase. Among them, peptone has the greatest influence. When the peptone content decreases, the activity of cellulase decreases significantly, indicating that the cellulase-degrading bacterium (Trichoderma erinaceum) A18 prefers to use peptone as a nitrogen source to synthesize cellulase.

[0101] 3. A low pH environment in the culture medium is more conducive to promoting the production of cellulases with stronger acid resistance by the strain.

[0102] The experimental results show that a pH of 4.8 is more conducive to the production of cellulases with stronger acid resistance by the strain, which may be because Trichoderma erinaceum A18 tends to produce enzymes in a low pH environment.

[0103] The above results show that the culture medium prepared by the method of the present invention can more effectively promote the production of acid-resistant cellulase by the cellulodegrading bacterium (Trichoderma erinaceum) A18.

Claims

1. A strain of a cellulolytic bacterium (Trichoderma erinaceum) A18, characterized in that, It is deposited at the Guangdong Provincial Center for Microbial Culture Collection, accession number: GDMCC No. 65616.

2. The cellulosic degrading bacteria of claim 1 (Trichoderma erinaceum) A18, characterized in that The cellulose-degrading bacteria (Trichoderma erinaceum) A18 was screened from the soil and fallen leaves in Nanning City.

3. The cellulosic degrading bacteria of claim 1 (Trichoderma erinaceum) A18, characterized in that The cellulose-degrading bacteria (Trichoderma erinaceum) Screening and identification of A18, comprising the following steps: (1) The collected soil and fallen leaves were mixed with physiological saline, soaked, filtered, plated on PDA medium, cultured and purified until single colonies were obtained; (2) Single colonies obtained were inoculated onto Congo red agar and those that formed obvious clear zones were screened again; (3) Inoculate colonies that form obvious transparent zones into filter paper strip culture medium and perform secondary screening. For those with a high degree of filter paper strip disintegration, determine the activity of cellulase endonuclease. (4) After the assay, those with high cellulase activity will be screened out for safety assessment; (5) The relatively safe strains were sequenced by ITS, a phylogenetic tree was constructed and preserved.

4. A cellulose-degrading bacterium for use in the improvement of the activity of the cellulase produced by the bacterium according to claim 1. (Trichoderma erinaceum) A18 A method for increasing the activity of a cellulase produced by a bacterium, characterized in that, The cellulose-degrading bacteria of claim 1 are cultured using a culture medium including a seed culture medium and an enzyme-producing culture medium. (Trichoderma erinaceum) A18, wherein the seed culture medium comprises: sodium carboxymethyl cellulose 10 g / L, peptone 3 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L, and calcium chloride 0-0.3 g / L; and the enzyme-producing culture medium comprises: sodium carboxymethyl cellulose 8-12 g / L, peptone 2-3 g / L, yeast extract 0.2-3 g / L, ammonium sulfate 0.2-2 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate heptahydrate 0.3 g / L, and zinc chloride 0.002 g / L.

5. The method according to claim 4, comprising the following steps: (1) Prepare the seed culture medium and the enzyme production culture medium separately with distilled water and put them into an autoclave for sterilization at 121°C for 20 min; (2) the cellulose-degrading bacteria (Trichoderma erinaceum) A18 was activated and multiplied in PDA medium, and after the plate was covered, the plate was washed with sterile water to obtain a suspension which was stored in a 4°C refrigerator. (3) The suspension was inoculated into the seed culture medium at a ratio of 2% and cultured anaerobically in a sealed container for 2 days; (4) After the seed culture medium is completed, inoculate it into the enzyme-producing culture medium at a ratio of 2% to 6% and culture it in a closed anaerobic environment for 5 days; (5) After the enzyme is cultured in the enzyme-producing medium, its cellulase activity is measured.

6. The method of claim 5, wherein, It also includes the following steps: (1) After the enzyme-producing culture medium is cultured, the bacterial solution obtained is centrifuged at 6000 r / min for 15 min to obtain crude enzyme solution; (2) Add the crude enzyme solution to 0.75 ml of sodium citrate buffer solution with a concentration of 10 g / L sodium carboxymethyl cellulose at a volume of 0.25 ml. Divide the solution into control tubes and test tubes. Add 0.75 ml of 3,5-dinitrosalicylic acid reagent to the control tubes at the same time. Do not add any reagent to the test tubes. Place them in a water bath at 50°C for 30 min. (3) Immediately after the water bath is completed, add 0.75 ml of 3,5-dinitrosalicylic acid reagent to the test tube. Then place the control tube and the test tube in boiling water for 5 min. After cooling, zero the blank tube at a wavelength of 540 nm and record the absorbance of the test tube. (4) Prepare glucose standard solution and process it according to steps (2) and (3) to establish a standard curve for glucose standard solution; (5) Substitute the absorbance obtained in step (3) into the glucose standard curve to calculate the glucose content in the crude enzyme solution, and calculate the cellulase activity of the crude enzyme solution according to the following formula: 。 7. The method of claim 6, wherein, The method for preparing the sodium citrate buffer solution in step (2) is as follows: dissolve 9.6g of citric acid in 900ml of distilled water, adjust the pH value to 4 with sodium hydroxide, and bring the volume to 1L.

8. The method of claim 6, wherein, The preparation method of the 3,5-dinitrosalicylic acid reagent in step (2) is as follows: 5.3 g / L of 3,5-dinitrosalicylic acid and 9.9 g / L of sodium hydroxide are dissolved in 708 ml of deionized water by heating; then 153 g / L of potassium sodium tartrate, 3.8 ml / L of melted phenol and 4.15 g / L of sodium metabisulfite are added and dissolved completely, and the mixture is made up with deionized water.

9. The method of claim 6, wherein, The concentration of the glucose standard solution in step (4) is 1 mg / mL.

Images