Photosensitive DNA polymerase as well as use method and application thereof

By modifying DNA polymerase to make it light sensitive and using light-start control technology, the problem of inaccurate reaction start control in isothermal nucleic acid amplification technology is solved, and the effect of simultaneous start of multiple systems is achieved, improving the reliability and accuracy of the experiment.

CN120060193APending Publication Date: 2025-05-30HEBEI AGRICULTURAL UNIV.
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510189106.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The existing isothermal nucleic acid amplification technology is difficult to achieve accurate reaction start-up control, which limits its application in precision fields such as nucleic acid detection and quantitative analysis.

Method used

By modifying the DNA polymerase, it is light-sensitive and activates its activity only after illumination at a specific wavelength, thus achieving light-start control of isothermal nucleic acid amplification.

Benefits of technology

The simultaneous start of multiple isothermal nucleic acid amplification systems is achieved, which avoids errors caused by different starts and improves the reliability and accuracy of the experiment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060193A_ABST
    Figure CN120060193A_ABST
Patent Text Reader

Abstract

The invention discloses photosensitive DNA polymerase as well as a use method and application thereof, relates to the technical field of enzyme engineering, and aims at solving the technical problem of how to provide protein and how to prepare the photosensitive DNA polymerase from the protein. The amino acid sequence of the protein is as shown in SEQ ID NO: 3, X is pAzF, amino in the pAzF is linked with a carboxyl peptide bond of lysine at the fourth position in the SEQ ID NO: 3, and carboxyl in the pAzF is linked with an amino peptide bond of histidine at the fifth position in the SEQ ID NO: 3. The protein is combined with a photosensitive oligonucleotide chain as shown in SEQ ID NO: 5 to obtain the photosensitive DNA polymerase, the photosensitive DNA polymerase can only be subjected to amplification reaction after being illuminated by 365 nm, in-vitro start control of the DNA polymerase can be realized, and the photosensitive DNA polymerase can be used for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention specifically relates to a photosensitive DNA polymerase, a method for using the same, and an application thereof Background Art

[0002] Currently, there are mainly two types of nucleic acid amplification technologies. One is the polymerase chain reaction technology (PCR), which is widely used. Combining with a modified thermosensitive DNA polymerase, it can achieve hot start fluorescence quantitative PCR for accurate nucleic acid quantification and detection, and has been widely used in laboratories and clinics. However, this type of technology requires temperature cycling to achieve the PCR reaction, which has high requirements for equipment; while the other isothermal nucleic acid amplification technology can be completed at room temperature, has low requirements for equipment, and has a faster reaction speed. However, the existing methods for controlling the start of its reaction mainly rely on the addition of magnesium ions, and it is difficult to achieve precise control during a large number of reactions.

[0003] In the real-time fluorescence polymerase chain reaction technology (RT-PCR) widely used in nucleic acid detection and quantitative analysis, ordinary Taq DNA polymerase also has similar problems. Taq DNA polymerase has a certain activity at room temperature, which is likely to cause non-specific amplification, thus deviating or even invalidating the detection results. To address this problem, the current mainstream method is to use monoclonal antibodies. At low temperatures, the antibodies bind to Taq DNA polymerase to inhibit its activity, and at high temperatures, the antibodies are inactivated to release the activity, thereby achieving the hot start of fluorescence quantitative PCR and improving the accuracy of nucleic acid detection and quantitative analysis.

[0004] In isothermal nucleic acid amplification technology, all enzymes are intolerant to high temperatures, so they are not suitable for hot start modification. To achieve precise control of isothermal nucleic acid amplification, the prior art often controls the simultaneous start of the reaction by controlling the addition of magnesium ions. Magnesium ions are the key ions in isothermal nucleic acid amplification reactions. In this technology, for multiple reactions, an isothermal nucleic acid amplification system without magnesium ions is first prepared, and magnesium ions are added when the reaction needs to be started, thereby achieving the start control of isothermal nucleic acid amplification. However, this technology requires the successive addition of magnesium ions at the end. When the number of reactions is large, there is still a certain time difference between the starts of the first and last reactions, and the start control still cannot be very precise.

[0005] However, with the rapid development of isothermal nucleic acid amplification technology, nucleic acid amplification can be achieved at room temperature, with simple equipment required, and it has a broader prospect. Among them, recombinase-aided isothermal nucleic acid amplification technology (Recombinase Aided Amplification, RAA) is a technology that uses recombinase, single-stranded binding protein, and DNA polymerase to perform nucleic acid amplification under isothermal conditions (37°C - 42°C). The specific process of this technology is as follows: recombinase, single-stranded binding protein, and primer form a complex to scan double-stranded DNA, unwind the double-stranded DNA at the sequence homologous to the primer, and the single-stranded binding protein (SSB) prevents the single-stranded DNA from renaturing. In the presence of energy and dNTP, DNA polymerase completes the extension of the strand to achieve nucleic acid amplification. However, since the isothermal nucleic acid amplification reaction can be carried out at room temperature, when multiple isothermal nucleic acid amplification systems are prepared sequentially, the reactions will start sequentially, making it difficult to control the reactions of multiple systems to start simultaneously. In application scenarios such as nucleic acid detection and quantitative analysis, the nucleic acid amplification reaction needs to be started simultaneously for the results to be comparable. Therefore, the start control of the nucleic acid amplification reaction is crucial, which also limits the further application of isothermal nucleic acid amplification technology.

[0006] Generally speaking, the isothermal nucleic acid amplification technology has a faster reaction speed, simple temperature requirements, and flexible detection methods. However, there is still a lack of precise start control methods at present, which limits its further application. Therefore, how to provide a method that can precisely control the start of the isothermal nucleic acid amplification reaction and promote the application of isothermal nucleic acid amplification technology in precision fields such as nucleic acid detection and quantitative analysis is a technical problem faced by those in this field. Summary of the Invention

[0007] To solve the above technical problems, the present invention has modified the DNA polymerase of the isothermal nucleic acid amplification system to make it light-sensitive and have photosensitivity. Only after being irradiated with light of a specific wavelength can the polymerase activity be activated, and it is completely inactive when not irradiated. Then, with the help of this photosensitive DNA polymerase, the isothermal nucleic acid amplification system will not start to react during the preparation process. Only after all systems are configured and irradiated with light of a specific wavelength, the reaction will start, thus realizing the light start control of isothermal nucleic acid amplification. The present invention has developed a light-start isothermal nucleic acid amplification technology based on photosensitive polymerase, which can achieve the control of multiple isothermal nucleic acid amplification systems to start reacting simultaneously, avoiding errors caused by different start times of nucleic acid amplification in precise experiments.

[0008] To solve the above technical problems, the present invention provides a protein, its salt, or its derivative.

[0009] The amino acid sequence of the protein is as follows in any one of the following:

[0010] B1), a protein whose amino acid sequence is SEQ ID NO: 3;

[0011] B2) A protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in B1), having an identity of more than 80% with the protein shown in B1) and having the same activity;

[0012] B3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of B1) or B2);

[0013] Wherein X is pAzF, the amino group in pAzF is peptide-bonded to the carboxyl group of the 4th lysine in SEQ ID NO: 3, and the carboxyl group in pAzF is peptide-bonded to the amino group of the 5th histidine in SEQ ID NO: 3;

[0014] The structure of pAzF is as follows:

[0015]

[0016] Among the above proteins, the protein tag refers to a polysaccharide hydrolase or protein that is fused and expressed together with the target protein by using DNA in vitro recombination technology, in order to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag and / or SUMO tag, etc.

[0017] Among the above proteins, identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web page of the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and performing a search to calculate the identity of a pair of amino acid sequences, and then the identity value (%) can be obtained.

[0018] Among the above proteins, the identity of more than 80% can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0019] Among the above proteins, SEQ ID No: 3 consists of 602 amino acid residues.

[0020] One or more amino acids of the protein of the present invention can be replaced with amino acids having a D-configuration, artificially modified amino acids, rare amino acids existing in nature, etc., so as to improve the bioavailability, stability and / or anti-cancer activity of the polysaccharide hydrolase. Among them, D-amino acids refer to amino acids corresponding to the L-amino acids that make up proteins; artificially modified amino acids refer to common L-amino acids that make up proteins and are modified such as methylation and phosphorylation; rare amino acids existing in nature include uncommon amino acids that make up proteins and amino acids that do not make up proteins, such as 5-hydroxylysine, methylhistidine, γ-aminobutyric acid, homoserine, etc.

[0021] To solve the above technical problems, the present invention also provides a compound, its salt or its derivative.

[0022] The structural formula of the compound is as follows:

[0023]

[0024] Among them, V is a polypeptide with an amino acid sequence of MR, and W is a polypeptide with a sequence from the 5th to the 598th position of SEQ ID NO: 3;

[0025] Z is an oligonucleotide chain with a sequence from the 1st to the 19th position of SEQ ID NO: 5, C is cytosine, and A is adenine;

[0026] The carboxyl group at the carboxyl terminus of V forms a peptide bond with the amino group in the lysine residue; the amino group at the amino terminus of W forms a peptide bond with the carboxyl group in the pAzF residue; the phosphate of the cytosine deoxyribonucleotide at the 3'-end of Z forms a phosphodiester bond with the hydroxyl group in the fifth C atom of the adenine deoxyribonucleotide.

[0027] For the above method for preparing the protein, the method includes the step of transcribing and translating a nucleic acid with a nucleotide sequence of SEQ ID NO: 4 to obtain the protein. Among them, the reaction contains a pAzF-tRNA-TAG complex, and the pAzF-tRNA-TAG complex recognizes the TAG codon and the amino acid arm carries the above-mentioned pAzF.

[0028] In the above preparation method, the method includes the step of in vitro transcribing and translating a nucleic acid with a nucleotide sequence of SEQ ID NO: 4 to obtain the protein. Among them, the reaction contains an aminoacyl-tRNA synthetase that recognizes the above-mentioned pAzF and a tRNA that recognizes the stop codon.

[0029] In the above preparation method, the aminoacyl-tRNA synthetase that recognizes the above-mentioned pAzF and the tRNA that recognizes the stop codon are expressed by the pZA16-pAzF plasmid.

[0030] In any of the above-described preparation methods, the transcription and translation are carried out in a microorganism.

[0031] In the above text, the microorganism can be Escherichia coli. The Escherichia coli can be Escherichia coli strain BL21(DE3).

[0032] In the above text, the pZA16-pAzF plasmid is purchased from AddGene, catalog number 31186.

[0033] In the above text, the in vitro transcription and translation of the nucleic acid with the nucleotide sequence of SEQ ID NO: 4 are achieved through an expression vector. The expression vector can be a prokaryotic expression vector. The prokaryotic expression vector can be the pTrc99A vector. The pTrc99A vector is purchased from HonorGene, catalog number HG-VYA0262.

[0034] In the preparation method of the above compound, the method includes the step of performing an azide-alkyne cycloaddition reaction between the azide residue of pAzF in the protein prepared by any of the above methods and the alkyne of dibenzocyclooctyne in the photosensitive oligonucleotide chain to obtain the above compound; the structure of the photosensitive oligonucleotide chain is as follows:

[0035]

[0036] Wherein, Z is an oligonucleotide chain of positions 1-19 of SEQ ID NO: 5, C is cytosine, and A is adenine;

[0037] The phosphate of the cytosine deoxyribonucleotide at the 3'-end of Z forms a phosphodiester bond with the hydroxyl group in the fifth C atom of the adenine deoxyribonucleotide.

[0038] To solve the above technical problems, the present invention provides the following applications.

[0039] The application is any of the following:

[0040] 1) The application of the protein as described above or prepared by any of the above methods in the preparation of a photosensitive DNA polymerase;

[0041] 2) The application of the protein as described above or prepared by any of the above methods in isothermal nucleic acid amplification or the preparation of isothermal nucleic acid amplification products.

[0042] To solve the above technical problems, the present invention provides the following applications.

[0043] The application is any of the following:

[0044] 1) The application of the compound as described above or prepared by the above method in the preparation of a photosensitive DNA polymerase product;

[0045] 2) Use of the compound as described above or prepared by the above method in isothermal nucleic acid amplification or in the preparation of isothermal nucleic acid amplification products.

[0046] In the above text, in addition to the above-mentioned photosensitive DNA polymerase, the photosensitive DNA polymerase product includes, but is not limited to, reaction buffer, dNTPs, Mg 2+ , stabilizer, enhancer, coenzyme or cofactor, dye or tracer, and / or other additives.

[0047] In the above text, the reaction buffer maintains the pH and ionic strength of the reaction system to ensure the activity and stability of DNA polymerase. The reaction buffer includes substances for maintaining pH stability (such as Tris-HCl), substances for adjusting ionic strength (such as KCl or (NH 4 ) 2 SO 4 ) which affects DNA polymerase activity and primer binding, and / or, a detergent (such as Triton X-100 or NP-40), which can prevent the enzyme from binding to the tube wall.

[0048] In the above text, the magnesium ion is an essential cofactor for DNA polymerase, affecting primer binding, enzyme activity and product specificity. In the embodiments of the present application, it can be provided in the form of MgCl 2 or MgSO 4 alone or in combination.

[0049] In the above text, dNTPs (deoxynucleoside triphosphates) are the raw materials for DNA synthesis (dATP, dTTP, dCTP, dGTP). In the embodiments of the present application, they can be premixed in the reaction buffer or packaged separately.

[0050] In the above text, the stabilizers include, but are not limited to, glycerol and BSA (bovine serum albumin). Glycerol can prevent enzyme inactivation during low-temperature storage. BSA (bovine serum albumin) can reduce tube wall adsorption and stabilize the enzyme structure.

[0051] In the above text, the enhancers include, but are not limited to, betaine and DMSO (dimethyl sulfoxide). The betaine can reduce DNA secondary structures (such as regions with high GC content). The DMSO can promote DNA denaturation and is suitable for complex templates.

[0052] In the above text, the coenzymes or cofactors include, but are not limited to, DTT (dithiothreitol) or β-mercaptoethanol, which can maintain a reducing environment and prevent enzyme oxidation inactivation.

[0053] In the above text, the dye or tracer includes, but is not limited to, bromophenol blue / xylene cyanol or ROX reference dye. Bromophenol blue / xylene cyanol is an electrophoresis indicator dye (premixed in the buffer). ROX reference dye is used for fluorescence correction in real-time quantitative PCR.

[0054] In the above text, the other additives include, but are not limited to, preservatives (such as NaN 3 ) and nuclease inhibitors. Preservatives are used to inhibit microbial contamination. Nuclease inhibitors are used to prevent DNA degradation.

[0055] The working concentration of Mg 2+ can be 1.5 - 3 mM. It can also be adjusted according to the actual situation.

[0056] To solve the above technical problems, the present invention provides a biological material.

[0057] The biological material is any one of the following:

[0058] B1), a nucleic acid molecule encoding the above peptide;

[0059] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0060] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0061] B4), a recombinant cell containing the nucleic acid molecule described in B1), or a recombinant cell containing the expression cassette described in B2), or a recombinant cell containing the recombinant vector described in B3);

[0062] B5), a recombinant tissue containing the nucleic acid molecule described in B1), or a recombinant tissue containing the expression cassette described in B2), or a recombinant tissue containing the recombinant vector described in B3);

[0063] B6), a recombinant organ containing the nucleic acid molecule described in B1), or a recombinant organ containing the expression cassette described in B2), or a recombinant organ containing the recombinant vector described in B3);

[0064] B7), a recombinant individual containing the nucleic acid molecule described in B1), or a recombinant individual containing the expression cassette described in B2), or a recombinant individual containing the recombinant vector described in B3).

[0065] B8), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

[0066] In the above text, in the nucleic acid molecule described in B1), those of ordinary skill in the art can easily use known methods, such as directed evolution or site-directed mutagenesis, to mutate the nucleotide sequence encoding the above polypeptide of the present invention. Those nucleotides that have been artificially modified and have 80% or more identity with the nucleotide sequence of the polypeptide isolated from the present invention, as long as they encode the polypeptide and have the ability to inhibit cancer cell growth, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0067] The above 80% or more identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0068] In this article, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web page on the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively and performing a search to calculate the identity of the amino acid sequence, and then the identity value (%) can be obtained.

[0069] Among the above biological materials, the nucleic acid molecule described in B1) can be the coding gene of the protein. Specifically, the coding sequence of the coding strand of the nucleic acid molecule described in B1) is the DNA molecule shown in SEQ ID NO: 4.

[0070] In the above text, the vectors are well-known to those skilled in the art and include, but are not limited to: plasmids, phages (such as λ phage or M13 filamentous phage, etc.), cosmids (i.e., cosmid plasmids), Ti plasmids or viral vectors.

[0071] Among the above biological materials, the expression cassette described in B2) refers to DNA that can express the gene in a host cell. This DNA can not only include a promoter that initiates gene transcription, but also include a terminator that terminates gene transcription. Further, the expression cassette can also include enhancer sequences.

[0072] And the use of the above biological materials.

[0073] The use is any one of the following:

[0074] 1) Use of the biomaterial as described above in the preparation of a photosensitive DNA polymerase;

[0075] 2) Use of the biomaterial as described above in the preparation of a photosensitive DNA polymerase product;

[0076] 3) Use of the biomaterial as described above in the preparation of isothermal nucleic acid amplification or in the preparation of an isothermal nucleic acid amplification product.

[0077] A kit, wherein the kit comprises a protein prepared by the above method or any of the above methods, a compound prepared by the above method or any of the above methods, and / or the above-mentioned photosensitive oligonucleotide chain.

[0078] Advantageous effects

[0079] The present invention discloses a photosensitive DNA polymerase, its use method and application, relating to the technical field of enzyme engineering. The technical problem to be solved is how to provide a protein and prepare it into a photosensitive DNA polymerase. The amino acid sequence of the protein is the protein of SEQ ID NO: 3, wherein X is pAzF. The amino group in pAzF is linked to the carboxyl group of the lysine at the 4th position in SEQ ID NO: 3 by a peptide bond, and the carboxyl group in pAzF is linked to the amino group of the histidine at the 5th position in SEQ ID NO: 3 by a peptide bond. The above-mentioned protein binds to the photosensitive oligonucleotide chain shown in SEQ ID NO: 5 to obtain a photosensitive DNA polymerase, which can only carry out an amplification reaction after being irradiated with 365 nm light, realizing the in vitro start control of the DNA polymerase and being applicable to industrial production.

[0080] The present invention modifies the key DNA polymerase in the isothermal nucleic acid amplification system through unnatural amino acid technology, enabling the activity of the DNA polymerase to be controlled by light of a specific wavelength, being inactive before light irradiation and being activated after light irradiation, thus realizing the light start of isothermal nucleic acid amplification. The purpose of the present invention is to provide a method for precisely controlling the start of an isothermal nucleic acid amplification reaction, making up for the deficiencies of the current isothermal nucleic acid amplification technology and promoting its in-depth application in precision fields such as nucleic acid detection and quantitative analysis.

[0081] Advantageous effects

[0082] The present invention discloses a photosensitive DNA polymerase, its usage method and application, relating to the technical field of enzyme engineering. The technical problem to be solved is how to provide a protein and prepare it into a photosensitive DNA polymerase. The amino acid sequence of the protein is the protein of SEQ ID NO: 3, wherein X is pAzF, the amino group in pAzF is peptide-bonded to the carboxyl group of the lysine at the 4th position in SEQ ID NO: 3, and the carboxyl group in pAzF is peptide-bonded to the amino group of the histidine at the 5th position in SEQ ID NO: 3. The above-mentioned protein binds to the photosensitive oligonucleotide chain shown in SEQ ID NO: 5 to obtain a photosensitive DNA polymerase, which can only carry out an amplification reaction after being irradiated with light at 365 nm, realizing the in vitro start control of the DNA polymerase and being applicable to industrial production.

[0083] The present invention modifies the key DNA polymerase in the isothermal nucleic acid amplification system through unnatural amino acid technology, enabling the activity of the DNA polymerase to be controlled by light of a specific wavelength, being inactive before light irradiation and being activated after light irradiation, thereby realizing the light start of isothermal nucleic acid amplification. The purpose of the present invention is to provide a method for precisely controlling the start of isothermal nucleic acid amplification reactions, making up for the deficiencies of current isothermal nucleic acid amplification technologies and promoting their in-depth application in precision fields such as nucleic acid detection and quantitative analysis. Description of the Drawings

[0084] Figure 1 is the experimental principle diagram; lane 1 is the RAA reaction of natural DNA polymerase; lane 2 is the RAA reaction of unnatural DNA polymerase.

[0085] Figure 2 is the structural formula of the unnatural amino acid pAzF.

[0086] Figure 3 is the schematic diagram of the process for site-directed insertion of unnatural amino acids into proteins.

[0087] Figure 4 is the figure of purified unnatural DNA polymerase.

[0088] Figure 5 is the activity detection of unnatural DNA polymerase.

[0089] Figure 6 is the mass spectrometry analysis figure of natural DNA polymerase (the measured molecular weight is 68225.69 Da).

[0090] Figure 7 is the mass spectrometry analysis figure of unnatural DNA polymerase (the measured molecular weight is 68402.82 Da).

[0091] Figure 8 is the click chemical reaction figure.

[0092] Figure 9It is a diagram of light-initiated isothermal nucleic acid amplification. Specific Embodiments

[0093] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0094] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0095] The following embodiments use SPSS 11.5 statistical software to process data. The experimental results are expressed as mean ± standard deviation, and are tested by One-way ANOVA. P < 0.05 (*) indicates significant difference, P < 0.01 (**) indicates extremely significant difference, and P < 0.001 (***) indicates extremely significant difference.

[0096] The term "pAzF" refers to a compound with a structure as Figure 2 shown.

[0097] The term "azide group" refers to a group formed by three nitrogen atoms connected by double bonds (—N=N=N), and its chemical formula is -N3. In the chemical structure, the azide group has a chain structure and is usually represented as N=N=N. In this application, N3 or -N3 in the structural formula of the pAzF compound (with a structure as Figure 2 shown) represents the azide group.

[0098] The term "aminoacyl-tRNA synthetase" refers to aminoacyl-tRNA synthases, which are a class of enzymes involved in the process of attaching amino acids to their corresponding tRNAs. The synthesis process involving aminoacyl-tRNA synthetase occurs in two steps. The first step is that the aminoacyl-tRNA synthetase recognizes the amino acid it catalyzes and another substrate ATP. Under the catalysis of the aminoacyl-tRNA synthetase, an ester bond is formed between the carboxyl group of the amino acid and the phosphate on AMP, while releasing a molecule of PPi: amino acid + ATP -- aminoacyl-AMP-enzyme + PPi; at this time, aminoacyl-AMP remains tightly bound to the enzyme molecule. The second reaction catalyzed by the aminoacyl-tRNA synthetase is to link the amino acid to the ribose at the 3'-end of the tRNA by forming an ester bond: aminoacyl-AMP + tRNA -- aminoacyl-tRNA + AMP; aminoacyl-tRNA synthetases differ in the region where they recognize tRNAs. Some aminoacyl-tRNA synthetases can specifically form the 2'-form of the ester, some form the 3'-form of the ester, and some may also form a mixture.

[0099] The terms "peptide bond linkage", "forming a peptide bond", and "peptide bond" have the same meaning, referring to the amide bond formed by the dehydration condensation of the α-carboxyl group of one molecule of amino acid and the α-amino group of another molecule of amino acid, that is, -CO-NH-.

[0100] The term "tRNA (Transfer RNA)", also known as transfer RNA, messenger ribonucleic acid, transfer ribonucleic acid, usually refers to an RNA composed of 76 - 90 nucleotides. Its 3'-end can be attached to a specific type of amino acid under the catalysis of aminoacyl-tRNA synthetase. During the process of translation, tRNA can recognize the codon on the mRNA through its own anticodon and transport the amino acid corresponding to the codon to the polypeptide chain being synthesized on the ribosome. In theory, each tRNA molecule can only be attached to one type of amino acid, but due to the degeneracy of the genetic code, more than one tRNA can be attached to one amino acid.

[0101] The term "amino acid arm" refers to the part formed by the base pairing of the nucleotide sequence near the 3'-end and the 5'-end sequence in the tRNA molecule, which is mainly responsible for receiving amino acids. It can carry specific amino acids to the ribosome and pair with the codons on the mRNA to ensure that amino acids can be accurately added to the polypeptide chain being synthesized.

[0102] The term "codon" refers to the rule that every three adjacent nucleotides in a messenger RNA molecule form a group, and during protein synthesis, it represents a certain amino acid. Messenger RNA can determine the types and sequences of amino acids in a protein molecule in a cell. The sequence of the four nucleotides (bases) in a messenger RNA molecule can determine the sequence of 21 amino acids in a protein molecule. And three bases on a messenger RNA molecule can determine one amino acid. Including but not limited to the following:

[0103] The codon UUU represents phenylalanine, the codon UUC represents phenylalanine, the codon UUA represents leucine, the codon UUG represents leucine, the codon UCU represents serine, the codon UCC represents serine, the codon UCA represents serine, the codon UCG represents serine, the codon UAU represents tyrosine, the codon UAC represents tyrosine, the codon UAA represents termination, the codon UAG represents termination, the codon UGU represents cysteine, the codon UGC represents cysteine, the codon UGA represents termination, the codon UGG represents tryptophan, the codon CUU represents leucine, the codon CUC represents leucine, the codon CUA represents leucine, the codon CUG represents leucine, the codon CCU represents proline, the codon CCC represents proline, the codon CCA represents proline, the codon CCG represents proline, the codon CAU represents histidine, the codon CAC represents histidine, the codon CAA represents glutamine, the codon CAG represents glutamine, the codon CGU represents arginine, the codon CGC represents arginine, the codon CGA represents arginine, the codon CGG represents arginine, the codon AUU represents isoleucine, the codon AUC represents isoleucine, the codon AUA represents isoleucine, the codon AUG represents methionine, the codon ACU represents threonine, the codon ACC represents threonine, the codon ACA represents threonine, the codon ACG represents threonine, the codon AAU represents asparagine, the codon AAC represents asparagine, the codon AAA represents lysine, the codon AAG represents lysine, the codon AGU represents serine, the codon AGC represents serine, the codon AGA represents arginine, the codon AGG represents arginine, the codon GUU represents valine, the codon GUC represents valine, the codon GUA represents valine, the codon GCU represents alanine, the codon GCC represents alanine, the codon GAU represents aspartic acid, the codon GAC represents aspartic acid, the codon GAA represents glutamic acid, the codon GGU represents glycine, the codon GGC represents glycine, the codon GCA represents alanine, the codon GCG represents alanine, the codon GUG represents valine, the codon GAG represents glutamic acid, the codon GGG represents glycine, and the codon GGA represents glycine.

[0104] The term "DNA polymerase" refers to DNA-dependent DNA polymerase (DNApol), which is a class of enzymes that use parental DNA as a template to catalyze the polymerization of substrate dNTP molecules to form daughter DNA.

[0105] The terms "photosensitive DNA polymerase" and "light-initiated DNA polymerase" have the same meaning. It refers to a special DNA polymerase that can initiate DNA replication under light illumination. This enzyme usually contains a photosensitive group that changes when irradiated with light of a specific wavelength, thereby activating the enzyme's activity and enabling it to catalyze DNA synthesis.

[0106] The term "gene" refers to the DNA segment involved in the production of a polypeptide chain; it includes the regions before and after the coding region (leader region and trailing region) involved in the transcription / translation of the gene product and the regulation of said transcription / translation, as well as the intervening sequences (introns) between individual coding regions (exons).

[0107] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to refer to polymers of amino acid residues. This term can apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acids, as well as naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. As used herein, this term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), wherein the amino acid residues are linked by covalent peptide bonds.

[0108] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that act in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as subsequently modified amino acids such as hydroxyproline, γ-carboxyglutamic acid, and O-phosphoserine. In this document, amino acids can be represented by the common three-letter codes or single-letter codes recommended by the IUPAC-IUB Commission on Biochemical Nomenclature. Similarly, nucleotides can be represented by their commonly accepted single-letter codes.

[0109] The term "template" refers to any nucleic acid molecule that can be used for the amplification described in the present invention. Non-natural double-stranded RNA or DNA can be made into double-stranded DNA and used as double-stranded DNA. Any double-stranded DNA or product containing multiple different double-stranded DNA molecules can be used as template DNA to amplify one or more loci of interest contained within the template DNA.

[0110] The term "primer" refers to an oligonucleotide that can be used in an amplification method such as polymerase chain reaction (PCR) for amplifying a nucleotide sequence according to a polynucleotide sequence corresponding to a specific genomic sequence. At least one PCR primer for amplifying a polynucleotide sequence is sequence-specific for that sequence.

[0111] The term "probe" refers to a molecule that binds to a specific sequence or subsequence or other part of another molecule. Unless otherwise stated, the term "probe" generally refers to a polynucleotide probe that binds to another polynucleotide (commonly referred to as the "target polynucleotide") through complementary base pairing. A probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe, depending on the stringency of the hybridization conditions. A probe can be labeled directly or indirectly.

[0112] The term "amplification reaction" refers to a process for copying a nucleic acid one or more times. In embodiments, the amplification method includes, but is not limited to: polymerase chain reaction, self-sustained sequence reaction, ligase chain reaction, rapid amplification of cDNA ends, polymerase chain reaction and ligase chain reaction, Q-β phage amplification, strand displacement amplification, or overlap extension splicing polymerase chain reaction. In some embodiments, a single molecule of nucleic acid is amplified, e.g., by digital PCR.

[0113] The term "amplification product" refers to a nucleic acid product generated by a nucleic acid amplification technique.

[0114] The term "kit" refers to any delivery system for delivering a substance.

[0115] The term "nucleic acid" refers to a polymer present in single- or double-stranded form and containing at least two deoxynucleotides or nucleotides. Unless specifically restricted, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to that of naturally occurring nucleotides. Unless otherwise indicated, a specific nucleic acid sequence also implicitly encompasses its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the explicitly recited sequence. Specifically, degenerate codon substitutions can be obtained by generating a sequence in which the third position of one or more selected (or all) codons is replaced with a mixture of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Casso et al. (1992); Rossolini et al., Mol. Cell Probes 8:91-98 (1994)). "Nucleotide" contains the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked by phosphate groups. "Base" includes purines and pyrimidines, which further include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, as well as purines and pyrimidines. Broadly speaking, an antigen can include any immunogenic fragment or determinant of a selected target, including a single epitope, multi-epitope, single domain, multi-domain, or the entire extracellular domain (ECD) or protein. Peptides, proteins, glycoproteins, polysaccharides, and lipids, parts thereof, and combinations thereof can all constitute an antigen. Non-limiting exemplary antigens include tumor antigens or pathogen antigens, etc. "Antigen" can also refer to a molecule that elicits an immune response. Any form of antigen or a cell or preparation containing the antigen can be used to generate an antibody specific for the antigenic determinant. The antigen can be an isolated full-length protein, a cell surface protein (e.g., immunized with a cell expressing at least a portion of the antigen on its surface), or a soluble protein (e.g., immunized only with the ECD portion of the protein) or a protein construct (e.g., an Fc antigen). The antigen can be produced in genetically modified cells. Any of the foregoing antigens can be used alone or in combination with one or more immunogenicity-enhancing adjuvants known in the art. The DNA encoding the antigen can be genomic or non-genomic (e.g., cDNA) and can encode at least a portion of the ECD sufficient to elicit an immunogenic response. Any vector can be used to transform the cells in which the antigen is expressed, including but not limited to adenoviral vectors, lentiviral vectors, plasmids, and non-viral vectors such as cationic lipids.

[0116] In an isothermal nucleic acid amplification system, DNA polymerase has the core function of nucleic acid amplification and is active at room temperature. In the present invention, unnatural amino acids are introduced into DNA polymerase, and oligonucleotide chains with photosensitive groups are coupled through azide residues on the unnatural amino acids. In the presence of oligonucleotide chains, DNA polymerase is inactive; after being irradiated with light of a specific wavelength, the photosensitive group breaks, the oligonucleotide chain detaches, and DNA polymerase resumes its activity, thus forming a photosensitive polymerase. Based on this enzyme, a large number of isothermal nucleic acid amplification systems will have no amplification activity during preparation, avoiding non-specific amplification. After the preparation is completed, the photosensitive DNA polymerase can be activated by irradiating with light of a specific wavelength, thereby initiating the isothermal nucleic acid amplification reaction, thus achieving light activation (specifically as shown in Figure 1 ).

[0117] In this application, the pZA16-pAzF plasmid and the pEVOL-pAzF plasmid are the same substance, purchased from AddGene, catalog number 31186, and its name in AddGene is the pEVOL-pAzF plasmid, and its name in this application is the pZA16-pAzF plasmid.

[0118] Example 1 Synthesis of Photosensitive DNA Polymerase

[0119] (I) Synthesis of Photosensitive DNA Polymerase

[0120] Expression and Purification of Unnatural DNA Polymerase

[0121] The unnatural amino acid used in the present invention is pAzF (structural formula as shown in Figure 2 ), and pAzF has an azide group, which can be connected to other molecules through click chemistry in the following steps. At the same time, in order to enable the unnatural amino acid pAzF to be site-specifically inserted into DNA polymerase, the cells for protein expression were also modified in the present invention, and the pZA16-pAzF plasmid was transfected. This plasmid expresses an aminoacyl-tRNA synthetase (pAzFRS) that can recognize pAzF and a tRNATAG that can recognize the stop codon (TAG). pAzFRS can recognize the pAzF amino acid and aminoacylate it to tRNATAG, forming a pAzF-tRNA-TAG complex. This complex can enter the ribosome to participate in protein translation and site-specifically insert pAzF at the TAG codon, realizing the unnatural modification of DNA polymerase (synthesis schematic diagram as shown in Figure 3 ).

[0122] Plasmid construction: A stop codon (TAG) was inserted into the coding sequence of the DNA polymerase protein (the amino acid sequence of the protein is shown in SEQ ID NO: 1), that is, a stop codon (TAG) was inserted into the 9th to 10th nucleotide residues of SEQ ID NO: 2. The nucleotide sequence of the DNA polymerase gene with the inserted stop codon is shown in SEQ ID NO: 4.

[0123] SEQ ID NO: 1 is specifically as follows:

[0124] MRKHQHQHQHQHQSASVEDAIEKTIEIETSFDNVDFTSLKEAAIHFELDGGNYLRNNILKFSLFTGEKHIVINADDINNYAELVSWLENPNTKKVVYDAKKTYVASHRLGIDIQNISFDIMLASYIIDPSRTISDVQSVVSLYGQSFVKDDVSIYGKGKKFKVPEDDVLNPYVASITDAIYFAKPNMDKQLEEYNQVELLADLELPLAKILSEMEEIGIFTDVHDLEEMEKEIQEKLDVLIRNIHDAAGEDFNINSPKQLGVVLFETLQLPVIKKTKTGYSTAVDVLEQLQGEHPITDYILEYRQLSKLQSTYVEGLQKVISDDQRIHTRFNQTLAQTGRLSSVDPNLQNIPVRLEEGRKIRKAFKPTSKDSVILSADYSQIELRVLAHITQDESMKEAFINGDDIHTATAMKVFGVEADQVDSSMRRQAKAINFGIVYGISDYGLSQSLGITRKKAKAFIDDYLASFPGVKQYMSDIVKDAKALGYVETLLHRRRYIPDITSRNFNLRGFAERTAMNTPIQGSAADIIKLAMVKFAQKMKETTYQAKLLLQVHDELIFEVPKSEVDSFSEFVEEIMENALQLDVPLKVDSSYGATWYDAK.

[0125] SEQ ID NO: 2 is specifically as follows:

[0126]

[0127] SEQ ID NO: 4 is as follows:

[0128]

[0129] The specific experimental process is as follows:

[0130] Primer 1: CATGCGTAAATAGCATCAGCATCAGCATCAGCATCAGCATCAGTCAG

[0131] Primer 2: GATGCTGATGCTATTTACGCATGGTCTGTTTCCTG

[0132] Preparation of template: Take the DNA polymerase plasmid (pTrc99A-P) for DNA extraction using a plasmid extraction kit (TIANGEN DP103-02) to obtain the pTrc99A-P vector. Digest the pTrc99A-P vector with DpnI restriction enzyme (20 U / μl, New England Biolabs) at 37°C overnight (12 hours) to obtain the digested product of the Trc99A-P vector, which serves as the template for the following PCR.

[0133] Use the following PCR system and PCR program to amplify the template to obtain the PCR product.

[0134] The PCR system is as follows:

[0135] Table 1

[0136] Component Reaction system Final concentration TaKaRa-PrimeSTARMax (TKARA, Catalog No.: R045Q) 25ul μl 1X 10μM Primer1 5μl 1μM 10μM Primer2 5μl 1μM Template 100ng 100ng <![CDATA[ddH 2 O]]> to 50μl

[0137] The PCR program is as follows:

[0138] Table 2

[0139]

[0140] Transformation and sequencing

[0141] Take 5 μL of the PCR product and transform it into competent cells of DH5α. After single colonies grow, pick a single colony for sequencing, and preserve the correctly sequenced ligation product to obtain the plasmid pTrc99A-P4TAG of the non-natural DNA polymerase, also known as the pTrc99A-P4TAG recombinant vector.

[0142] The pTrc99A-P4TAG recombinant vector is a recombinant plasmid obtained by inserting fragment 3 (5’-TAG-3’) between fragment 1 (5’-ATGCGTAAA-3’) and fragment 2 (5’-CATCAGCATCAGCATCAGCATCAGCA-3’) of the pTrc99A vector (the pTrc99A vector was purchased from HonorGene, catalog number HG-VYA0262), while keeping the other nucleotide sequences of the pTrc99A vector unchanged. It is named the pTrc99A-P4TAG recombinant vector, also known as pTrc99A-P4TAG.

[0143] Plasmid Transformation and Strain Construction

[0144] The pTrc99A-P4TAG and pZA16-pAzF plasmids were transferred into the BL21(DE3) strain in two steps to obtain a strain with double antibiotics that can express non-natural DNA polymerase, also known as BL21(DE3) / (pTrc99A-P4TAG / pZA16-pAzF). BL21(DE3) / (pTrc99A-P4TAG / pZA16-pAzF) is BL21(DE3) containing pTrc99A-P4TAG and pZA16-pAzF.

[0145] Example 2 Expression and Purification of DNA Polymerase

[0146] The structural formula of pAzF (CAS NO: 34670-43-4) is as Figure 2 shown.

[0147] Using the constructed strain (BL21(DE3) / (pTrc99A-P4TAG / pZA16-pAzF)), the expression and purification of non-natural DNA polymerase were carried out:

[0148] (1) Pick a single colony (BL21(DE3) / (pTrc99A-P4TAG / pZA16-pAzF)) and shake-culture it in LB medium containing Amp and Kan antibiotics until the OD600 value reaches 0.6. Then add IPTG (final concentration 0.1 mM), pAzF (final concentration 0.1 mM), and L-arabinose (final concentration 10 mM), and continue to culture overnight (12 hours) at 16°C.

[0149] (2) Collect the bacteria. Take a part, break it and centrifuge. Perform SDS-PAGE on the supernatant and precipitate to detect the protein expression.

[0150] (3) If protein expression is determined, the remaining bacterial cells are lysed and purified through an AKTA nickel column (cytiva brand, HisTrap HP purification column, catalog number 17524802), followed by SDS-PAGE to detect protein expression, and the purified unnatural DNA polymerase is obtained.

[0151] (4) The purified unnatural DNA polymerase is dialyzed into the DNA polymerase Dialysis Buffer to obtain a purified unnatural DNA polymerase solution, and the protein concentration in the purified unnatural DNA polymerase solution is 1 mg / L.

[0152] The amino acid sequence of the unnatural DNA polymerase is shown in SEQ ID NO: 3. Among them, X is pAzF. Its structural formula is as Figure 2 shown. The amino group in pAzF is peptide-bonded to the carboxyl group of lysine at the 4th position in SEQ ID NO: 3, and the carboxyl group in pAzF is peptide-bonded to the amino group of histidine at the 5th position in SEQ ID NO: 3.

[0153] SEQ ID NO: 3 is specifically as follows:

[0154] MRKXHQHQHQHQHQSASVEDAIEKTIEIETSFDNVDFTSLKEAAIHFELDGGNYLRNNILKFSLFTGEKHIVINADDINNYAELVSWLENPNTKKVVYDAKKTYVASHRLGIDIQNISFDIMLASYIIDPSRTISDVQSVVSLYGQSFVKDDVSIYGKGKKFKVPEDDVLNPYVASITDAIYFAKPNMDKQLEEYNQVELLADLELPLAKILSEMEEIGIFTDVHDLEEMEKEIQEKLDVLIRNIHDAAGEDFNINSPKQLGVVLFETLQLPVIKKTKTGYSTAVDVLEQLQGEHPITDYILEYRQLSKLQSTYVEGLQKVISDDQRIHTRFNQTLAQTGRLSSVDPNLQNIPVRLEEGRKIRKAFKPTSKDSVILSADYSQIELRVLAHITQDESMKEAFINGDDIHTATAMKVFGVEADQVDSSMRRQAKAINFGIVYGISDYGLSQSLGITRKKAKAFIDDYLASFPGVKQYMSDIVKDAKALGYVETLLHRRRYIPDITSRNFNLRGFAERTAMNTPIQGSAADIIKLAMVKFAQKMKETTYQAKLLLQVHDELIFEVPKSEVDSFSEFVEEIMENALQLDVPLKVDSSYGATWYDAK。

[0155] Among them, the HQHQHQHQHQ sequence at positions 5 - 14 of SEQ ID NO: 3 can bind to nickel columns.

[0156] Activity detection of the unnatural DNA polymerase in Example 2

[0157] Unnatural DNA polymerase: The purified unnatural DNA polymerase prepared above.

[0158] Natural DNA polymerase (also referred to as natural DNA polymerase solution in the present invention): It is a component of the RAA kit of Heqishi Company (product number MD001), and the natural DNA polymerase solution contains a natural DNA polymerase with the amino acid sequence as SEQ ID NO: 9.

[0159] SEQ ID NO: 9 is specifically as follows:

[0160] MRKHQHQHQHQHQSASVEDAIEKTIEIETSFDNVDFTSLKEAAIHFELDGGNYLRNNILKFSLFTGEKHIVINADDINNYAELVSWLENPNTKKVVYDAKKTYVASHRLGIDIQNISFDIMLASYIIDPSRTISDVQSVVSLYGQSFVKDDVSIYGKGKKFKVPEDDVLNPYVASITDAIYFAKPNMDKQLEEYNQVELLADLELPLAKILSEMEEIGIFTDVHDLEEMEKEIQEKLDVLIRNIHDAAGEDFNINSPKQLGVVLFETLQLPVIKKTKTGYSTAVDVLEQLQGEHPITDYILEYRQLSKLQSTYVEGLQKVISDDQRIHTRFNQTLAQTGRLSSVDPNLQNIPVRLEEGRKIRKAFKPTSKDSVILSADYSQIELRVLAHITQDESMKEAFINGDDIHTATAMKVFGVEADQVDSSMRRQAKAINFGIVYGISDYGLSQSLGITRKKAKAFIDDYLASFPGVKQYMSDIVKDAKALGYVETLLHRRRYIPDITSRNFNLRGFAERTAMNTPIQGSAADIIKLAMVKFAQKMKETTYQAKLLLQVHDELIFEVPKSEVDSFSEFVEEIMENALQLDVPLKVDSSYGATWYDAK。

[0161] Among them, the HQHQHQHQHQ sequence at positions 4-13 of SEQ ID NO: 9 can bind to nickel columns.

[0162] The protein concentration (native DNA polymerase) in the native DNA polymerase solution is 3.8 mg / L. The difference between the non-native DNA polymerase amino acid (the sequence is as shown in SEQ ID NO: 3) and the native DNA polymerase (the amino acid sequence is as shown in SEQ ID NO: 9) is that pAzF is inserted between the 3rd and 4th amino acids of the native DNA polymerase. Using the non-native DNA polymerase to replace the native DNA polymerase in the RAA reaction to detect whether it can support the RAA reaction, the specific method is as follows:

[0163] The experiment is divided into a RAA reaction group with native DNA polymerase and a RAA reaction group with non-native DNA polymerase.

[0164] The RAA reaction group with native DNA polymerase:

[0165] The template was amplified using the reaction Buffer in Table 4 and the reaction system in Table 5.

[0166] RAA reaction group of non-natural DNA polymerase:

[0167] The difference between the RAA reaction group of non-natural DNA polymerase and the RAA reaction group of natural DNA polymerase lies in that the natural DNA polymerase is replaced by non-natural DNA polymerase, and the remaining operations are the same as those of the RAA reaction group of natural DNA polymerase.

[0168] The results are as Figure 5 ( Figure 5 In, the protein marker in lane M, with sizes from top to bottom being 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp in turn, lane 1 is the RAA reaction group of natural DNA polymerase; lane 2 is the RAA reaction group of non-natural DNA polymerase), indicating that the RAA reaction group of non-natural DNA polymerase and the DNA polymerase of natural DNA polymerase are normal.

[0169] Example 3 Mass spectrometry analysis of non-natural DNA polymerase

[0170] To verify the correct insertion of non-natural amino acids into DNA polymerase to form the correct non-natural DNA polymerase, we performed mass spectrometry analysis on the obtained non-natural DNA polymerase. The instruments and parameters used are shown in the following table.

[0171] Table 3

[0172]

[0173] Samples (10 μL of purified non-natural DNA polymerase solution and 10 μL of purified natural DNA polymerase solution) were respectively loaded onto an autosampler (7 °C), separated by HPLC and then entered into mass spectrometry analysis. The profile map of 600 - 3200 M / Z was collected and deconvoluted using Deconvolute(MS):protein software. Deconvolute algorithm: maximum entropy, mass range: 10000 - 80000 Da. The measured molecular weight of non-natural DNA polymerase was 68402.82 Da (specifically as Figure 7 shown, the abscissa is the molecular weight, and the ordinate s is the signal intensity), and the molecular weight of wild-type DNA polymerase (natural DNA polymerase) was 68225.69 Da (specifically as Figure 6As shown, compared with the abscissa being the molecular weight and the ordinate s being the signal intensity, it is proved that the molecular weight of the unnatural DNA polymerase has increased by 177.13 Da. Although there is still an error of about 10 Da compared with the theoretical difference of 188.2 Da, this error is within the reasonable range of the mass spectrometry detection of this device. Therefore, it can be inferred that the unnatural amino acid has been successfully inserted into the unnatural DNA polymerase, proving the feasibility of this method.

[0174] Example 3 Synthesis and Click Chemistry Coupling of Photosensitive Oligonucleotide Chains

[0175] In this application, the strategy of ligating oligonucleotide chains to DNA polymerase is adopted, so that the active center of DNA polymerase is "locked" and temporarily loses its enzyme activity. A photosensitive oligonucleotide chain is synthesized and ligated to the unnatural DNA polymerase in the RAA reaction by using the "click chemistry" reaction to lock and photoactivate the enzyme activity.

[0176] Synthesis of Photosensitive Oligonucleotide Chains

[0177] The photosensitive oligonucleotide chain was synthesized by GenScript and can be represented as:

[0178] TTCCTCTACCACCTACATCA[PC BMN]C-DBCO, and the nucleotide sequence of SEQ ID NO: 5 is 5'-TTCCTCTACCACCTACATCA-3'.

[0179] The specific structure of the photosensitive oligonucleotide chain is as follows:

[0180]

[0181] Among them, A is adenine, which forms adenine deoxyribonucleotide with deoxyribose; C is cytosine, which forms cytosine deoxyribonucleotide with deoxyribose; X is DBCO, Y is [PC BMN], and Z is the oligonucleotide chain of positions 1-19 of SEQ ID NO: 5; the phosphate of the cytosine deoxyribonucleotide at the 3' end of Z forms a phosphodiester bond with the hydroxyl group in the fifth C atom of adenine deoxyribonucleotide.

[0182] The photosensitive oligonucleotide chain was dissolved in water to obtain a photosensitive oligonucleoside solution, and the concentration of the photosensitive oligonucleotide in the photosensitive oligonucleoside solution was 10 uM / L.

[0183] Among them, PC BMN ([PC BMN]) is a photosensitive group and is sensitive to light with a wavelength of 365 nm. After being irradiated with light with a wavelength of 365 nm, this group will break, causing the oligonucleotide chain to detach; DBCO is a click chemistry group and can undergo a click chemical reaction with the azide residue of pAzF in the unnatural DNA polymerase for coupling.

[0184] Coupling of Unnatural DNA Polymerase with Photosensitive Oligonucleotide Chains

[0185] (1) Incubate the unnatural DNA polymerase and the photosensitive oligonucleotide chains in a light - proof tube at a molar ratio of 1:2 at 4 °C (room temperature) for 4 hours. The reaction buffer is 1*PBS buffer solution. At this time, the unnatural DNA polymerase and the photosensitive oligonucleotide chains will be linked through click chemistry reactions.

[0186] (2) After completing step (1), remove the unreacted DBCO - modified oligomers (photosensitive oligonucleotide chains) by ultrafiltration to obtain a solution of unnatural DNA polymerase coupled with photosensitive oligonucleotide chains. In the solution of unnatural DNA polymerase coupled with photosensitive oligonucleotide chains, the concentration of the unnatural DNA polymerase coupled with photosensitive oligonucleotide chains is 1 mg / ml.

[0187] The click chemical reaction formula between the DBCO in the photosensitive oligonucleotide chains and the azide group of the above - prepared unnatural DNA polymerase is as follows Figure 8 as shown. The alkyne group of DBCO in the photosensitive oligonucleotide chains undergoes an azide - alkyne Husigen cycloaddition reaction (Copper - Catalyzed Azide–Alkyne Cycloaddition) with the azide group of pAzF in the above - prepared unnatural DNA polymerase

[0188] Coupling of Natural DNA Polymerase with Photosensitive Oligonucleotide Chains

[0189] The difference between the coupling of natural DNA polymerase with photosensitive oligonucleotide chains and the coupling of unnatural DNA polymerase with photosensitive oligonucleotide chains is that the purified solution of unnatural DNA polymerase is replaced with a purified solution of natural DNA polymerase, and the remaining operations are the same as those for the coupling of unnatural DNA polymerase with photosensitive oligonucleotide chains. After the coupling reaction, in the solution of natural DNA polymerase coupled with photosensitive oligonucleotide chains, the concentration of natural DNA polymerase is 1 mg / ml.

[0190] Nucleic Acid Amplification of Light - Initiated RAA Reaction

[0191] Preparation of the RAA System:

[0192] The RAA isothermal amplification system is a currently mature isothermal nucleic acid amplification system, which requires protein components such as recombinase (X), recombinase accessory factor (Y), single-stranded DNA binding protein (G), and DNA polymerase (P). Currently, this system has been commercially produced by the cooperative enterprise of the research group, Hangzhou Heqishi Future Biotechnology Co., Ltd., and there are mature kits for sale (product number MD001). The present invention uses the established and mature commercial RAA isothermal amplification system to replace the DNA polymerase (P) therein, in order to utilize a photoactivated unnatural DNA polymerase to achieve a photo-initiated RAA reaction. The specific operation is as follows:

[0193] Photo-initiated RAA reaction

[0194] (1) Replace the common DNA polymerase in the RAA reaction with a photoactivated unnatural DNA polymerase to construct a photo-initiated isothermal amplification system. The template, primers, and the preparation system are as follows:

[0195] Template and primers

[0196] Template: The amplified region in pET23a-sfGFPwt

[0197] ACTAATGGTAAACTGACGCTGAAGTTCATCTGTACTACTGGTAAACTGCCGGTACCTTGGCCGACTCTGGTAACGACGCTGACTTATGGTGTTCAGTGCTTTGCTCGTTATCCGGACCATATGAAGCAGCATGACTTCTTCAAGTCCGCCATGCCGGAAGGCTATGTGCAGGAACGCACGATTTCCTTTAAGGATGACGGCACGTACAAAACGCGTGCGGAAGTGAAATTTGAAGGCGATACCCTGG (SEQ ID NO: 6).

[0198] Dissolve the template in water to obtain a template solution. In the template solution, the template concentration is 200 ng / ul.

[0199] Primers:

[0200] RAA-1F: ACTAATGGTAAACTGACGCTGAAGTTCATCTGTAC (SEQ ID NO: 7).

[0201] RAA-1R: CCAGGGTATCGCCTTCAAATTTCACTTCCGCACGC (SEQ ID NO: 8).

[0202] Preparation of the RAA system

[0203] Prepare the Buffer as shown in Table 4 below:

[0204] Table 4

[0205]

[0206]

[0207] Prepare the reaction system as shown in Table 5 below:

[0208] Table 5

[0209]

[0210] The experiment is divided into 5 groups: the native enzyme group with 0 s of photoactivation, the native enzyme group with 300 s of photoactivation, the photo-locked group, the group with 180 s of photoactivation, and the group with 300 s of photoactivation.

[0211] For the native enzyme group with 0 s of photoactivation, perform the following operations:

[0212] Prepare various Buffers according to Table 4 and prepare the reaction system according to Table 5 (where P is the solution of native DNA polymerase). After preparation, mix well: cover the tube cap, invert the tube up and down 5 - 6 times to mix well, and centrifuge at low speed for 10 seconds; do not perform ultraviolet light irradiation. Then, place the detection unit tube in a 37 °C constant temperature metal bath (or constant temperature water bath, constant temperature incubator, etc.) and incubate for 30 min. After the reaction ends, take 10 μL of the reaction system for electrophoresis detection (use a phenol:chloroform:isoamyl alcohol (25:24:1) extraction reaction solution 1:1 (volume ratio) purification Kit, centrifuge at 12000 rpm / min for 3 - 5 min, and take the supernatant for electrophoresis detection to obtain the best electrophoresis effect). Finally, place the electrophoresed gel in a gel imager for photographic detection.

[0213] For the native enzyme group with 300 s of photoactivation, perform the following operations:

[0214] Prepare various Buffers according to Table 4 and prepare the reaction system according to Table 5 (where P is the solution of native DNA polymerase). After preparation, mix well: cover the tube cap, invert the tube up and down 5 - 6 times to mix well, and centrifuge at low speed for 10 seconds; irradiate with a 35 W handheld lamp under ultraviolet light for 300 s. Then, place the detection unit tube in a 37 °C constant temperature metal bath (or constant temperature water bath, constant temperature incubator, etc.) and incubate for 30 min. After the reaction ends, take 10 μL of the reaction system for electrophoresis detection (use a phenol:chloroform:isoamyl alcohol (25:24:1) extraction reaction solution 1:1 (volume ratio) purification Kit, centrifuge at 12000 rpm / min for 3 - 5 min, and take the supernatant for electrophoresis detection to obtain the best electrophoresis effect). Finally, place the electrophoresed gel in a gel imager for photographic detection.

[0215] The optical lock group performs the following operations:

[0216] Configure various Buffers according to Table 4, and configure the reaction system according to Table 5 (where P is a solution of unnatural DNA polymerase coupled with a photosensitive oligonucleotide chain). After preparation, mix well: cover the tube cap, invert it up and down 5 - 6 times to mix well, and centrifuge at low speed for 10 seconds; without ultraviolet light irradiation, then place the detection unit tube in a 37°C constant temperature metal bath (or constant temperature water bath, constant temperature incubator, etc.) and incubate for 30 mins. After the reaction ends, take 10 μL of the reaction system for electrophoresis detection (use a phenol:chloroform:isoamyl alcohol (25:24:1) extraction reaction solution 1:1 (volume ratio) purification Kit, centrifuge at 12000 rpm / min for 3 - 5 min, take the supernatant for electrophoresis detection to obtain the best electrophoresis effect). Finally, place the electrophoresed gel in a gel imager for photographic detection.

[0217] The 180s light activation group performs the following operations:

[0218] Configure various Buffers according to Table 4, and configure the reaction system according to Table 5 (where P is a solution of unnatural DNA polymerase coupled with a photosensitive oligonucleotide chain). After preparation, mix well: cover the tube cap, invert it up and down 5 - 6 times to mix well, and centrifuge at low speed for 10 seconds; irradiate with a 35W hand-held lamp under ultraviolet light for 180s, then place the detection unit tube in a 37°C constant temperature metal bath (or constant temperature water bath, constant temperature incubator, etc.) and incubate for 30 mins. After the reaction ends, take 5 - 10 μL (10 μL) of the reaction system for electrophoresis detection (use a phenol:chloroform:isoamyl alcohol (25:24:1) extraction reaction solution 1:1 (volume ratio) purification Kit, centrifuge at 12000 rpm / min for 3 - 5 min, take the supernatant for electrophoresis detection to obtain the best electrophoresis effect). Finally, place the electrophoresed gel in a gel imager for photographic detection.

[0219] The 300s light activation group performs the following operations:

[0220] Configure various Buffers according to Table 4, and configure the reaction system according to Table 5 (where P is the solution of unnatural DNA polymerase coupled with photosensitive oligonucleotide chains). After preparation, mix well: cover the tube cap, invert it up and down 5 - 6 times to mix well, and centrifuge at low speed for 10 seconds; irradiate with a 35W handheld lamp under ultraviolet light for 300s, then put the detection unit tube into a 37°C constant temperature metal bath (or constant temperature water bath, constant temperature incubator, etc.) and incubate for 30 minutes. After the reaction is completed, take 5 - 10 μL (10 μL) of the reaction system for electrophoresis detection (use a phenol:chloroform:isoamyl alcohol (25:24:1) extraction reaction solution 1:1 (volume ratio) purification Kit, centrifuge at 12000 rpm / min for 3 - 5 minutes, and take the supernatant for electrophoresis detection to obtain the best electrophoresis effect). Finally, place the electrophoresed gel in a gel imager for photographic detection.

[0221] Analyze the electrophoresis pattern with ImageJ in grayscale, and plot the analyzed values with Graphpad Prism 9.5.

[0222] The results are as Figure 9 ( Figure 9 In it, the original enzymes are the original enzyme group at 0s, the original enzyme group after 300s of photoactivation, the photoswitch is the photoswitch group, and the photoactivations are the photoactivation 180s group and the photoactivation 300s group respectively; in the upper part of the gel image, from left to right in sequence are the original enzyme group at 0s of photoactivation, the original enzyme group after 300s of photoactivation, the photoswitch group, the photoactivation 180s group, and the photoactivation 300s group. In the lower part of the bar chart, from left to right, the first bar chart is the original enzyme group at 0s of photoactivation, the second bar chart is the original enzyme group after 300s of photoactivation, the third bar chart is the photoswitch group, the fourth bar chart is the photoactivation 180s group, and the fifth bar chart is the photoactivation 300s group) as shown, verifying that in the absence of light, the photoinitiated isothermal amplification system is inactive; after irradiating the photoinitiated isothermal amplification system with a 365nm lamp, visible DNA fragments can be obtained by amplification.

[0223] The above details the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. A protein, a salt thereof or a derivative thereof, characterized in that: The protein amino acid sequence is any of the following: B1), a protein having an amino acid sequence of SEQ ID NO: 3; B2), a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in B1), which has more than 80% identity with the protein described in B1) and has the same activity; B3), connecting the N-terminus or / and C-terminus of B1) or B2) to a protein tag to obtain a fusion protein; Wherein, X is pAzF, the amino group in pAzF is linked to the carboxyl group of the 4th lysine in SEQ ID NO: 3 by a peptide bond, and the carboxyl group in pAzF is linked to the amino group of the 5th histidine in SEQ ID NO: 3 by a peptide bond; The structure of pAzF is shown below:

2. A compound, characterized in that The structural formula of the compound is as follows: Wherein, V is a polypeptide having an amino acid sequence of MR, W is a polypeptide having a sequence of positions 5 to 598 of SEQ ID NO: 3; Z is an oligonucleotide chain having a sequence of positions 1 to 19 of SEQ ID NO: 5, C is cytosine, and A is adenine; the carboxyl group at the carboxyl end of V forms a peptide bond with the amino group in the lysine residue; the amino group at the amino end of W forms a peptide bond with the carboxyl group in the pAzF residue; the phosphate of the cytosine deoxyribonucleotide at the 3' end of Z forms a phosphodiester bond with the hydroxyl group in the fifth C atom of the adenine deoxyribonucleotide.

3. The method for preparing the protein according to claim 1, characterized in that: The method comprises the steps of transcribing and translating a nucleic acid having a nucleotide sequence of SEQ ID NO: 4 to obtain the protein, wherein the translation process contains a pAzF-tRNA-TAG complex, the pAzF-tRNA-TAG complex recognizes the TAG codon and the amino acid arm carries the pAzF of claim 1.

4. The preparation method according to claim 3, characterized in that: The method comprises the steps of in vitro transcription and translation of a nucleic acid having a nucleotide sequence of SEQ ID NO: 4 to obtain the protein, wherein the translation process contains an aminoacyl tRNA synthetase that recognizes the pAzF of claim 1 and a tRNA that recognizes a stop codon.

5. The preparation method according to claim 4, characterized in that: The aminoacyl-tRNA synthetase that recognizes pAzF according to claim 1 and the tRNA that recognizes the stop codon are expressed through the pZA16-pAzF plasmid.

6. The preparation method according to any one of claims 3 to 5, characterized in that: The transcription and translation are carried out in the microorganism.

7. The method for preparing the compound according to claim 2, characterized in that: The method comprises the steps of performing an alkyne-azide cycloaddition azide-alkyne cycloaddition reaction between the azide residue of pAzF in the protein prepared by the method of any one of claims 1 or claims 3-6 and the alkyne of dibenzocyclooctyne in the photosensitive oligonucleotide chain to obtain the compound of claim 2; the structure of the photosensitive oligonucleotide chain is as follows: Wherein, Z is an oligonucleotide chain having a sequence of positions 1 to 19 of SEQ ID NO: 5, C is cytosine, and A is adenine; the phosphate of the cytosine deoxyribonucleotide at the 3' end of Z forms a phosphodiester bond with the hydroxyl group in the fifth C atom of the adenine deoxyribonucleotide.

8. Use of the protein according to claim 1 or prepared by any one of the methods of claims 3 to 6, characterized in that: The application is any of the following: 1) Use of the protein according to claim 1 or prepared by any one of the methods of claims 3 to 6 in the preparation of a photosensitive DNA polymerase; 2) Use of the protein prepared by claim 1 or any one of claims 3 to 6 in the preparation of isothermal nucleic acid amplification or in the preparation of isothermal nucleic acid amplification products.

9. Use of the compound described in claim 2 or prepared by the method of claim 7, characterized in that: The application is any of the following: 1) Use of the compound described in claim 2 or prepared by the method of claim 7 in the preparation of a photosensitive DNA polymerase product; 2) Use of the compound described in claim 2 or prepared by the method of claim 7 in the preparation of isothermal nucleic acid amplification or the preparation of isothermal nucleic acid amplification products.

10. Biomaterial, characterized in that The biological material is any of the following: B1), a nucleic acid molecule encoding the protein according to claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant cell containing the nucleic acid molecule described in B1), or a recombinant cell containing the expression cassette described in B2), or a recombinant cell containing the recombinant vector described in B3); B5), a recombinant tissue containing the nucleic acid molecule described in B1), or a recombinant tissue containing the expression cassette described in B2), or a recombinant tissue containing the recombinant vector described in B3); B6), a recombinant organ containing the nucleic acid molecule described in B1), or a recombinant organ containing the expression cassette described in B2), or a recombinant organ containing the recombinant vector described in B3); B7), a recombinant individual containing the nucleic acid molecule described in B1), or a recombinant individual containing the expression cassette described in B2), or a recombinant individual containing the recombinant vector described in B3). B8), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).