Lactobacillus plantarum with phenyllactic acid biosynthesis performance and application of lactobacillus plantarum

By screening and identifying Lactobacillus endogenous plantarum CJEL01, this strain significantly increased the yield of benzene lactic acid under the fermentation conditions of kumquat pulp and phenylpyvate, solving the problem of low yield of benzene lactic acid synthesis in the prior art, and realizing the application of industrial fermentation production and food preservation.

CN120059999APending Publication Date: 2025-05-30GUILIN UNIVERSITY OF TECHNOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510021891.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-07
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

In the prior art, the synthesis yield of lactic acid bacteria is low and cannot meet market demand. Research on the synthesis of benzene lactic acid bacteria in kumquat endogenous lactic acid has not been reported.

Method used

A strain of Lactobacillus endogenous plant Lactobacillus CJEL01 was screened and identified. This strain can significantly improve the synthesis efficiency of benzene lactic acid when using kumquat pulp as the fermentation raw material and adding phenypyruvate as the substrate.

Benefits of technology

Through bioconversion technology, Lactobacillus plantarum CJEL01 is used to convert phenylphenic acid into benzene lactic acid, which increases the yield of benzene lactic acid, realizes the possibility of industrial fermentation and production, and provides the application of natural antibacterial agents for the field of food preservation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120059999A_ABST
    Figure CN120059999A_ABST
Patent Text Reader

Abstract

The invention discloses lactobacillus plantarum with phenyllactic acid biosynthesis performance and application of the lactobacillus plantarum, and belongs to the technical field of biology. The invention provides lactobacillus plantarum CJEL01, which is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number of the lactobacillus plantarum CJEL01 is CGMCC No.30204, and the preservation date of the lactobacillus plantarum CJEL01 is March 29, 2024. The lactobacillus plantarum CJEL01 provided by the invention can be used for synthesizing phenyllactic acid by using kumquat pulp, phenylalanine and phenylpyruvic acid, and has the characteristics of simple steps, environmental protection, no pollution and the like, and the obtained fermentation liquor has great application potential in the aspect of food preservation, and lays a foundation for research and development of natural bacteriostatic agent products of citrus flavones, polyphenols and phenyllactic acid in the later period.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a Lactobacillus plantarum with the ability of biosynthesizing phenyllactic acid and its application. Background Art

[0002] Phenyllactic acid (PLA), chemically named 2-hydroxy-3-phenylpropionic acid, is a new type of biological preservative widely existing in nature and having a broad-spectrum antibacterial effect. The molecular formula of phenyllactic acid is C 9 H 10 O 3 , with a relative molecular mass of 166 g / mol, a density of 1.3 ± 0.1 g / m 3 , a melting point of 121 - 125 °C, and can maintain its structure without being damaged at 121 °C for 20 min. Its second carbon atom is a chiral carbon atom, so there are two enantiomers, namely D-phenyllactic acid and L-phenyllactic acid. Except for the different structures, there are no obvious differences in properties such as relative density, melting point, and boiling point between the two. Phenyllactic acid has strong water solubility, is easy to dissolve and diffuse in water, and its solubility changes with temperature and can be evenly diffused in the food system. At the same time, it is stable to acids and heat. The basic properties of phenyllactic acid make it have better application prospects.

[0003] Phenyllactic acid can inhibit the growth and reproduction of microorganisms by destroying the cell wall of microorganisms or interfering with the expression of proteins, and has the advantages of broad-spectrum antibacterial property, high safety, wide source, strong stability, and good hydrophilicity, and gradually replaces chemical preservatives to become a new type of additive. The application range of phenyllactic acid is very wide. As a natural preservative, it can be widely used in the food industry, and is also used in the pharmaceutical and cosmetic industries, and is used to replace antibiotics in the aquaculture industry. As a kind of fruit acid, phenyllactic acid not only has the effects of removing wrinkles, moisturizing, whitening, and lightening spots, but also can be used as a preservative to prevent microbial contamination and thus extend the shelf life of skin care products. In the aquaculture industry, when the feed preservative is added improperly, it will cause the residue of antibacterial drugs to exceed the standard. Appropriate addition of phenyllactic acid can extend the storage time of feed.

[0004] The kumquat is a plant of the genus Citrus in the Rutaceae family, rich in nutrients and with high economic benefits. Research at home and abroad has shown that citrus contains abundant nutrients such as vitamins, amino acids, citric acid, pectin, dietary fiber, trace elements, etc., as well as bioactive components such as flavonoids, essential oils, organic acids, limonoids, and carotenoids, with high comprehensive utilization value. Citrus polyphenols and flavonoids have good antibacterial and antioxidant activities, but their activities are relatively weak and limited. Lactic acid bacteria are generally considered safe and are used as bioprotective bacteria in food systems. Through nutritional and spatial competition, they produce various antibacterial active compounds such as organic acids, hydrogen peroxide, cyclic dipeptides, and bacteriocins, enabling them to exhibit strong antagonistic abilities and antibacterial activities. As one of the organic acids produced by lactic acid bacteria, phenyl lactic acid has also received increasing attention due to its broad-spectrum antibacterial activity. Currently, the synthesis of phenyl lactic acid by endogenous lactic acid bacteria in kumquats has not been reported. The synthesis of phenyl lactic acid is a basic characteristic of most lactic acid bacteria, but the yields are mostly low, and the production scale cannot meet market needs. Therefore, screening for high-yield strains of phenyl lactic acid is of great significance for improving the production efficiency and yield of phenyl lactic acid, and for realizing the industrial fermentation production of phenyl lactic acid and the development of green preservatives. Summary of the Invention

[0005] The object of the present invention is to provide a Lactobacillus plantarum with the performance of biosynthesizing phenyl lactic acid and its application to solve the problems existing in the above-mentioned prior art. The Lactobacillus plantarum CJEL01 provided by the present invention has a high efficiency of synthesizing phenyl lactic acid when using kumquat pulp as the fermentation raw material (kumquat pulp concentration is 150 g / L) and phenylpyruvic acid as the substrate, providing theoretical and technical support for future research on improving the production of phenyl lactic acid and its application in the field of food preservation.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] Technical solution one: A Lactobacillus plantarum CJEL01, deposited in the China General Microbiological Culture Collection Center, with the deposit number CGMCC No. 30204, and the deposit date is March 29, 2024.

[0008] Technical solution two: A bacterial agent, the active ingredient includes the Lactobacillus plantarum CJEL01 described above.

[0009] Preferably, the bacterial agent includes the Lactobacillus plantarum CJEL01 and / or its metabolites.

[0010] Preferably, the metabolite is phenyl lactic acid synthesized using kumquat pulp (150 g / L) and phenylpyruvic acid.

[0011] Technical solution three: Application of the Lactobacillus plantarum CJEL01 or the microbial agent in the preparation of phenyl lactic acid.

[0012] Technical solution four: A preparation method of phenyl lactic acid, comprising the step of inoculating and fermenting the Lactobacillus plantarum CJEL01.

[0013] Further, the preparation method comprises the following steps: First, activate the Lactobacillus plantarum CJEL01, perform liquid culture to prepare a seed solution, and then inoculate the seed solution into a fermentation medium for culture to obtain the phenyl lactic acid.

[0014] Further, the conditions for the liquid culture are: temperature is 30 °C, rotation speed is 150 r / min, and the oscillation culture time is 24 h.

[0015] Further, the fermentation medium uses phenylpyruvic acid as a substrate, and the components of the fermentation medium include: 5 g / L phenylpyruvic acid, 150 g / L kumquat pulp, and 20 g / L glucose.

[0016] Further, the pH of the fermentation medium is 6.

[0017] Further, the inoculation amount for inoculating and culturing in the fermentation medium is 6%, the culture temperature is 30 °C, and the time is 120 h.

[0018] Technical solution five: Phenyl lactic acid prepared by the described preparation method.

[0019] The present invention discloses the following technical effects:

[0020] An endogenous Lactobacillus plantarum CJEL01 of kumquat screened in the present invention has been proven by experiments that this Lactobacillus plantarum CJEL01 can use kumquat pulp (150 g / L) as a fermentation raw material, and the yield of phenyl lactic acid can be increased when phenylpyruvic acid substrate is added. The present invention uses the means of biotransformation, that is, using the endophytic bacteria of kumquat - Lactobacillus plantarum CJEL01, to study the use of phenylpyruvic acid as a substrate to increase the yield of phenyl lactic acid, which has the advantages of simple steps, being green, environmentally friendly and pollution - free, and laying a foundation for the preparation of natural bacteriostatic agents by lactic acid bacteria fermentation of kumquat and its application in the food field. In addition, the present invention has also optimized the conditions for increasing the yield of phenyl lactic acid. The present invention uses single - factor experiments to investigate the influence of different fermentation conditions of Lactobacillus plantarum CJEL01 on the production of phenyl lactic acid under phenylpyruvic acid substrate, and finally obtains the optimal fermentation scheme for the production of phenyl lactic acid by Lactobacillus plantarum CJEL01, improving the yield of phenyl lactic acid and providing technical support for the industrial production of phenyl lactic acid. Citrus polyphenols and flavonoids have good antibacterial and antioxidant activities, but they are limited due to weak activities, and phenyl lactic acid is one of the organic acids produced by lactic acid bacteria. Therefore, the endogenous Lactobacillus plantarum CJEL01 of kumquat screened in the present invention lays a foundation for the later research and development of natural bacteriostatic agent products of citrus flavonoids, polyphenols and phenyl lactic acid. Brief Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the following - described drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0022] Figure 1 It is a primary - screening plate picture of strain CJEL01;

[0023] Figure 2 It is the colony morphology of strain CJEL01 on solid MRS medium;

[0024] Figure 3 It is the influence of the addition amount of phenylpyruvic acid substrate on the yield of phenyl lactic acid;

[0025] Figure 4 It is the influence of the addition amount of kumquat pulp on the yield of phenyl lactic acid;

[0026] Figure 5 It is the influence of the addition amount of glucose on the yield of phenyl lactic acid;

[0027] Figure 6 It is the influence of fermentation temperature on the yield of phenyl lactic acid;

[0028] Figure 7 It is the influence of the initial pH on the yield of phenyl lactic acid;

[0029] Figure 8 Effect of fermentation time on the yield of phenyl lactic acid Detailed implementation manners

[0030] The various exemplary implementation manners of the present invention will be described in detail below. This detailed description should not be considered as a limitation to the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention

[0031] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail

[0033] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary

[0034] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, that is, they are meant to include but not be limited to

[0035] Example 1 Isolation and identification of endogenous Lactobacillus plantarum CJEL014 from kumquat

[0036] 1 Isolation of strains

[0037] 1.1 Collect fresh and superficially healthy crispy kumquats from Yangshuo, Guilin, Guangxi. Select several intact crispy kumquat fruits of the same size without virus or pests. Wash the epidermal foreign matters with clean water and wipe them dry with filter paper. Sterilize and clean the pulverizer with 75% ethanol by volume, and rinse it 3 times with sterile water to remove ethanol. Place the crispy kumquat materials on a sterile operating table, immerse the crispy kumquats completely in 75% ethanol by volume for 1 min, and then wash them 3 times with sterile water. Take 0.5 mL of the sterile water used to wash the pulverizer and the crispy kumquats 3 times respectively, spread them on the LB medium plate, set 3 groups in parallel, let them stand for 5 min, then invert and culture them in an incubator under the same conditions for 24 h. Observe whether there are bacteria. If there are no bacteria, the disinfection is thorough; if there are bacteria, the disinfection is not thorough and the materials need to be disinfected again.

[0038] 1.2 Place the superficially sterile crispy kumquat fruits in a sterile pulverizer and pulverize them. Sieve them through a 60-mesh sieve. Add the pulverized crispy kumquats to the MRS liquid medium containing 2.0 g / L of phenyl lactic acid (purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.) at a ratio of 1:9 (g / mL). Let it stand and culture in an incubator at 30 °C for 48 h. Take the fermentation broth and add it to the enrichment medium (the component is the MRS liquid medium containing 2.0 g / L of phenyl lactic acid) at a ratio of 1:9 (mL / mL). Let it stand and culture in an incubator at 30 °C for 24 h.

[0039] 1.3 Primary screening of lactic acid bacteria producing phenyl lactic acid

[0040] Extract 1 mL of the fermentation broth of endophytic bacteria from crispy kumquat fruits and dilute it stepwise with sterile water to 10 -1 、10 -2 、10 -3 、10 -4 and 10 -5 Five concentrations. Respectively pipette 100 μL and inject it into the lower layer of the primary screening medium (the component is the MRS solid medium containing 2.0 g / L of phenylalanine), then culture it in an incubator at 30 °C for 24 h, and then inject the upper layer of the primary screening medium (the component is the MRS solid medium containing 30 g / L CaCO 3 ). Culture it in an incubator at 30 °C for 24 h. Pick the colonies with large calcium dissolution circles and streak and purify them multiple times until single colonies without contaminants are obtained, as shown in Figure 1 and Figure 2 . After obtaining the pure culture, number it, and inoculate the strain on the test tube slant medium. After culturing at a constant temperature of 30 °C for 24 h, store it in a refrigerator at 4 °C.

[0041] 1.4 Re-screening of lactic acid bacteria producing phenyl lactic acid

[0042] The strains after primary screening were respectively inoculated into MRS liquid medium containing 2.0 g / L phenylalanine, MRS liquid medium containing 2.0 g / L phenylpyruvic acid, and MRS liquid medium without substrate, and then placed in an incubator at 30 °C for static culture for 48 h. After the fermentation broth was centrifuged at 10000 r / min for 5 min and filtered through a 0.22 μm filter membrane, the content of phenyl lactic acid was analyzed by an Agilent 1260 high performance liquid chromatograph. The strain with the highest phenyl lactic acid content (strain number CJEL01) was selected as the target strain. Chromatographic column: Waters Symmetry C18 chromatographic column (5 μm, 4.6 mm × 250 mm), column temperature: 30 °C, injection volume: 10 μL, flow rate: 1.0 mL / min, mobile phase A: methanol solution of 0.05% trifluoroacetic acid by volume, B phase: aqueous solution of 0.05% trifluoroacetic acid by volume, the elution program was A:B = 40:60 (v / v), isocratic elution, detection duration 27 min, detection wavelength 210 nm.

[0043] Identification of the strain

[0044] 2.1 Identification of the physiological and biochemical reactions of the strain, and the results are shown in Table 1.

[0045] Table 1

[0046]

[0047] Note: "+" indicates positive; "-" indicates negative.

[0048] Combined with the morphological identification and physiological and biochemical characteristics of the strain, referring to the "Manual for the Systematic Identification of Common Bacteria", it was found that the strain isolated in the present invention was similar to Lactobacillus plantarum, and was named Lactobacillus plantarum CJEL01.

[0049] 2.2 Gene identification

[0050] The DNA genome of Lactobacillus plantarum CJEL01 was extracted and the PCR amplification reaction was respectively carried out using the bacterial genome DNA extraction kit and the bacterial genome PCR amplification kit provided by Sangon Biotech (Shanghai) Co., Ltd. The specific extraction and amplification steps were carried out according to the kit instructions. The PCR amplification primers were 1492R and 27F:

[0051] 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO.1);

[0052] 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.2).

[0053] The amplification procedure was as follows: pre-denaturation at 94°C for 5 min, 94°C for 30 s; 55°C for 30 s, 72°C for 2 min, with 35 cycles; extension at 72°C for 7 min. After the PCR amplification reaction was completed, agarose gel electrophoresis of the PCR products was carried out using 1% agarose gel, 0.5×TBE as the electrophoresis buffer, and a voltage of 80 V. After the PCR products were detected by agarose gel electrophoresis, they were sent to Sangon Biotech (Shanghai) Co., Ltd. for detection. The results of the detection (the nucleotide sequence is shown as SEQ ID NO.3) were logged onto the NCBI website in the United States (http: / / blast.ncbi.nlm.nih.gov / ) for DNA Blast alignment, and a phylogenetic tree was constructed using MEGA5.0 software to determine that the strain belongs to Lactobacillus plantarum.

[0054] SEQ ID NO.3:

[0055]

[0056] Lactobacillus plantarum CJEL01 was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on March 29, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 30204.

[0057] Fermentation method for Lactobacillus plantarum CJEL01 to synthesize phenyl lactic acid using phenylpyruvic acid in Example 2

[0058] 1 Determination of the production amount of phenyl lactic acid in the fermentation broth of Lactobacillus plantarum CJEL01 strain

[0059] The screened strains were respectively inoculated into a liquid medium containing 5.0 g / L phenylpyruvic acid, 150 g / L kumquat pulp, and 20 g / L glucose, and placed in an incubator at 30 °C for static culture for 120 h. After the fermentation broth was centrifuged at 10000 r / min for 5 min and filtered through a 0.22 μm filter membrane, the content of phenyl lactic acid was analyzed by an Agilent 1260 high performance liquid chromatograph. Chromatographic column: Waters Symmetry C18 chromatographic column (5 μm, 4.6 mm × 250 mm), column temperature: 30 °C, injection volume: 10 μL, flow rate: 1.0 mL / min, mobile phase A: methanol solution of trifluoroacetic acid with a volume fraction of 0.05%, B phase: aqueous solution of trifluoroacetic acid with a volume fraction of 0.05%, the elution program was A:B = 40:60 (v / v), isocratic elution, detection duration 27 min, detection wavelength 210 nm.

[0060] 2 Study on the culture conditions of Lactobacillus plantarum CJEL01 strain

[0061] Taking the production amount of phenyl lactic acid as an index, the addition amounts of phenylpyruvic acid (1.0, 2.0, 3.0, 4.0, 5.0, 6.0 g / L), kumquat pulp (50, 100, 150, 200, 250 g / L), glucose (10, 15, 20, 25, 30 g / L), fermentation temperature (26, 30, 34, 38, 42 °C), initial pH (3.0, 4.0, 5.0, 6.0, 7.0), and fermentation time (24, 48, 72, 96, 120, 144 h) for Lactobacillus plantarum CJEL01 fermentation substrate were optimized to explore the effects of the above conditions on the yield of phenyl lactic acid.

[0062] As Figures 3 - 8As shown, the results show that the optimal culture conditions for Lactobacillus plantarum CJEL01 to produce phenyl lactic acid under phenylpyruvic acid substrate are as follows: the addition amount of phenylpyruvic acid as the fermentation substrate is 5.0 g / L, the fermentation temperature is 30 °C, the fermentation time is 120 h, the initial pH is 6, the inoculation amount is 6%, the liquid loading amount is (180 / 250 mL), and the production amount of phenyl lactic acid is 4.50 g / L.

[0063] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A Lactobacillus plantarum (Lactobacilus plantarum) CJEL01, characterized in that It is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.30204 and the deposit date March 29, 2024.

2. A bacterial agent, characterized in that The active ingredient comprises the Lactobacillus plantarum CJEL01 described in claim 1.

3. Use of the plant lactobacillus CJEL01 described in claim 1 or the bacterial agent described in claim 2 in the preparation of phenyllactic acid.

4. A method for preparing phenyllactic acid, characterized in that: The method comprises the step of inoculating and fermenting the Lactobacillus plantarum CJEL01 described in claim 1.

5. The preparation method according to claim 4, characterized in that: The following steps are involved: The Lactobacillus plantarum CJEL01 is first activated, and liquid culture is performed to prepare seed liquid, and then the seed liquid is inoculated into a fermentation medium for culture to obtain the phenyllactic acid.

6. The preparation method according to claim 5, characterized in that: The conditions of the liquid culture are: temperature of 30° C., rotation speed of 150 r / min, and shaking culture time of 24 h.

7. The preparation method according to claim 5, characterized in that: The fermentation medium uses phenylpyruvic acid as a substrate, and the components of the fermentation medium include: 5g / L phenylpyruvic acid, 150g / L kumquat pulp and 20g / L glucose.

8. The preparation method according to claim 5, characterized in that: The pH of the fermentation medium is 6.

9. The preparation method according to claim 5, characterized in that: The inoculation amount in the fermentation medium is 6%, the culture temperature is 30° C., and the culture time is 120 hours.

10. Phenyllactic acid prepared by the preparation method according to any one of claims 4 to 9.