Streptococcus suis type 2 gene deletion strain as well as construction method and application thereof

By constructing the gene deletion strain of Streptococcus suhr, the problem of unsatisfactory immunity of the existing Streptococcus suhr vaccine was solved, and effective prevention and treatment of Streptococcus suhr type 2 was achieved, with broad-spectrum immune activity and good vaccine candidate characteristics.

CN120060105AActive Publication Date: 2025-05-30SOUTHWEST UNIV

Patent Information

Application Number
CN202510224071.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-27
Publication Date
2025-05-30
Estimated Expiration
2045-02-27

AI Technical Summary

Technical Problem

The immune effect of the existing Streptococcus suis vaccine is not ideal, and there are few studies on the prevention and treatment of Streptococcus suis type 2.

Method used

By constructing the 2 gene deletion strain of Streptococcus suis, the B9H01_05210 gene of the SC19 strain was deleted to form the gene deletion strain SC19ΔB9H01_05210, and the recombinant plasmid pSET4sΔB9H01_05210 was constructed through homologous recombination, and transferred to SC19 competent cells.

Benefits of technology

The constructed Streptococcus suis type 2 gene deletion strain has significantly reduced its antioxidant ability and pathogenicity, and has no virulence regaining effect. It has good vaccine candidate characteristics and can provide broad-spectrum immune activity to prevent or treat infections caused by Streptococcus suis of different genotypes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060105A_ABST
    Figure CN120060105A_ABST
Patent Text Reader

Abstract

The invention discloses a streptococcus suis type 2 gene deletion strain as well as a construction method and application thereof, and belongs to the technical field of biological products. According to the invention, the B9H0105210 gene in the genome of the streptococcus suis serotype 2 SC19 is deleted in a homologous recombination manner for the first time, the hydrogen peroxide and nitric oxide stress resistance of the constructed streptococcus suis serotype 2 gene deleted strain is reduced, and the pathogenicity to mice is obviously weakened; moreover, the growth performance of the streptococcus suis type 2 gene-deleted strain is not greatly different from that of a wild strain SC19, the condition of gene recovery does not exist after continuous passage, and the streptococcus suis type 2 gene-deleted strain has an application prospect as an attenuated live vaccine, has a good immune protection effect on different genotypes of streptococcus suis such as the streptococcus suis type 2 strain SC19 and streptococcus suis type 2 P1 / 7, and has a good application prospect. And a certain cross immune protection performance is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biological products, and specifically relates to a Streptococcus suis type 2 gene deletion strain, a construction method thereof, and an application thereof. Background Art

[0002] Streptococcus suis is a Gram-positive pathogen that can infect humans through the food-borne route, causing clinical symptoms such as septicemia, meningitis, and toxic shock-like syndrome in infected individuals, and even leading to the death of infected individuals. Therefore, it is necessary to effectively prevent and control Streptococcus suis. According to the different capsular antigens of Streptococcus suis, it can be divided into 33 serotypes. Among them, Streptococcus suis type 2 is the most important serotype causing swine diseases. According to the differences in the sequences of 7 housekeeping genes (aroA, cpn60, dpr, gki, mutS, recA, thrA), it can be divided into different genotypes (ST) (Auger et al., 2016). The pathogenicity of Streptococcus suis of different serotypes or genotypes varies.

[0003] For the prevention and treatment of Streptococcus suis, vaccination is an effective preventive measure. At present, most of the inactivated vaccines used for preventing and treating Streptococcus suis infections belong to autogenous multivalent inactivated vaccines. Such vaccines have a low cost and good safety, but the immune effect is not very ideal. Compared with inactivated vaccines, live attenuated vaccines have stronger immunogenicity, do not need to rely on adjuvants to enhance the immune effect, and also have the potential to become mucosal immune vaccines in theory. At present, the research on live attenuated vaccines mainly focuses on gene deletion vaccines constructed by deleting key virulence genes of Streptococcus suis; however, limited by the research on virulence genes, there are relatively few reports on Streptococcus suis gene deletion vaccines. Summary of the Invention

[0004] Aiming at the above-mentioned prior art, the purpose of the present invention is to provide a Streptococcus suis type 2 gene deletion strain, a construction method thereof, and an application thereof.

[0005] To achieve the above purpose, the present invention adopts the following technical solutions:

[0006] In the first aspect of the present invention, there is provided a Streptococcus suis type 2 gene deletion strain, which is obtained by deleting the B9H01_05210 gene in the genome of Streptococcus suis type 2 SC19 strain. The nucleotide sequence of the B9H01_05210 gene is as shown in SEQ ID No. 1; specifically as follows:

[0007]

[0008] SC19 is a highly virulent isolate of Streptococcus suis type 2. The present invention finds through research that the B9H01_05210 gene can serve as a new virulence gene. After deleting the B9H01_05210 gene in SC19, the antioxidant ability of the bacterial cells is weakened, and the pathogenicity is also significantly reduced. Moreover, after continuous passage culture, there is no phenomenon of reversion to high virulence, and it can be used as a good candidate strain for vaccine preparation.

[0009] In the second aspect of the present invention, a method for constructing the above-mentioned Streptococcus suis type 2 gene deletion strain is provided, including the following steps:

[0010] Using the genomic DNA of Streptococcus suis type 2 SC19 strain as a template, amplify the upstream homologous arm and downstream homologous arm of the B9H01_05210 gene respectively; clone the upstream homologous arm and downstream homologous arm of the B9H01_05210 gene into the pSET4s plasmid to obtain the deletion gene recombinant plasmid pSET4sΔB9H01_05210; transfer the deletion gene recombinant plasmid pSET4sΔB9H01_05210 into SC19 competent cells to construct the Streptococcus suis type 2 gene deletion strain.

[0011] Preferably, use the primer Up-B9H01_05210-F shown in SEQ ID No.2 and the primer Up-B9H01_05210-R shown in SEQ ID No.3 to amplify the upstream homologous arm of the B9H01_05210 gene; use the primer Down-B9H01_05210-F shown in SEQ ID No.4 and the primer Down-B9H01_05210-R shown in SEQ ID No.5 to amplify the downstream homologous arm of the B9H01_05210 gene.

[0012] Preferably, the method for cloning the upstream homologous arm and downstream homologous arm of the B9H01_05210 gene into the pSET4s plasmid is: digest the pSET4s plasmid with EcoRI and BamHⅠ restriction endonucleases respectively, and ligate the upstream homologous arm and downstream homologous arm of the B9H01_05210 gene to the digested pSET4s plasmid.

[0013] Preferably, use the electrotransformation method to transfer the deletion gene recombinant plasmid pSET4sΔB9H01_05210 into SC19 competent cells; the electric shock voltage of the electrotransformation is 2500V, the resistance is 500 ohms, and the time of the electrotransformation is 5ms.

[0014] In the third aspect of the present invention, the application of the above-mentioned Streptococcus suis type 2 gene deletion strain in the preparation of a vaccine for preventing or treating Streptococcus suis infection is provided.

[0015] In the above application, the vaccine is a live attenuated vaccine.

[0016] In the above application, the Streptococcus suis infection is caused by Streptococcus suis type 2 SC19 and / or Streptococcus suis type 2 P1 / 7.

[0017] The live attenuated vaccine prepared using the Streptococcus suis type 2 gene deletion strain of the present invention has broad-spectrum immune activity and can prevent or treat infections caused by Streptococcus suis of different genotypes such as Streptococcus suis type 2 SC19 and Streptococcus suis type 2 P1 / 7.

[0018] In the fourth aspect of the present invention, a live attenuated vaccine for preventing and treating Streptococcus suis infection is provided, and the live attenuated vaccine uses the above-mentioned Streptococcus suis type 2 gene deletion strain as an active ingredient.

[0019] Advantages of the present invention:

[0020] For the first time in the present invention, the B9H01_05210 gene in the genome of Streptococcus suis type 2 SC19 is deleted by homologous recombination. The constructed Streptococcus suis type 2 gene deletion strain has reduced abilities to resist hydrogen peroxide and nitric oxide stresses and significantly weakened pathogenicity to mice. Moreover, the growth performance of the Streptococcus suis type 2 gene deletion strain is not much different from that of the wild-type strain SC19, and there is no gene reversion after continuous passage. It has the application prospect as a live attenuated vaccine and has good immune protection effects on Streptococcus suis of different genotypes such as Streptococcus suis type 2 strain SC19 and Streptococcus suis type 2 P1 / 7, and has certain cross-immune protection performance. Description of the Drawings

[0021] Figure 1 : Amplification results of the upstream and downstream homologous arms of the target gene B9H01_05210; among them, lane 1 is the upstream homologous arm; lane 2 is the downstream homologous arm.

[0022] Figure 2 : Identification results of the B9H01_05210 gene deletion recombinant plasmid pSET4s-ΔB9H01_05210.

[0023] Figure 3 : Identification results of PCR verification of the gene deletion strain SC19ΔB9H01_05210, where M 1 : Marker of DL5000; M 2 : Marker of DL2000; 1: SC19; 2 - 16: PCR identification of suspected strains to screen out the target strains; 6, 8, 11, 16: successfully constructed SC19ΔB9H01_05210.

[0024] Figure 4: Genetic stability of gene deletion strain SC19ΔB9H01_05210, 1: wild type SC19, 2 - 4: single colony cultures of gene deletion bacteria after subculture.

[0025] Figure 5 : Growth curves of wild strain SC19 and gene deletion strain SC19ΔB9H01_05210.

[0026] Figure 6 : Hydrogen peroxide tolerance results of wild strain SC19 and gene deletion strain SC19ΔB9H01_05210.

[0027] Figure 7 : Nitric oxide tolerance results of wild strain SC19 and gene deletion strain SC19ΔB9H01_05210.

[0028] Figure 8 : Results of colony counting determination of mouse tissue organs of wild strain SC19 and gene deletion strain SC19ΔB9H01_05210.

[0029] Figure 9 : Virulence experiment (LD 50 ) of wild strain SC19 and gene deletion strain SC19ΔB9H01_05210.

[0030] Figure 10 : Immunoprotective effect of the attenuated vaccine of gene deletion strain SC19ΔB9H01_05210 against infection of mice by Streptococcus suis type 2 SC19 strain.

[0031] Figure 11 : Immunoprotective effect of the attenuated vaccine of gene deletion strain SC19ΔB9H01_05210 against infection of mice by Streptococcus suis type 2 P1 / 7 strain. Detailed implementation manners

[0032] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present application belongs.

[0033] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in combination with specific embodiments.

[0034] The test materials used in the embodiments of the present invention are all conventional test materials in the art and can be obtained through commercial channels. The experimental methods without detailed conditions are carried out according to conventional test methods or according to the operation manuals recommended by the suppliers. Among them:

[0035] The GenBank accession number of the wild-type strain SC19 of Streptococcus suis type 2 is MNPY00000000.1. Streptococcus suis P1 / 7 is described in the literature "Serotype distribution and production of muramidase-released protein, extracellular factor and suilysin by field strains of Streptococcus suis isolated in the United States." Veterinary Microbiology 156(3-4):290-296.

[0036] Example 1: Construction of a gene-deleted strain of Streptococcus suis type 2

[0037] 1. Construction of the recombinant vector pSET4sΔB9H01_05210 with the B9H01_05210 gene deleted

[0038] Using the genome of the wild-type strain SC19 of Streptococcus suis type 2 as a template, the upstream and downstream homologous arm fragments on both sides of the B9H01_05210 gene were amplified respectively with the primers Up-B9H01_05210-F / Up-B9H01_05210-R and Down-B9H01_05210-F / down-B9H01_05210-R in Table 1, and the upstream and downstream homologous arms of the B9H01_05210 gene were ligated and recovered.

[0039] Table 1: Primers for constructing gene-deleted strains

[0040]

[0041] Reaction system: 2×Taq Master PCR Mix 25 μL, DNA template 1 μL, Forward primer (20 μM) 1 μL, Reverse primer (20 μM) 1 μL, ddH 2 O was supplemented to 50 μL.

[0042] Reaction program: 95°C for 5 min, 94°C for 1 min, 55°C for 30 s, 72°C for 1 min, 30 cycles, 72°C for 10 min. According to the instructions of the PCR product purification kit of BIOMIGA company, the PCR products were recovered and purified, and 2 μL was taken for detection. The results were as Figure 1 shown, and the upstream and downstream homologous arms of the target length were successfully amplified.

[0043] Extract the pSET4s plasmid according to the instructions of the plasmid extraction kit. Perform double digestion on the pSET4s plasmid using EcoRI and BamHⅠ. Recover the double-digested product of pSET4s, and then ligate the upstream and downstream homologous arm fragments of the amplified B9H01_05210 gene into the double-digested pSET4s plasmid. Take 10 μL of the ligated product and add it to 100 μL of Escherichia coli competent cells, mix well, place on ice for 30 min, treat at 42 °C for 90 s, and then incubate on ice for 2 min. Add 900 μL of LB medium and incubate at 30 °C for 10 min for recovery. Shake in a shaker at 30 °C for 90 min, take 100 μL of the bacterial solution and spread it evenly on a plate containing antibiotics, and culture overnight in a 30 °C incubator. Pick several colonies on the plate for colony PCR amplification, and detect the products by gel electrophoresis. The electrophoresis results are as Figure 2 shown. At the same time, send the plasmid to Sangon Biotech for sequencing.

[0044] The above results show that: the recombinant vector pSET4sΔB9H01_05210 lacking the B9H01_05210 gene was successfully constructed in this invention.

[0045] 2. Construct Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)

[0046] Electrotransform the recombinant vector pSET4sΔB9H01_05210 into SC19 competent cells. The electrotransformation conditions are:

[0047] Voltage 2500V, resistance 500 ohms, time 5 ms. Immediately after the electric shock, add THB medium, mix well and transfer to an EP tube; after preheating at 30°C for 10 min, culture in a shaker at 37°C for 2 - 3 h; take 100 μL of the cultured bacterial solution and spread it on a THB plate containing 50 μg / mL spectinomycin, pick the grown single colonies and place them in THB liquid medium (containing 50 μg / mL spectinomycin), culture overnight at 37°C; dilute the bacterial solution and spread it on a THB solid medium (containing 50 μg / mL spectinomycin), culture at 37°C for 12 h; select the grown single colonies, place them in THB liquid medium (without spectinomycin), culture overnight at 30°C, transfer to a new THB liquid medium (without spectinomycin) at a ratio of 1:5 and continue to culture at 30°C, transfer and culture 3 times; after continuous culture, dilute the bacterial solution in gradient and spread it on a THB solid medium (without spectinomycin), culture overnight at 37°C; pick the single colonies on the above solid medium and streak them on THB solid media containing 50 μg / mL spectinomycin and without spectinomycin respectively, culture at 37°C for 12 h; select the colonies that do not grow on the THB solid medium containing 50 μg / mL spectinomycin but grow on the THB solid medium without spectinomycin, transfer them to a new THB liquid medium (without spectinomycin) and culture overnight at 37°C for identification.

[0048] The primers used for PCR identification of the deletion strain are as follows:

[0049] B9H01_05210 - second exchange - F: TTCTAAATGCACCGATTGCG;

[0050] B9H01_05210 - second exchange - R: ATGGCTGCATCCTTATTCTCA.

[0051] Reaction system: 2×Taq Master PCR Mix 10 μL, DNA template 1 μL, forward primer (20 μM) 1 μL, reverse primer (20 μM) 1 μL, ddH 2 O 7 μL.

[0052] Reaction procedure: Pre - denature at 95°C for 3 min; denature at 95°C for 30 s, anneal at 57°C for 30 s, extend at 72°C for 90 s, cycle 35 times, then extend at 72°C for 10 min and cool at 16°C.

[0053] The results of PCR identification are as Figure 3 shown. The results indicate that: the fragment lengths of the suspected strains in lanes 6, 8, 11, and 16 are significantly shorter than that of the wild - type SC19 in lane 1, so they are the strains with the target fragment deleted.

[0054] The strain with the deletion of the target fragment identified by PCR was subjected to genome re-sequencing (Sangon Biotech). The results of genome re-sequencing (Sangon Biotech) showed that the B9H01_05210 gene of the strain with the deletion of the target fragment identified by PCR was deleted.

[0055] The above results proved that the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) was successfully constructed in the present invention.

[0056] Example 2: Investigation of the genetic stability of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)

[0057] The Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) constructed in Example 1 was subcultured for 30 consecutive generations. Single colonies after 30 consecutive subcultures were picked, and the expression of the B9H01_05210 gene was detected by PCR.

[0058] The results were as Figure 4 shown. The genetically deleted bacterium SC19ΔB9H01_05210 had good genetic stability after continuous subculture, and the mutated and deleted gene did not recover.

[0059] Example 3: Investigation of the growth of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)

[0060] Equal amounts of the wild strain SC19 and the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) constructed in Example 1 were inoculated into THB liquid medium and cultured in a shaker at 37°C and 220 rpm. Every 1 h, 1 mL of the bacterial solution was taken and placed in a cuvette, and the absorbance value at OD 600 was read with a spectrophotometer, and the in vitro growth curve of the bacteria was recorded and plotted.

[0061] The results were as Figure 5 shown. There was no significant difference in the growth of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) and the wild-type strain SC19, indicating that the deletion of the B9H01_05210 gene had little effect on the growth of Streptococcus suis.

[0062] Example 4: Investigation of the tolerance of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) to hydrogen peroxide

[0063] 1. Test method:

[0064] (1) Preparation of the bacterial suspension:

[0065] The Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) and the wild-type strain SC19 were cultured separately to obtain the Streptococcus suis type 2 gene deletion strain bacterial liquid and the wild-type strain SC19 bacterial liquid; the above bacterial liquids were centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the bacterial cells were resuspended with sterile PBS, and the bacterial cell concentration was adjusted to 2×10 8 CFU / ml to obtain a bacterial suspension.

[0066] (2) Hydrogen peroxide treatment:

[0067] In a sterile centrifuge tube, equal volumes of the above-prepared bacterial suspensions were added respectively, and H 2 O 2 was added to make the final concentrations 0 mM (control) and 20 mM respectively. Three replicate tubes were set for each concentration, gently shaken and mixed evenly, and placed in an incubator at 37°C and 5% CO 2 for 40 min to induce oxidative stress response in Streptococcus suis under hydrogen peroxide.

[0068] (3) Dilution and spotting:

[0069] After incubation, the bacterial liquids in each tube were serially diluted. 7 μL of the diluted bacterial liquid was taken and spotted on a THB agar plate, and three parallels were made for each dilution.

[0070] The plate was inverted and placed in a constant temperature incubator at 37°C for 10 - 15 h until colonies grew out.

[0071] (4) Data processing and analysis:

[0072] Count the number of colonies on the plate, and calculate the survival rate of Streptococcus suis in each experimental group. The formula is as follows:

[0073] Survival rate (%) = (average number of colonies in the experimental group / average number of colonies in the blank control group) × 100%

[0074] Statistical software was used to analyze the data. A P < 0.05 was considered statistically significant, and a bar chart was drawn to show the change in the survival rate of Streptococcus suis under different hydrogen peroxide concentrations.

[0075] 2. Test results:

[0076] The results are as Figure 6 shown. The results show that: compared with the wild-type strain SC19, the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) has a significantly reduced tolerance to hydrogen peroxide.

[0077] Example 5: Investigation of the tolerance of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) to nitric oxide

[0078] 1. Test method:

[0079] (1) Preparation of bacterial suspension:

[0080] The gene - deleted strain of Streptococcus suis type 2 (SC19ΔB9H01_05210) and the wild - type strain SC19 were cultured separately to obtain the bacterial suspension of the gene - deleted strain of Streptococcus suis type 2 and the bacterial suspension of the wild - type strain SC19. The above bacterial suspensions were centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the bacterial cells were resuspended with sterile PBS. The concentration of the bacterial cells was adjusted to 2×10 8 CFU / ml to obtain the bacterial suspension.

[0081] (2) Nitric oxide treatment:

[0082] In a sterile centrifuge tube, equal volumes of the above - prepared bacterial suspensions were added, and DETA NONOate was added to make the final concentrations 0 mM (control) and 5 mM respectively. Three replicate tubes were set for each concentration. After gently shaking and mixing evenly, they were placed in an incubator at 37℃ and 5% CO 2 for 1 h to induce Streptococcus suis to produce oxidative stress response under nitric oxide.

[0083] (3) Dilution and spotting on the plate:

[0084] After incubation, the bacterial suspensions in each tube were serially diluted. 7 μL of the diluted bacterial suspension was taken and spotted on the THB agar plate respectively. Three parallels were made for each dilution. After the bacterial suspension dried, the plate was inverted and placed in a constant - temperature incubator at 37℃ for 10 - 15 h until colonies grew out.

[0085] (4) Data processing and analysis:

[0086] Count the number of colonies on the plate and calculate the survival rate of Streptococcus suis in each experimental group. The formula is as follows:

[0087] Survival rate (%)=(average number of colonies in the experimental group / average number of colonies in the blank control group)×100%

[0088] Statistical software was used to analyze the data. Taking P < 0.05 as having statistical significance of the difference, a bar chart was drawn to show the change of the survival rate of Streptococcus suis under different nitric oxide concentrations.

[0089] 2. Test results:

[0090] The results are as Figure 7 shown. The results indicate that: compared with the wild - type strain SC19, the gene - deleted strain of Streptococcus suis type 2 (SC19ΔB9H01_05210) has a significantly reduced tolerance to nitric oxide.

[0091] Example 6: Colony counting experiment of Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)

[0092] The wild-type strain SC19 and the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) were respectively inoculated into THB liquid medium, cultured in a shaker at 37 °C and 220 rpm, transferred after 12 h, and challenged the mice at a dose of 2.5×10 8 CFU. After 24 h, the tissues and organs of the mice were collected in a sterile environment, and the tissue and organ samples were homogenized. Use a 100 μL micropipette to aspirate 100 μL of the 1:10 sample homogenate, and slowly inject it along the tube wall into a sterile test tube containing 900 μL of diluent, and shake the test tube to mix the sample homogenate. Select the sample homogenate with an appropriate dilution. When performing a 10-fold serial dilution, aspirate 10 μL of the sample and drop it into the sterile THB solid medium. Each dilution is repeated 3 times. At the same time, aspirate 10 μL of the blank diluent as a blank control. After the diluent solidifies, invert the solid medium and culture it at 36 °C ± 1 °C for 48 h ± 2 h. After the culture is completed, take out the medium, observe it with the naked eye, record the dilution factor and the corresponding number of colonies, and the colony count is expressed as colony forming unit (CFU).

[0093] The results are as Figure 8 shown. The bacterial colonization amount of the gene deletion strain SC19ΔB9H01_05210 in tissues and organs was significantly lower than that of the wild strain SC19.

[0094] Example 7: Virulence experiment of Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) (LD 50 )

[0095] Fifty female mice aged 18 - 20 g with basically the same physiological status were randomly divided into 10 groups, with 5 mice in each group. Among them: 5 groups were respectively intraperitoneally injected with the wild-type strain SC19 at doses of 5×10 8 , 2.5×10 8 , 1×10 8 , 5×10 7 , 2.5×10 7 CFU; the other 5 groups were respectively intraperitoneally injected with the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) at doses of 5×10 8 , 2.5×10 8 , 1×10 8 , 5×10 7 , 2.5×10 7 CFU.

[0096] After inoculation, observe for 5 days, record the status of mice every 8 hours, record the number of dead and surviving mice within 5 days, and calculate the LD of the wild strain SC19 and the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210). 50 .

[0097] The results are as Figure 9 shown. The results show that: the LD of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) is 50 1×10 8 CFU, and the LD of the wild type SC19 is 50 2×10 7 CFU, indicating that its virulence is lower than that of the wild type SC19.

[0098] Example 8: Immunoprotective experiment of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)

[0099] Randomly divide 20 female mice weighing 18 - 20 g into 4 groups, with 5 mice in each group; among them: groups 1 - 2 are used as the immunization groups, and the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) with a dose of 2.5×10 8 CFU is injected through the intramuscular route; groups 3 - 4 are used as the PBS control groups, and an equal volume of PBS is injected through the intramuscular route.

[0100] 14 days after immunization, group 1 of the immunization group and group 3 of the PBS control group are challenged with an equal dose (5×10 8 CFU) of the wild strain SC19 of Streptococcus suis; group 2 of the immunization group and group 4 of the PBS control group are challenged with an equal dose (5×10 8 CFU) of the Streptococcus suis P1 / 7.

[0101] Observe for 7 days after challenge, record the status of mice every day, count the number of surviving mice, and calculate the survival rate of mice.

[0102] The results are as Figures 10 - 11 shown. The survival rate of mice immunized with the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) is significantly increased under the challenge of P1 / 7 and SC19, indicating that the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) has protective and cross - immune effects.

[0103] The above are only the preferred embodiments of the present application and are not used to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A gene-deficient strain of Streptococcus suis type 2, characterized in that: The strain is obtained by deleting the B9H01_05210 gene in the genome of Streptococcus suis type 2 SC19 strain. The nucleotide sequence of the B9H01_05210 gene is shown in SEQ ID No.

1.

2. The method for constructing the Streptococcus suis type 2 gene-deficient strain according to claim 1, characterized in that: The following steps are involved: The genomic DNA of Streptococcus suis type 2 SC19 strain was used as a template to amplify the upstream homology arm and the downstream homology arm of the B9H01_05210 gene respectively; the upstream homology arm and the downstream homology arm of the B9H01_05210 gene were cloned into the pSET4s plasmid to obtain the gene-deficient recombinant plasmid pSET4sΔB9H01_05210; the gene-deficient recombinant plasmid pSET4sΔB9H01_05210 was transferred into SC19 competent cells to construct the Streptococcus suis type 2 gene-deficient strain.

3. The construction method according to claim 2, characterized in that: The upstream homology arm of the B9H01_05210 gene was amplified using the primer Up-B9H01_05210-F shown in SEQ ID No.2 and the primer Up-B9H01_05210-R shown in SEQ ID No.3; the downstream homology arm of the B9H01_05210 gene was amplified using the primer Down-B9H01_05210-F shown in SEQ ID No.4 and the primer Down-B9H01_05210-R shown in SEQ ID No.

5.

4. The construction method according to claim 2, characterized in that: The method for cloning the upstream homology arm and the downstream homology arm of the B9H01_05210 gene into the pSET4s plasmid is as follows: the pSET4s plasmid is digested with EcoRI and BamHI restriction enzymes respectively, and the upstream homology arm and the downstream homology arm of the B9H01_05210 gene are connected to the digested pSET4s plasmid.

5. Use of the Streptococcus suis type 2 gene-deficient strain of claim 1 in the preparation of a vaccine for preventing or treating Streptococcus suis infection.

6. The use according to claim 5, characterized in that: The vaccine is a live attenuated vaccine.

7. The use according to claim 5, characterized in that: The Streptococcus suis infection is an infection caused by Streptococcus suis type 2 SC19 and / or Streptococcus suis type 2 P1 / 7.

8. A live attenuated vaccine for preventing and treating Streptococcus suis infection, characterized in that: The attenuated live vaccine is the gene-deficient strain of Streptococcus suis type 2 described in claim 1 as an active ingredient.

Citation Information

Patent Citations

  • Five-gene-deleted streptococcus suis serotype 2 strain and application

    CN105316252A

  • Streptococcus suis 2 (SS2) apuA gene knockout mutant strain and application thereof

    CN109810933A

  • Attenuated Streptococcus suis Vaccines and Methods of Making and Use Thereof

    US20140004144A1

Cited By

  • Streptococcus suis type 2 SC19 delta potD attenuated strain as well as preparation method and application thereof

    CN120025958A

  • A streptococcus suis type 2 sc19 delta potd attenuated strain, a preparation method and application thereof

    CN120025958B