Multifunctional rhizoma polygonati rhizosphere growth-promoting fungus PSR-26 and application thereof

Abstract

The invention discloses a multifunctional polygonatum sibiricum rhizosphere growth-promoting fungus PSR-26 and application thereof, and belongs to the technical field of microorganisms. The invention discloses a multifunctional rhizoma polygonati rhizosphere growth-promoting fungus PSR-26, the preservation number of the multifunctional rhizoma polygonati rhizosphere growth-promoting fungus PSR-26 is CGMCC (China General Microbiological Culture Collection Center) No.41690, and the multifunctional rhizoma polygonati rhizosphere growth-promoting fungus PSR-26 is classified and named as Simple lanosoniveum. The growth-promoting fungus PSR-26 has good organic phosphorus dissolving capacity, inorganic phosphorus dissolving capacity, potassium dissolving capacity and nitrogen fixing capacity, can generate indoleacetic acid auxin and siderophore, and has a good promoting effect on plant growth.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and more specifically, to a multifunctional plant growth-promoting rhizosphere fungus PSR-26 of Polygonatum sibiricum and its application. Background Art

[0002] In order to pursue higher quality, yield and economic benefits, chemical fertilizers are applied in agricultural production to improve soil fertility and increase crop yields. There is a widespread phenomenon of overusing chemical fertilizers in crop planting in China, which causes soil compaction, reduced fertility, leading to a decline in crop yields and quality, and also causing problems such as environmental deterioration of soil and water. Microbial inoculants can reduce damage to the soil and the environment, which is in line with the concept of sustainable development of crops. Plant growth-promoting bacteria refer to a class of beneficial bacteria that live freely in the soil or are attached to the roots, leaves, and stems of plants, which can promote plant growth and their absorption and utilization of mineral nutrients, and can inhibit harmful microorganisms. At present, most rhizosphere growth-promoting fungi use single-functional microbial strains, resulting in insignificant conversion of soil nutrients and growth-promoting effects, which limits the development and popularization of fungal fertilizers. Based on this, the research and development of rhizosphere growth-promoting fungi with multiple functions has become an important direction for the future sustainable and high-quality development of crops.

[0003] Therefore, providing a multifunctional plant growth-promoting rhizosphere fungus PSR-26 of Polygonatum sibiricum and its application is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0004] In view of this, the present invention provides a multifunctional plant growth-promoting rhizosphere fungus PSR-26 of Polygonatum sibiricum and its application. PSR-26 is a new multifunctional plant rhizosphere growth-promoting fungus, which can be applied to the preparation of multifunctional microbial fertilizers to promote plant growth.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A multifunctional plant growth-promoting rhizosphere fungus PSR-26 of Polygonatum sibiricum, with a preservation number of CGMCC No. 41690, has been preserved in the China General Microbiological Culture Collection Center, abbreviated as CGMCC, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The preservation date is December 09, 2024, and the taxonomic name is Simplicillium lanosoniveum.

[0007] Furthermore, the application of the multifunctional plant growth-promoting rhizosphere fungus PSR-26 of Polygonatum sibiricum in phosphorus solubilization.

[0008] Furthermore, the application of the multifunctional plant growth-promoting rhizosphere fungus PSR-26 of Polygonatum sibiricum in potassium release.

[0009] Further, the application of the multifunctional rhizosphere growth-promoting fungus PSR-26 of Polygonatum sibiricum in nitrogen fixation.

[0010] Further, the application of the multifunctional rhizosphere growth-promoting fungus PSR-26 of Polygonatum sibiricum in siderophore production.

[0011] Further, the application of the multifunctional rhizosphere growth-promoting fungus PSR-26 of Polygonatum sibiricum in IAA production.

[0012] Further, the application of the multifunctional rhizosphere growth-promoting fungus PSR-26 of Polygonatum sibiricum in promoting the germination of wheat seeds.

[0013] Further, the application of the multifunctional rhizosphere growth-promoting fungus PSR-26 of Polygonatum sibiricum in promoting the growth of wheat seedlings.

[0014] Through the above technical solutions, it can be seen that compared with the prior art, the present invention discloses a multifunctional rhizosphere growth-promoting fungus PSR-26 of Polygonatum sibiricum and its application. The growth-promoting fungus PSR-26 has good abilities of dissolving organic phosphorus, dissolving inorganic phosphorus, decomposing potassium, and nitrogen fixation, and can produce indoleacetic acid auxin and siderophores, which have a good promoting effect on the growth of plants. Description of the Drawings

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0016] Figure 1 The drawing is the phylogenetic tree of the PSR-26 strain of the present invention;

[0017] Figure 2 The drawing is the colony morphology diagram of the PSR-26 strain of the present invention on a PDA plate;

[0018] Figure 3 The drawing is the influence diagram of the PSR-26 strain of the present invention on the growth of wheat seedlings. Detailed Embodiments

[0019] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0020] Organophosphorus selective medium: Glucose 10.0 g, (NH 4 ) 2 SO 4 0.5 g, MgSO 4 ·7H 2 O 0.3 g, MnSO 4 ·4H 2 O 0.3 g, KCl 0.3 g, FeSO 4 ·7H 2 O 0.03 g, NaCl 0.3 g, CaCO 3 5.0 g, Lecithin 0.2 g, Agar 18.0 g, made up to 1 L with water, pH 7.0.

[0021] Organophosphorus liquid medium: Glucose 10 g, MnSO 4 ·4H 2 O 0.03 g, Yeast extract 0.4 g, MgSO 4 ·7H 2 O 0.3 g, NaCl 0.3 g, KCl 0.3 g, FeSO 4 ·7H 2 O 0.03 g, Lecithin 0.2 g, CaCO 3 5 g, (NH 4 ) 2 SO 4 0.5 g, made up to 1 L with water, pH 7.2.

[0022] Inorganic phosphorus selective medium: Glucose 10.0 g, (NH 4 ) 2 SO 4 0.5 g, MgSO 4 ·7H 2 O 0.3 g, MnSO 4 ·4H 2 O 0.03 g, KCl 0.3 g, FeSO 4 ·7H 2 O 0.03 g, NaCl 0.3 g, Ca 3 (PO 4 ) 2 10.0 g, Agar 18.0 g, made up to 1 L with water, pH 7.0.

[0023] Inorganic phosphorus liquid medium: Ammonium sulfate 0.5 g, Magnesium sulfate heptahydrate 0.3 g, Sodium chloride 0.3 g, Manganese sulfate tetrahydrate 0.03 g, Potassium chloride 0.3 g, Ferrous sulfate heptahydrate 0.03 g, Glucose 10 g, Calcium phosphate 10 g, made up to 1 L with water, pH 7.0.

[0024] Potassium-solubilizing selective medium: 10 g of sucrose, 0.5 g of yeast extract, 1 g of ammonium sulfate, 2 g of disodium hydrogen phosphate, 0.5 g of magnesium sulfate, 1 g of calcium carbonate, 1 g of potassium feldspar powder, 20 g of agar, made up to 1 L with water, pH 7.0.

[0025] Nitrogen-fixing selective medium (Ashby medium): KH 2 PO 4 0.2 g, 0.2 g of NaCl, 5.0 g of mannitol, K 2 SO 4 ·2H 2 O 0.2 g, MgSO 4 ·7H 2 O 0.2 g, CaCO 3 5.0 g, 5.0 g of glucose, 20 g of agar, made up to 1 L with water, pH 7.0.

[0026] Siderophore selective medium (CAS medium): 69.5 mg of chrome azurol S, 72.9 mg of cetyltrimethylammonium bromide, 2.645 mg of ferric chloride hexahydrate, 0.295 g of disodium hydrogen phosphate dihydrate, 1.213 g of disodium hydrogen phosphate dodecahydrate, 125 mg of ammonium chloride, 37.5 mg of potassium dihydrogen phosphate, 62.5 mg of sodium chloride, 9 g of agar, made up to 1 L with water, pH 6.8.

[0027] MKB liquid medium: 15 mL of glycerol, 5 g of acid hydrolysate of casein, K 2 HPO 4 2.5 g, MgSO 4 ·7H 2 O 1.0 g, made up to 100 mL with deionized water, natural pH. Used for determining the siderophore-producing ability of strains.

[0028] King liquid medium: 20 g of peptone, K 2 HPO 4 1.15 g, MgSO 4 ·7H 2 O 1.5 g, 15 mL of glycerol, 0.1 g of L-tryptophan, made up to 1 L with water, pH 7.2. Used for determining the IAA-producing ability of strains.

[0029] PDB liquid medium: 200 g of peeled potatoes, 20 g of glucose, made up to 1 L with distilled water, natural pH.

[0030] PDA medium: Add 20 g of agar to the PDB liquid medium.

[0031] Example 1 Isolation and purification of rhizosphere fungi of Polygonatum sibiricum

[0032] The soil sample was collected from the soil around the roots of Polygonatum cyrtonema Hua planted in the Biotechnology Park of Longdong University. 10 g of the soil sample was weighed and added to a conical flask containing 90 mL of sterile water. It was shaken at 28 °C and 160 r / min in a shaker for 24 h for enrichment culture. The bacterial suspension was serially diluted. 1 mL of the bacterial suspension was taken and added to 9 mL of sterile water, and shaken well to obtain a dilution of 10 -2 concentration; diluted successively to 10 -6 in the above operation until 10 -4 、10 -5 、10 -6 soil suspension of 100 μL was spread on PDA medium. Each concentration gradient was repeated three times and placed in an incubator at 28 °C for inverted culture for 3 - 5 d.

[0033] During the culture period, the growth status of the colonies was observed regularly. Single colonies with good growth and different morphologies were picked out and inoculated on PDA medium, and purified culture was carried out at 28 °C in an incubator. The purification culture was repeated until no contaminants appeared on the PDA medium, and a single colony was obtained.

[0034] Example 2 Functional identification of strains

[0035] A. Determination of phosphate - solubilizing ability of strains

[0036] The plate method was used for primary screening. The isolated strains were preliminarily screened by comparing their phosphate - solubilizing abilities. Bacterial cakes with a diameter of 3 mm were inoculated on organic - phosphorus selective medium and inorganic - phosphorus selective medium respectively, and incubated at 28 °C in an inverted position for 5 d. Whether a phosphate - solubilizing circle appeared on the plate was observed. If there was a phosphate - solubilizing circle, the diameter (D) of the phosphate - solubilizing circle and the colony diameter (d) produced by each strain on the solid plate on the fifth day were measured respectively, and the solubility index (D / d) was calculated. The phosphate - solubilizing ability of the strains was preliminarily judged according to the solubility index.

[0037] The shake - flask method was used for rescreening the phosphate - solubilizing ability of the strains. Strains with obvious phosphate - solubilizing effects were inoculated into PDB liquid medium, cultured in a shaker at 28 °C and 180 r / min for 7 d, and adjusted to a bacterial suspension of 1×10 8 cfu / mL with sterile water. They were inoculated into 50 mL of sterilized inorganic - phosphorus liquid medium and organic - phosphorus liquid medium respectively at an inoculation amount of 1% with three replicates for each strain. Then, the medium without inoculation was used as the control group, and it was placed in a shaker at 28 °C and 180 r / min for 7 d. 10 mL of the culture solution of each strain was taken for centrifugation, and the supernatant was used to measure the ability to decompose organic phosphorus and dissolve inorganic phosphorus by the molybdenum blue colorimetric method. The phosphate - solubilizing amount of the strains was calculated through the phosphorus standard curve y = 0.011x - 0.0018.

[0038] The results of the determination of the ability of strains to decompose organic phosphorus and inorganic phosphorus are shown in Table 1 and Table 2.

[0039] Table 1 Determination of the ability of strains to dissolve organic phosphorus

[0040]

[0041] Note: Different letters in the same column indicate significant differences among treatments (P<0.05). The same applies to the following tables.

[0042] Table 2 Determination of the ability of strains to dissolve inorganic phosphorus

[0043]

[0044] The results of Table 1 and Table 2 show that in the primary screening, the organic phosphorus solubility index of strain PSR-26 is 1.463, and the inorganic phosphorus solubility index is 1.373, indicating that the strain has the ability to dissolve organic phosphorus and inorganic phosphorus. In the secondary screening, the amount of organic phosphorus dissolved by strain PSR-26 is 30.56 μg / mL, and the amount of inorganic phosphorus dissolved is 5.59 μg / mL.

[0045] B. Determination of the potassium-dissolving ability of strains

[0046] The tested strains (bacterial cakes with a diameter of 3 mm) were inoculated on the potassium-dissolving selective medium and cultured in an incubator at 28°C for 5 days. Observe whether a transparent circle appears around the colony. If there is a transparent circle, measure the diameter of the potassium-dissolving circle (D) and the colony diameter (d) of the strain, and calculate the solubility index (D / d) to determine the potassium-dissolving ability of the strain. The results are shown in Table 3.

[0047] Table 3 Determination of the potassium-dissolving ability of strains

[0048]

[0049] The results of Table 3 show that the potassium-dissolving solubility index of strain PSR-26 is 1.4, indicating that it has the ability to dissolve potassium.

[0050] C. Determination of the nitrogen-fixing ability of strains

[0051] The tested strains were streaked and inoculated on the nitrogen-fixing selective medium and cultured in an incubator at 28°C for 5 days. Observe the growth of the strains, and continuously inoculate the strains with good growth three times. Record the growth status of different strains and judge the size of the nitrogen-fixing ability. The results are shown in Table 4.

[0052] Table 4 Determination of the nitrogen-fixing ability of strains

[0053]

[0054] Note: "++" indicates good growth of the strain, "+" indicates general growth of the strain, and "-" indicates no growth of the strain.

[0055] Table 4 results show that PSR-26 grows well in nitrogen-fixing medium and has good nitrogen-fixing ability.

[0056] D. Determination of siderophore production ability

[0057] For the primary screening by the plate method, the test strains (bacterial cakes with a diameter of 3 mm) were inoculated into CAS medium and cultured in an incubator at 28 °C for 5 days. Observe whether there is an orange halo around the colony. If there is an orange halo, measure the diameter (D) of the orange-yellow halo and the diameter (d) of the colony produced by each strain on the solid plate on the third day, and calculate the solubility index (D / d). The ability of the strain to secrete siderophores was initially judged by the solubility index.

[0058] For the rescreening of the siderophore production ability of the strains by the shake flask method, the strains with a siderophore solubility index greater than 2 were inoculated into PDB liquid medium and cultured in a shaker at 28 °C and 180 r / min for 7 days, and then adjusted to a bacterial suspension of 1×10 8 cfu / mL with sterile water and inoculated into 50 mL of MKB liquid medium at an inoculation amount of 1%, with 3 replicates for each strain. Among them, non-inoculated was used as the control, and it was placed on a shaker at 28 °C and 180 r / min for 7 days. The culture solution was centrifuged at 4 °C and 10,000 r / min for 5 min, and the supernatant was taken and an equal volume of CAS detection solution was added to measure the value, which was recorded as the measured value A. The value measured by adding an equal volume of CAS detection solution to the non-inoculated MKB liquid medium was recorded as the control reference value Ar, and the absorbance was measured at OD 680 nm. The formula for the strength of siderophore ability is: relative expression of siderophore = (Ar - A) / Ar × 100%. The results of the siderophore production ability of the strains are shown in Table 5.

[0059] Table 5 Determination of siderophore production ability of strains

[0060]

[0061]

[0062] Table 5 results show that the siderophore solubility index of strain PSR-26 is 2.143, indicating its ability to produce siderophores, and the relative expression of siderophores is 41.47%.

[0063] E. Determination of indole-3-acetic acid (IAA) production ability

[0064] The test strains were inoculated into PDB liquid medium and cultured in a shaker at 28 °C and 180 r / min for 7 days, and then adjusted to a bacterial suspension of 1×10 8The bacterial suspension with a concentration of cfu / mL was inoculated into 50 mL of King liquid medium at an inoculation amount of 1% respectively, with 3 replicates for each strain. The non-inoculated group was used as the control, and they were placed on a shaker and cultured at 28 °C and 180 r / min for 7 days. 10 mL of the culture solution was taken for centrifugation, and the supernatant was used to measure the absorbance value at 530 nm by the Salkowski II colorimetric method. The IAA production of the strain was calculated through the IAA standard curve y = 0.0051x - 0.0099. The results are shown in Table 6.

[0065] Table 6 Determination of the IAA production ability of the strains

[0066]

[0067] The results in Table 6 show that the secretion amount of IAA by the PSR-26 strain is 33.97 μg / mL, indicating its ability to produce IAA.

[0068] F. Determination of multi-functional strains

[0069] By comprehensively comparing the abilities of each strain in phosphate solubilization, potassium solubilization, nitrogen fixation, IAA production, and siderophore production, the PSR-26 strain has obvious pleiotropic functions and is a multi-functional plant growth-promoting fungus.

[0070] Example 3 Strain identification

[0071] The genomic DNA of the PSR-26 strain was extracted using the Shengong Fungal Genomic DNA Rapid Extraction Kit; the fungal rDNA ITS region was amplified using the universal primer ITS1 sequence (5’-TCCGTAGGTGAACCTGCGG-3’; SEQ ID NO.1) and ITS4 sequence (5’-TCCTCCGCTTATTGATATGC-3’; SEQ ID NO.2). The DNA samples that passed the electrophoresis detection were sent to Shengong Bioengineering Co., Ltd. for sequencing. The obtained sequence results were submitted to the GenBank database of NCBI for homologous sequence search (BLAST serach) for molecular identification of the strain. The sequence of the strain with the highest homology to the target sequence was selected for comparison, and a phylogenetic tree (Neighbor-Joining) was constructed using MEGA 11 ( Figure 1 ).

[0072] The sequencing result of the rDNA ITS region of the PSR-26 strain is shown in SEQ ID NO.3.

[0073] GTTTCGGGCTATCCACTCCCACCCTATGTGAACCTACCTTTATGTTGCTTCGGCGGTCTCGCGCCGGGTTGCTCCCCTGGGGGCTCCCGGGACCACGCGTCCGCCGGAGACCACAAACTCTTGATTTTGCGAAAGCAGTATTATTCTGAGTGGCCGAAAGGCAAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTCGTCTTCATTGACGGGATCGGTGTTGGGACCCGGCGAGCGGGGACTTTTGTCCTCTGCCGGCCCCGAAATTCAGTGGCGGCCCGTTGCGGCGACCTCTGCGTAGTAACTCAACCTCGCACCGGTAACAGCATCGTGGCCACGCCGTAAAACCCCCGACTTTTATAAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGACCTGTGTGAAATTGTTATCCGC; SEQ ID NO.3。

[0074] Based on the gene sequencing results, the taxonomic name of strain PSR-26 was determined to be Simplicillium lanosoniveum. The colonies on the PDA plate are as Figure 2 shown, white, with vigorous hyphae, fast growth rate, rough surface like villi, irregular edges, and slightly raised.

[0075] The preservation number of the multifunctional rhizosphere growth-promoting fungus PSR-26 of Polygonatum sibiricum is CGMCC No. 41690. It has been preserved in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, abbreviated as CGMCC, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The preservation date is December 9, 2024, and the taxonomic name is Simplicillium lanosoniveum.

[0076] Example 4 Effect of the rhizosphere growth-promoting fungus PSR-26 of Polygonatum sibiricum on wheat seed germination and seedling growth

[0077] Preparation of the multifunctional growth-promoting bacterium PSR-26 agent: Inoculate PSR-26 into the PDB liquid medium, and shake and culture it at 28 °C and 200 rpm for 7 days, and then adjust it to a bacterial suspension of 1×10 7 cfu / mL with sterile water, which is the liquid bacterial agent.

[0078] Soak the wheat seeds of Longyu 12 in distilled water at 75 °C for 30 seconds, then disinfect them with 75% ethanol solution for 10 minutes, wash them with sterile water, and after drying the surface moisture, place the wheat seeds in the PSR-26 agent for 2 hours of seed soaking, and at the same time set the seed soaking with distilled water as the control (CK). After air-drying the seeds treated with the agent, evenly place them in a germination box lined with double-layer germination paper, and place the germination box in a constant temperature incubator at 25 °C with a light / dark cycle of 12 h / 12 h for a germination test. From the time when the seeds are placed on the bed, with the radicle breaking through the seed coat by 1 mm as the standard, count the number of germinated seeds every day and replenish distilled water in a timely manner. After 5 days, end the germination test, and calculate its germination rate, germination potential, germination index, and vigor index. The results are shown in Table 7. Continue the light culture for 3 days to end the seedling growth test. Select 10 seedlings, measure their root length, plant height, and fresh weight respectively, and determine the root activity; the root activity is determined by the 2,3,5-triphenyltetrazolium chloride (TTC) method. The results are shown in Table 8.

[0079] Germination rate = (number of germinated seeds / total number of seeds) × 100%

[0080] Germination potential = (number of germinated seeds within 3 days / total number of seeds) × 100%

[0081] Germination index = ΣG t / D t , where: G t is the number of germinations per day, and D t is the number of days of germination

[0082] Vigor index = germination index × average seedling length

[0083] Root activity = TTC reduction amount / (root weight × time)

[0084] Table 7 Effects of the plant growth-promoting rhizobacteria PSR-26 of Polygonatum sibiricum on wheat seed germination

[0085]

[0086] Note: Different lowercase letters represent significant differences between the PSR-26 group and the control group (P < 0.05).

[0087] The results in Table 7 show that the germination rate, germination potential, germination index, and vigor index of the wheat seeds treated with PSR-26 are significantly higher than those of the control group; compared with the control group, on the first day of seed germination treated with PSR-26

[0088] The germination rate increased by 220%, and on the second day, the germination rate increased by 54.55%; on the third day, the seed germination rate reached 95.56%, and the seed germination ended. The germination potential increased by 14.68% compared with the control group.

[0089] Table 8 Effects of Plant Growth-Promoting Rhizosphere Fungi PSR-26 of Polygonatum sibiricum on the Growth of Wheat Seedlings

[0090]

[0091] Note: Different lowercase letters indicate significant differences between the PSR-26 group and the control group (P < 0.05).

[0092] The results in Table 8 show that the root length, plant height, root activity, and fresh weight of wheat seedlings in the PSR-26 group were significantly higher than those in the control group; compared with the control group, after the treatment with PSR-26, the root length of the seedlings increased by 0.7 cm, the plant height increased by 0.6 cm, and the fresh weight increased by 0.039 g.

[0093] The figure showing the effect of strain PSR-26 on the growth of wheat seedlings is shown in Figure 3 。

[0094] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A multifunctional rhizosphere growth-promoting fungus PSR-26, whose preservation number is CGMCC No.41690 and classification name is Simplicillium lanosoniveum.

2. Application of the multifunctional Polygonatum sibiricum rhizosphere growth-promoting fungus PSR-26 described in claim 1 in phosphate solubilization.

3. Application of the multifunctional Polygonatum sibiricum rhizosphere growth-promoting fungus PSR-26 described in claim 1 in potassium solution.

4. Application of the multifunctional rhizosphere growth-promoting fungus PSR-26 described in claim 1 in nitrogen fixation.

5. Use of the multifunctional Polygonatum sibiricum rhizosphere growth-promoting fungus PSR-26 described in claim 1 in producing siderophores.

6. Application of the multifunctional Polygonatum sibiricum rhizosphere growth-promoting fungus PSR-26 described in claim 1 in producing IAA.

7. Use of the multifunctional Polygonatum sibiricum rhizosphere growth-promoting fungus PSR-26 described in claim 1 in promoting wheat seed germination.

8. Use of the multifunctional Polygonatum sibiricum rhizosphere growth-promoting fungus PSR-26 described in claim 1 in promoting the growth of wheat seedlings.

Images