Recombinant escherichia coli for producing butyric acid and construction method thereof
By enhancing the expression of PanF protein-encoding genes in E. coli, the RBS library of the M1-93 promoter regulates gene transcription and translation, the problem of insufficient butyric acid production capacity of microorganisms is solved, and the effect of significantly improving butyric acid yield and sugar acid conversion rate is achieved.
Patent Information
- Application Number
- CN202311619963.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-30
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art is difficult to effectively improve the ability of microorganisms to produce butyric acid, especially due to the harsh culture conditions of Clostridium butyric acid and the difficulty of genetic modification.
By enhancing the expression of PanF protein-encoding genes in E. coli, the M1-93 promoter RBS library regulates gene transcription and translation, significantly increasing butyrate production.
The butyric acid production of E. coli has been increased by 53.11 times, and the sugar acid conversion rate has reached 0.82mol/mol, which has significantly improved the production capacity of microbial butyric acid.
Smart Images

Figure BDA0004578992640000051 
Figure BDA0004578992640000052 
Figure BDA0004578992640000061
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly relates to a recombinant Escherichia coli for producing butyric acid and a method for constructing the same. Background Art
[0002] Butyric acid (C 4 H 8 O 2 ) is an aliphatic short-chain fatty acid and is widely used in industries such as agriculture, industry, medicine, and food. For example, it is added to feed as an antibiotic alternative; as a raw material for fine chemicals to produce cellulose acetate butyrate polymers; as a pharmaceutical precursor, it can produce the neurotransmitter inhibitor γ-aminobutyric acid; as a raw material to produce the flavoring butyl butyrate for the food industry.
[0003] Clostridium butyricum is a natural butyric acid-producing bacterium, but it is a strict anaerobe with harsh culture conditions, difficult genetic modification, and a long modification cycle. Compared with Clostridium butyricum, Escherichia coli has a clear genetic background, mature operating techniques, and the modification of Escherichia coli to produce butyric acid has become a research hotspot. Summary of the Invention
[0004] The problem to be solved by the present invention is how to improve the ability of microorganisms to produce butyric acid.
[0005] To solve the above problems, the present invention provides a recombinant enterobacterium.
[0006] The recombinant enterobacterium provided by the present invention is a recombinant bacterium obtained by enhancing the expression of the coding gene of the pantothenate transporter (abbreviated as PanF protein) of the recipient enterobacterium.
[0007] In this article, the enhanced expression can be achieved by regulating the expression at the transcriptional level or translational level of the protein-coding gene.
[0008] The expression level of a protein is determined by transcription, translation, and degradation, and transcription and translation are usually rate-limiting steps. Transcription initiation is controlled by promoter elements, and translation initiation is mainly affected by the strength of the ribosome binding site (RBS).
[0009] The promoter is located upstream of the gene transcription start site, is the recognition and binding site of RNA polymerase, and is an important element determining the level of gene transcription. The σ factor can recognize the key region of different types of promoter sequences. During the metabolic process, different types of promoters can be used to regulate the transcription of key genes, change the metabolic flux, strengthen or weaken the expression of related genes in the metabolic pathway, and obtain the corresponding metabolic products.
[0010] The RBS sequence, also known as the SD (Shine-Dalgarno) sequence, is a key region that controls translation initiation and protein expression and determines the level of translation. Research shows that using an appropriate RBS can enhance the expression of related proteins, regulate metabolic processes, and increase the yield of target products.
[0011] In terms of precise regulation of gene expression, one currently effective strategy is to use a promoter library to regulate the expression of a specific gene on the host microorganism chromosome, thereby screening for the optimal expression intensity.
[0012] In the present invention, the expression level of the recombinant bacterium obtained by enhancing the expression of the coding gene of the receptor Escherichia coli PanF protein is increased by 53.11 times compared to NZ-B016.
[0013] In this article, the promoter can be the M1-93 promoter RBS library, and the M1-93 promoter RBS library can be any of the following DNA molecules:
[0014] 1) A DNA molecule with the nucleotide sequence of SEQ ID No.1 in the sequence listing on one strand;
[0015] 2) A DNA molecule having more than 80% identity with the DNA molecule in 1) and having promoter function.
[0016] In the above-mentioned recombinant Escherichia coli, the element that enhances the expression of the coding gene of the receptor Escherichia coli PanF protein can be the DNA molecule shown in Sequence 1 in the sequence listing.
[0017] The receptor bacterium can be Escherichia coli NZ-B016.
[0018] The receptor bacterium does not contain lactate dehydrogenase gene, methylglyoxal synthase gene, propionate kinase gene, formate acetyltransferase gene, alcohol dehydrogenase gene, acetate kinase gene, and fumarate reductase gene; the recombinant Escherichia coli contains 3-hydroxybutyryl-CoA dehydrogenase gene, crotonase gene, trans-2-enoyl-CoA reductase gene, acyl-CoA transferase gene, M1-93 promoter, and RBSL1 sequence.
[0019] The receptor bacterium can be specifically constructed by referring to the method provided on pages 12 to 18 of CN116064546A: A Promoter for Regulating Butyric Acid Production and Its Application.
[0020] The above-mentioned recombinant Escherichia coli also contains a promoter that initiates the transcription of the PanF protein coding gene.
[0021] The promoter can be the M1-93 promoter RBS library, and the M1-93 promoter RBS library can be any of the following DNA molecules:
[0022] 1) A DNA molecule with the nucleotide sequence of SEQ ID No.1 in the sequence listing for one strand;
[0023] 2) A DNA molecule having more than 80% identity with the DNA molecule of 1) and having promoter function.
[0024] For the above-mentioned recombinant Escherichia coli, the PanF protein can be any of the following proteins:
[0025] A1) A protein encoding an amino acid sequence as described in SEQ ID No.3;
[0026] A2) A protein obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in A1), having more than 75% identity with the protein shown in A1) and having PanF protein activity;
[0027] A3) A fusion protein having PanF protein activity obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).
[0028] In the above-mentioned recombinant Escherichia coli, the coding gene of the PanF protein is any of the following:
[0029] C1) A DNA molecule with the nucleotide sequence as shown in SEQ ID No.2;
[0030] C2) A DNA molecule having more than 75% identity with the nucleotide sequence defined in C1) and encoding the PanF protein;
[0031] C3) A DNA molecule that hybridizes with any of the nucleotide sequences defined in C1)-C2) under stringent conditions and encodes the PanF protein.
[0032] Those of ordinary skill in the art can easily mutate the nucleotide sequence encoding the PanF protein of the present invention by known methods, such as directed evolution and point mutation methods. Those nucleotides that have been artificially modified and have more than 75% identity with the nucleotide sequence of the PanF protein of the present invention, as long as they encode the PanF protein and have cyanate transporter function, are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.
[0033] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity to the nucleotide sequence encoding the PanF protein of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0034] The above-mentioned identity of 75% or more can be 80%, 85%, 90% or 95% or more. The present invention also provides a method for constructing the recombinant Enterobacter described above, which is to regulate the production of butyric acid by microorganisms by regulating the expression of the coding gene of the PanF protein described above, or regulating the activity or content of the PanF transporter, so as to obtain microorganisms with changed butyric acid production.
[0035] In the above method, the method for regulating the expression of the coding gene of the PanF protein or regulating the activity or content of the PanF protein is to introduce a DNA molecule that enhances the expression of the PanF protein into the target microorganism.
[0036] In the above method, the DNA molecule can be any of the following 1), 2) or 3):
[0037] 1) The DNA molecule shown in Sequence 1 in the Sequence Listing;
[0038] 2) A DNA molecule that hybridizes with the DNA sequence defined in 1) under stringent conditions and has promoter function;
[0039] 3) A DNA molecule having 90% or higher identity to the DNA sequence defined in 1) or 2) and having promoter function.
[0040] In the above method, the recipient bacterium is Escherichia coli NZ-B016.
[0041] The present invention also provides a biological material containing the DNA molecule described above, and the biological material can be any of the following:
[0042] B1) An expression cassette containing the DNA molecule described above;
[0043] B2) A recombinant vector containing the DNA molecule described above, or a recombinant vector containing the expression cassette described in B1);
[0044] B3) A recombinant microorganism containing the DNA molecule described above, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2).
[0045] The vector described in this article refers to a vector that can carry exogenous DNA or a target gene into a host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmids, phages (such as λ phage or M13 filamentous phage, etc.), cosmids (i.e., cosmid plasmids), or viral vectors.
[0046] The microorganisms described in this article can be yeast, bacteria, algae, or fungi. Among them, the bacteria can be from the genus Escherichia (Escherichia sp.), the genus Erwinia (Erwinia sp.), the genus Agrobacterium (Agrobacterium sp.), the genus Flavobacterium (Flavobacterium sp.), the genus Alcaligenes (Alcaligenes sp.), the genus Pseudomonas (Pseudomonassp.), the genus Bacillus (Bacillus sp.), the genus Brevibacterium (Brevibacterium sp.), the genus Corynebacterium (Corynebacterium sp.), the genus Aerobacter (Aerobacter sp.), the genus Enterobacteria (Enterobacteria sp.), the genus Micrococcus (Micrococcus sp.), the genus Serratia (Serratia sp.), the genus Salmonella (Salmonellasp.), the genus Streptomyces (Streptomyces sp.), the genus Providencia (Providencia sp.), etc., but are not limited to this.
[0047] Furthermore, the bacteria can be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, or Corynebacterium pekinense.
[0048] In a specific embodiment, the Escherichia coli is the recombinant strain JH014. The recombinant strain JH014 is a recombinant Escherichia coli obtained by integrating the promoter RBSL14 into the start codon ATG of the panF gene of Escherichia coli NZ - B016.
[0049] Compared with the recombinant Escherichia coli NZ - B016, the recombinant bacterium JH014 replaces the fragment before the start codon ATG of the panF gene in NZ - B016 (the specific fragment is the nucleotide sequence at positions 487336 - 487335 of Genbank No.: NC_010468 (update date: January 27, 2012)) with the artificial promoter RBSL14 whose nucleotide sequence is SEQ ID No.1. The nucleotide sequence of RBSL14 is specifically: 5’ - TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCGTATTGTTAGCATGTACGT TTAAACCAGGAGATGCGTG - 3’.
[0050] The present invention also provides the application of the aforementioned Enterobacter and / or the aforementioned method in any one of the following:
[0051] E1) Application in regulating the butyric acid production of microorganisms;
[0052] E2) Application in the preparation of butyric acid;
[0053] E3) Application in constructing engineering microorganisms for butyric acid.
[0054] The present invention also provides the application of the aforementioned DNA molecule or the aforementioned biological material in any one of the following:
[0055] E1) Application in regulating the butyric acid production of microorganisms;
[0056] E2) Application in the preparation of butyric acid;
[0057] E3) Application in constructing engineering microorganisms for butyric acid.
[0058] By introducing the M1 - 93 promoter RBSL1 sequence that enhances the expression of the PanF protein before the promoter of the PanF protein - coding gene of Escherichia coli, the butyric acid production of the obtained recombinant Escherichia coli reaches 5.14 g / L, and the sugar - acid conversion rate reaches 0.82 mol / mol. The recombinant Escherichia coli and the construction method provided by the present invention have broad application prospects. Description of the Drawings
[0059] Figure 1 PCR verification fragment for the regulation of panF in recombinant Escherichia coli JH014. M is Marker, 1 represents strain ATCC8739, and 2 represents recombinant Escherichia coli JH014. Detailed Embodiments
[0060] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.
[0061] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0062] In the quantitative experiments in the following embodiments, unless otherwise specified, three repeated experiments are set up.
[0063] The NZ-B016 strain in the following embodiments was constructed according to the method provided on pages 12 to 18 of Patent CN116064546A: A Promoter for Regulating Butyric Acid Production and Its Application. The public can obtain this biological material from the applicant, and this biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.
[0064] The pXZ-CS plasmid in the following embodiments has been described in: Tan et al. 2013. Appl. Environ. Microbiol. 79, 4838 - 4844. The public can obtain this biological material from the applicant, and this biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.
[0065] The M1-93 in the following embodiments has been described in: Lu et al. 2012, Appl. Microbiol. Biotech. 93, 2455 - 2462.5. The public can obtain this biological material from the applicant, and this biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.
[0066] The strains used in the present invention are shown in Table 1, and the primers used are shown in Table 2.
[0067] Table 1. Strains Used in the Present Invention
[0068]
[0069] Table 2. Primers Used in the Present Invention
[0070]
[0071]
[0072] The following examples used SPSS 11.5 statistical software to process the data. The experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicated significant difference, P < 0.01 (**) indicated extremely significant difference, and P < 0.001 (***) indicated extremely significant difference.
[0073] Example 1. Construction of recombinant Escherichia coli JH010-JH014
[0074] Starting from recombinant Escherichia coli NZ-B016 (for the construction method, see Patent CN116064546A, a promoter for regulating butyric acid production and its application), the panF gene (the nucleotide sequence is from positions 485884 - 487335 of Genbank No. NC_010468 (update date: January 27, 2012)) was regulated by two-step homologous recombination.
[0075] Using the pXZ-CS plasmid as a template, PCR amplification was performed with primers panF-TK-cat-up / panF-TK-sacB-down (Table 2) to obtain a fragment of about 2.8 kb, panF-TK-cat-sacB (for the first-step homologous recombination). The fragment panF-TK-cat-sacB was introduced into recombinant Escherichia coli NZ-B016 to obtain a recombinant strain NZ-B016M in which the fragment panF-TK-cat-sacB was integrated before the start codon ATG of the chromosomal panF gene of recombinant Escherichia coli NZ-B016.
[0076] Using the genomic DNA of recombinant Escherichia coli M1-93 as a template, a 200-bp fragment (containing the promoter RBS library of M1-93) was obtained with primers panF-P-up / panF-RBSL-down (Table 2). This fragment was introduced into the recombinant strain NZ-B016M to obtain recombinant strains JH010-JH014 in which the fragment panF-TK-cat-sacB on the chromosome of the recombinant strain NZ-B016M was replaced with the promoter RBS library of M1-93.
[0077] Recombinant strains JH010-JH014 were obtained by integrating the promoter RBS library of Escherichia coli M1-93 before the start codon ATG of the chromosomal panF gene of Escherichia coli NZ-B016.
[0078] Example 2. Fermentation of recombinant Escherichia coli JH010-JH014
[0079] The seed medium was LB medium: 10 g / L tryptone; 5 g / L yeast extract; 10 g / L NaCl, and the rest was water.
[0080] Fermentation medium: glucose 20 g / L, yeast powder 5 g / L, KH 2 PO 4 3.5 g / L, K 2 HPO 4 6.55 g / L, (NH 4 ) 2 HPO 4 3.5 g / L, MgSO 4 ·7H 2 O 0.12 g / L and betaine-KCl 0.15 g / L, FeCl 3 ·6H 2 O 1.5 g / L, CoCl 2 ·6H 2 O 0.1 g / L, CuCl 2 ·2H 2 O 0.1 g / L, ZnCl 2 0.1 g / L, Na 2 MoO 4 ·2H 2 O 0.1 g / L, MnCl 2 ·4H 2 O 0.2 g / L, H 3 BO 3 0.05 g / L, and the rest is water.
[0081] Seed culture: Inoculate monoclonal strains JH010-JH014 into 100 mL of medium (in a 250 mL Erlenmeyer flask) and culture at 37 °C and 100 rpm for 12 hours to obtain a seed solution for inoculating the fermentation medium.
[0082] Fermentation culture: The volume of the fermentation medium in a 500 mL anaerobic tank is 250 mL. Inoculate the seed solution into the fermentation medium at an inoculum concentration of OD 550 = 0.1, at 37 °C, 150 rpm, and ferment for 1 day to obtain a fermentation broth. The neutralizing agent is 2 M KOH. The fermentation broth is all substances in the fermenter. No gas is introduced during the culture process.
[0083] Analysis method: Use an Agilent-1200 high-performance liquid chromatograph to measure the components in the 96-hour fermentation broth. The concentrations of glucose and organic acids in the fermentation broth are measured using an Aminex HPX–87H organic acid analysis column from Biorad.
[0084] Table 3. Butyric acid production capacity and sugar-acid conversion rate of recombinant Escherichia coli in the present invention
[0085] Strain <![CDATA[OD 55Onm > Butyric acid production (g / L) Sugar-acid conversion rate (mol / mol) NZ-B016 0.96 0.83±0.03 0.53±0.002 JH010 0.46 0.36±0.031 0.29±0.012 JH011 0.60 0.40±0.103 0.22±0.007 JH012 0.28 0.44±0.022 0.21+0.014 JH013 1.21 4.02±0.037 0.69±0.005 JH014 2.41 4.22±0.021 0.81±0.011
[0086] As can be seen from Table 3, after 96 hours of fermentation of JH014, the OD of the strain 550nm = 2.41; the butyric acid yield reached 4.22 g / L, and the sugar-acid conversion rate reached 0.81 mol / mol. The OD of the control strain Escherichia coli NZ-B016 550nm = 0.96; the butyric acid yield was 0.83 g / L, and the sugar-acid conversion rate was 0.53 mol / mol.
[0087] Example 3. Molecular Biology Analysis of Recombinant Escherichia coli JH014
[0088] The recombinant strain JH014 was verified by PCR and sequenced using the primers panF-TK-YZ-up / panF-TK-YZ-down (Table 2). The results are as Figure 1 shown. The amplified product of the recombinant strain JH014 was a fragment of approximately 362 bp, which consisted of 78 bp upstream of the panF gene promoter, 89 bp of the RBSL14 promoter, and 195 bp downstream of the panF gene promoter. The specific nucleotide sequence of the amplified product is as follows:
[0089]
[0090] The recombinant strain JH014 is a recombinant Escherichia coli obtained by integrating the promoter RBSL14 into the start codon ATG of the panF gene of the recombinant strain NZ-B016. Compared with the recombinant strain NZ-B016, the nucleotide sequence before the start codon ATG of the panF gene in the recombinant strain NZ-B016 is the fragment at positions 487336 - 487335 of Genbank accession number NC_010468 (update date January 27, 2012), which is replaced by the artificial promoter RBSL14 with the nucleotide sequence of SEQ ID No.1. The specific nucleotide sequence of RBSL14 is: 5’-TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCGTATTGTTAGCATGTACGT TTAAACCAGGAGATGCGTG-3’.
[0091] The 24-hour fermentation broths of the recombinant strains JH014 and NZ-B016 were sampled respectively, treated with liquid nitrogen, and re-sequencing and transcriptome analysis were completed by Novogene Bioinformatics Technology Co., Ltd. Each sample generated 1 Gb of clean data. The reference sequence for sequence analysis was the genomic sequence of ATCC 8739 (http: / / www.ncbi.nlm.nih.gov / nuccore / NC_010468.1). The results showed that the expression level of the panF gene was 47.08 in NZ-B016 and 2500.99 in JH014. The expression level of the panF gene was significantly increased in JH014, and the recombinant Escherichia coli JH014 was 53.11 times the expression level of NZ-B016.
[0092] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In general, according to the principle of the present invention, this application intends to cover any modifications, uses or improvements of the present invention, including those that depart from the scope disclosed in this application and are made with conventional techniques known in the art.
Claims
1. Recombinant Enterobacter, characterized in that: The recombinant Enterobacter is a recombinant bacterium obtained by enhancing the expression of the coding gene of the pantothenate transporter of the recipient Enterobacter, and the recipient bacterium is Escherichia coli NZ-B016.
2. The recombinant Enterobacter according to claim 1, characterized in that: The element for enhancing the expression of the coding gene of the pantothenate transporter of the recipient Enterobacter is the DNA molecule shown in SEQ ID No.
1.
3. The recombinant Enterobacter according to claim 1 or 2, characterized in that: The pantothenate transporter is any one of the following proteins: A1) The protein encoded by the amino acid sequence shown in SEQ ID No.3; A2) A protein having more than 75% identity with the protein shown in A1) and having pantothenate transporter activity, which is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in A1); A3) A fusion protein having pantothenate transporter activity, which is obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).
4. The recombinant Enterobacter according to any one of claims 1-3, characterized in that: The coding gene of the pantothenate transporter is any one of the following: C1) The DNA molecule with the nucleotide sequence shown in SEQ ID No.2; C2) A DNA molecule having more than 75% identity with the nucleotide sequence defined in C1) and encoding the pantothenate transporter; C3) A DNA molecule that hybridizes with any one of the nucleotide sequences defined in C1)-C2) under stringent conditions and encodes the pantothenate transporter.
5. A method for constructing the recombinant Enterobacter according to any one of claims 1-4, the method being to regulate the ability of a microorganism to produce butyric acid by regulating the expression of the coding gene of the pantothenate transporter according to any one of claims 1-4, or regulating the activity or content of the pantothenate transporter, so as to obtain a microorganism with a changed butyric acid yield.
6. The method according to claim 5, characterized in that, The method for regulating the expression of the coding gene of the pantothenate transporter or regulating the activity or content of the pantothenate transporter is to introduce a DNA molecule that enhances the expression of the pantothenate transporter into the target microorganism.
7. The DNA molecule according to claim 6, characterized in that: The DNA molecule is as follows 1) or 2) or 3): 1) The DNA molecule shown in SEQ ID No.1; 2) A DNA molecule that hybridizes with the DNA sequence defined in 1) under stringent conditions and has promoter function; 3) A DNA molecule having more than 90% identity with the DNA sequence defined in 1) or 2) and having the same function.
8. A biological material containing the DNA molecule according to claim 7, and the biological material is any one of the following: B1) An expression cassette containing the DNA molecule according to claim 7; B2) A recombinant vector containing the DNA molecule according to claim 7, or a recombinant vector containing the expression cassette described in B1) A recombinant microorganism containing the DNA molecule as described in claim 7, or a recombinant microorganism containing the expression cassette as described in B1), or a recombinant microorganism containing the recombinant vector as described in B2).
9. Use of the Escherichia coli according to any one of claims 1 to 4, and / or the method according to claim 5 or 6, in any of the following: E1) Use in regulating the butyric acid production of a microorganism; E2) Use in the preparation of butyric acid; E3) Use in constructing an engineered microorganism capable of producing butyric acid.
10. Use of the DNA molecule as described in claim 7 or the biological material as described in claim 8, in any of the following applications: E1) Use in regulating the butyric acid production of a microorganism; E2) Use in the preparation of butyric acid; E3) Use in constructing an engineered microorganism capable of producing butyric acid.
Citation Information
Patent Citations
Promoter for regulating and controlling production of butyric acid and application thereof
CN116064546A