Corn phosphatidylphospholipase C4, coding gene thereof and application of corn phosphatidylphospholipase C4 in enhancing disease resistance

By transferring the phosphatidylphospholipase C4 gene in corn to rice, the problem of decreasing rice disease resistance is solved, effective resistance to rice blast and white leaf blight is achieved, and the rice yield is maintained.

CN120060203AActive Publication Date: 2025-05-30CHINA AGRI UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510198113.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-21
Publication Date
2025-05-30
Estimated Expiration
2045-02-21

AI Technical Summary

Technical Problem

Rice faces threats to various diseases, and the innate resistance of existing disease-resistant varieties is easily eroded by the rapid evolution of pathogens, resulting in a decrease in disease resistance and affecting food security.

Method used

The disease resistance of rice is enhanced, especially against rice blast and white leaf blight, by transferring phosphatidylphospholipase C4 gene (ZmPIPLC4ef) across species from maize to rice.

Benefits of technology

It has achieved significant improvement in resistance to rice blast and white leaf blight without affecting rice yield, providing a sustainable and environmentally friendly disease-resistant breeding method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005282105180000011
    Figure HDA0005282105180000011
  • Figure HDA0005282105180000012
    Figure HDA0005282105180000012
  • Figure HDA0005282105180000021
    Figure HDA0005282105180000021
Patent Text Reader

Abstract

The invention discloses corn phosphatidylphospholipase C4, a coding gene thereof and application of the corn phosphatidylphospholipase C4 in enhancing disease resistance. The corn gene phosphatidylphospholipase C4 can endow the transgenic rice with wide resistance and does not influence the rice yield, and the amino acid sequence of the corn gene phosphatidylphospholipase C4 is SEQ ID No.2. The sequence of the coding gene of the gene is SEQ ID No.1. Research shows that the corn gene phosphatidylphospholipase C4 gene is positioned on a cell membrane, the resistance of rice to rice blast caused by magnaporthe oryzae and rice bacterial leaf blight caused by Xanthomonas oryzae can be improved by overexpression of the corn gene phosphatidylphospholipase C4 gene in rice, meanwhile, the agronomic traits of the rice are evaluated, it is found that the gene does not affect the ear length and the ear grain length of the rice, and the corn gene phosphatidylphospholipase C4 gene can be applied to the field of rice production. Thousand seed weight and single plant yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the maize phosphatidylphospholipase C4 gene and its application in enhancing disease resistance. Background Art

[0002] Rice (Oryza sativa) is one of the three major staple food crops, along with wheat (Triticum aestivum) and maize (Zea mays), and provides food for more than half of the world's population. Therefore, ensuring the sustainable production of rice is crucial for global food security. However, this crop is increasingly threatened by various diseases, including rice blast caused by the ascomycete fungus Magnaporthe oryzae and bacterial blight of rice caused by the Gram-negative bacterium Xanthomonas oryzae pv. oryzae (Savary S, Willocquet L, Pethybridge SJ, Esker P, McRoberts N, Nelson A (2019) The global burden of pathogens and pests on major food crops. Nature Ecology & Evolution 3(3):430–439). Cultivating resistant cultivars provides a cost-effective and environmentally sustainable strategy for managing these diseases. However, the rapid evolution of pathogens often erodes the innate resistance of cultivars. Therefore, expanding the genetic basis through the cross-species transfer of disease-resistant genes provides a promising, sustainable, and environmentally friendly approach for enhancing the disease resistance of rice.

[0003] PIPLCs are ubiquitous enzymes that hydrolyze the phosphodiester bond in phosphatidylinositols, such as phosphatidylinositol-4,5-bisphosphate (PIP2) located in the inner leaflet of the cell membrane, to generate two secondary messengers (inositol-1,4,5-trisphosphate [IP3] and diacylglycerol [DAG]) (Arisz SA, Testerink C, Munnik T (2009) Plant PA signaling via diacylglycerol kinase. Biochimica et Biophysica Acta 1791:869–875). IP3 diffuses from the plasma membrane to the cell membrane and binds to the IP3 receptor (Ca 2+ channel) on the endoplasmic reticulum (ER). This binding causes the channel to open, releasing Ca 2+ Released from the ER into the cytoplasm (Murray SC, et al. (2023) Genetic modification can improve crop yields - but stop overselling it. Nature 621(7979):470–473). The sudden increase in the Ca level in the cell membrane activates NADPH oxidase, thereby generating reactive oxygen species (ROS). The resulting ROS regulates the Ca 2 channels, forming a positive feedback loop. DAG can still resist the plasma membrane and is phosphorylated by DAG kinase (DGK) to produce phosphatidic acid. It has been reported that both Arabidopsis PIPLC1 and rice PIPLC4 contain EF-hand-like domains, which can regulate salt tolerance by modulating the cytoplasmic Ca 2+ level (Li L, Wang F, Yan P, Jing W, Zhang C, Kudla J, Zhang W (2017) A phosphoinositide-specific phospholipase C pathway elicits stress-induced Ca 2+ signals and confers salt tolerance to rice. New Phytologist 214(3):1172–1187; Xia K, Wang B, Zhang J, Li Y, Yang H, Ren D (2017) Arabidopsis phosphoinositide-specific phospholipase C4 negatively regulates seedling salt tolerance. Plant Cell and Environment 40(8):1317–1331). 2+ signals and confers salt tolerance to rice. New Phytologist 214(3):1172–1187; Xia K, Wang B, Zhang J, Li Y, Yang H, Ren D (2017) Arabidopsis phosphoinositide-specific phospholipase C4 negatively regulates seedling salt tolerance. Plant Cell and Environment 40(8):1317–1331).

[0004] Here, we report a phosphoinositide-specific phospholipase C4 ef gene (ZmPIPLC4 ef , GenBank accession number Zm00001d007229), which, when transferred across species from maize to rice, confers resistance to blast and bacterial blight without affecting yield. The successful cross-species transformation of ZmPIPLC4 ef in rice demonstrates its potential as a valuable genetic resource for enhancing resistance to fungal and bacterial pathogens without compromising crop yield. This study highlights the importance of harnessing maize genetic diversity to improve rice resistance to epidemic diseases, thus contributing to sustainable agricultural practices. Summary of the Invention

[0005] The objective of the present invention is to expand the genetic basis of rice through cross - species transfer of disease - resistant genes, providing a promising, sustainable, and environmentally friendly method for enhancing the disease resistance of rice.

[0006] Based on this, the present invention provides the application of a maize gene, phosphatidylphospholipase C4, which can endow transgenic rice with broad resistance without affecting rice yield and can serve as a candidate gene to provide elements for disease - resistant breeding.

[0007] Specifically, the present invention provides the application of maize phosphatidylphospholipase C4 or its coding gene in enhancing plant disease resistance. The maize phosphatidylphospholipase C4 protein is the protein shown in the following 1) or 2):

[0008] 1) The protein consisting of the amino acid residue sequence of SEQ ID№.2 in the sequence listing;

[0009] 2) The protein derived from SEQ ID№:1, which is obtained by substituting and / or deleting and / or adding one or several amino acid residues in the amino acid residue sequence of SEQ ID№.2 in the sequence listing and has the function of maize phosphatidylphospholipase C4.

[0010] Among them, the cDNA nucleotide sequence of the coding gene is shown in the following 1), 2), or 3):

[0011] 1) The nucleotide sequence of SEQ ID№:1 in the sequence listing;

[0012] 2) The nucleotide sequence that can hybridize with the DNA sequence described in 1) under stringent conditions;

[0013] 3) The nucleotide sequence that has more than 90% homology with the nucleotide sequence of SEQ ID№:1 in the sequence listing and encodes a protein with the function of maize phosphatidylphospholipase C4 gene.

[0014] The plant is preferably rice.

[0015] The disease resistance refers to the resistance of rice to rice blast caused by Magnaporthe oryzae and / or bacterial blight of rice caused by Xanthomonas oryzae.

[0016] The present invention also provides a method for enhancing plant disease resistance, which is to transfer the coding gene of maize phosphatidylphospholipase C4 shown in SEQ ID№.2 into a plant and screen to obtain transgenic plants with enhanced disease resistance.

[0017] Among them, the plant is rice, and the disease resistance is the resistance of rice to rice blast caused by Magnaporthe oryzae and / or bacterial blight of rice caused by Xanthomonas oryzae.

[0018] In the present invention, phosphatidylinositol phospholipase 4 (GenBank accession number Zm00001d007229) was cloned from maize and named ZmPIPLC4 ef gene. The cDNA of this gene is 1764 bp, and its nucleotide sequence is shown in Sequence Listing SEQ ID NO: 1; it encodes a protein of 587 amino acids, and the amino acid sequence is shown in Sequence Listing SEQ ID NO: 2. The protein contains three domains: the X and Y catalytic domains of phospholipase C (PLCXc and PLCYc) and the conserved region 2 of protein kinase C (C2) ( Figure 1 ). This tripartite domain structure is conserved in plant and animal PIPLCs (Abd-El-Haliem AM, Joosten MH (2017) Plant phosphatidylinositol-specific phospholipase C at the center of plant innate immunity. Journal of Integrative Plant Biology 59(3):164–179.); however, ZmPIPLC4ef is different from other PIPLCs and lacks an EF-hand-like domain at its N-terminus, and this domain is related to calcium ion binding. Similar to plant and animal PIPLCs, the catalytic X and Y domains of ZmPIPLC4ef form a (βα)8-barrel structure, similar to the triose phosphate isomerase barrel structure ( Figure 2 ).

[0019] To study whether ZmPIPLC4 ef is localized to the plasma membrane like typical PIPLCs, we transiently co-expressed ZmPIPLC4 ef -GFP and AtPIP2-mCherry (a plasma membrane marker) in tobacco leaves under the control of the 35S promoter by agroinfiltration. The GFP signal of ZmPIPLC4 ef -GFP and the RFP signal of AtPIP2-RFP overlapped on the plasma membrane of tobacco epidermal cells ( Figure 3 A). We further transfected maize protoplasts with ZmPIPLC4 ef -GFP and stained them with the endocytosis / membrane tracer FM4-64. In maize protoplasts, ZmPIPLC4 efThe GFP signal of -GFP overlapped with FM4-64( Figure 3 B), confirming the localization of ZmPIPLC4 ef on the plasma membrane.

[0020] To evaluate the role of ZmPIPLC4 ef in cross-species disease resistance, we generated transgenic lines of the japonica cultivar Zhonghua 11 (ZH11) overexpressing ZmPIPLC4 ef under the control of the Ubi promoter, including OsZmPIPLC4 ef -1, OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14( Figure 4 ). Lines OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14 (T2) were selected for further evaluation. The yield components of the transgenic lines and ZH11 were rigorously evaluated according to the randomized complete block design and related best practices outlined by Khaipho-Burch et al. (2023) and Wang et al. (2023) (Khaipho-Burch M, Cooper M, Crossa J, de Leon N, Holland J, Lewis R, McCouch S, Murray SC, et al. (2023) Genetic modification can improve crop yields - but stop over-selling it. Nature 621(7979):470–473; Wang Y, Yue J, Yang N, Zheng C, Zheng Y, Wu X, Yang J, Zhang H, et al. (2023). An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food 4(9):774–787). After comparative analysis of the yield components of the harvested crops, it was found that the transgenic lines (OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14) and ZH11 were similar in panicle length( Figure 5 A), grain size( Figure 5 B,C), 1000-grain weight( Figure 5 D; p>0.01) and grain weight per hill( Figure 5There were no significant differences in aspects such as E; p > 0.01). These results indicate that the expression of ZmPIPLC4 ef will not have a negative impact on the grain yield of transgenic rice lines. We further evaluated the resistance of these transgenic lines to the main fungal and bacterial diseases affecting rice production. We performed phenotypic analysis on the responses of ZH11, OsZmPIPLC4 ef -8, and OsZmPIPLC4 ef -14 lines to the rice blast pathogen strain SZ5 and the bacterial blight pathogen PXO99A. The transgenic lines showed quantitative resistance to rice blast. Six days after inoculation, the rice blast lesions on the inoculated leaves decreased ( Figure 6 A), and the leaf area affected by rice blast decreased significantly (the lesion areas of OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14 were 0.28 cm 2 and 0.24 cm 2 , respectively, while that of ZH11 was 1.29 cm 2 )( Figure 6 B; p < 0.001). Similarly, the transgenic lines showed quantitative resistance to bacterial blight ( Figure 7 A), and the lesion length was significantly smaller 14 dpi (the lesion lengths of OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14 were 0.50 cm and 0.34 cm, respectively, while that of ZH11 was 2.50 cm)( Figure 7 B; p < 0.001). These data confirm that OsZmPIPLC4 ef can confer broad-spectrum, cross-varietal resistance without causing yield loss.

[0021] Advantages of the present invention

[0022] 1. When the OsZmPIPLC4 ef transgenic rice plants were inoculated with Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae respectively under the same conditions, compared with the wild-type Zhonghua 11, the disease development was significantly weakened, and the lesion area and length decreased significantly, indicating that this gene has a certain broad resistance to rice pathogens.

[0023] 2. When evaluating the yield of the OsZmPIPLC4 ef transgenic rice plants, there were no significant differences in rice panicle length, 1000-grain weight, grain weight per plant, and grain length compared with the wild-type Zhonghua 11, indicating that this gene does not affect rice yield. Brief description of the drawings

[0024] Figure 1 is the protein domain of ZmPIPLC4 ef protein.

[0025] Figure 2 is ZmPIPLC4 ef Protein 3D structure prediction.

[0026] Figure 3 is ZmPIPLC4 ef Localization in tobacco (A) and protoplasts (B), Bars = 20 μm.

[0027] Figure 4 RT-PCR detection of the expression efficiency of transgenic rice.

[0028] Figure 5 Evaluation of the yield of transgenic rice (A) panicle length; (B, C) grain size; (D) 1000-grain weight; (E) grain weight per hill, Bars = 1 cm.

[0029] Figure 6 For (A) inoculation map of Magnaporthe oryzae on rice leaves (B) measurement of lesion area.

[0030] Figure 7 For (A) inoculation map of Xanthomonas oryzae pv. oryzae on rice leaves (B) measurement of lesion length. Detailed implementation manners

[0031] The following specific examples further illustrate the present invention for better understanding. For those not specifying specific techniques or conditions in the examples, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0032] Example 1, Obtaining of phosphatidylphospholipase 4 (ZmPIPLC4 ef ) and its encoding gene.

[0033] The present invention cloned phosphatidylphospholipase 4 (GenBank accession number Zm00001d007229) from maize and named it ZmPIPLC4 ef gene. The cDNA of this gene is 1764 bp, and its nucleotide sequence is as shown in SEQ ID NO: 1 in the sequence listing; it encodes a protein of 587 amino acids, and the amino acid sequence is as shown in SEQ ID NO: 2 in the sequence listing. The protein contains three domains: the X and Y catalytic domains of phospholipase C (PLCXc and PLCYc) and the conserved region 2 of protein kinase C (C2)( Figure 1 ). This tripartite domain structure is conserved in plant and animal PIPLCs (Abd-El-Haliem et al., 2017); however, ZmPIPLC4 efUnlike other PIPLCs, it lacks an EF-hand-like domain at its N-terminus, and this domain is related to calcium ion binding. Similar to plant and animal PIPLCs, ZmPIPLC4 ef 's catalytic X and Y domains form a (βα)8-barrel structure, similar to the triose phosphate isomerase barrel structure ( Figure 2 ).

[0034] Take the leaves of maize Ye 478. After grinding them in liquid nitrogen, extract the leaf RNA using the TRNzol Universal total RNA extraction reagent (DP424) from Tiangen Biotech (Beijing) Co., Ltd.; then reverse transcribe the RNA into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit from Vazyme Biotech Co., Ltd.

[0035] Using the above cDNA as a template, amplify the target fragment by PCR: Using F1: TacaccaaatcgactctagaATGGGCACCACGTAC and R1: CCCTTGCTCACCATcccgggGGCAAACTCGAAACG as primers, amplify the pCAMBIA1300-ZmPIPLC4ef-eGFP fragment for constructing the localization vector; using F2: TACTTCTGCACTAGGTACCATGGGCACCACGTAC and R2: TTAGAATTCCCGGGGATCCGGCAAACTCGAAACG as primers, amplify the pCAMBIA1390U-ZmPIPLC4 ef fragment for constructing the overexpression vector.

[0036] The total volume of the PCR reaction system is 50 μL, and the reaction system is as follows: 2×Phanta Max Master Mix 25 μL, forward primer (10 μM) 2 μL, reverse primer (10 μM) 2 μL, template 1 μg, ddH 2 O is supplemented to 50 μL.

[0037] The PCR amplification program is: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 sec, annealing at 58 °C for 15 sec, extension at 72 °C for 2 min, 35 cycles; extension at 72 °C for 5 min; store at 4 °C.

[0038] Sequence the PCR amplification products. The results show that the obtained pCAMBIA1300-ZmPIPLC4 ef -eGFP and pCAMBIA1390U-ZmPIPLC4 ef both contain the ZmPIPLC4 ef sequence shown in Sequence 1.

[0039] Example 2, ZmPIPLC4 ef Subcellular localization

[0040] To investigate whether ZmPIPLC4ef is localized to the plasma membrane like typical PIPLCs, we transiently co-expressed ZmPIPLC4 ef -GFP and AtPIP2-mCherry (a plasma membrane marker) in tobacco leaves under the control of the 35S promoter by agroinfiltration.

[0041] The specific method is as described below:

[0042] I. Construction of the expression vector for subcellular localization

[0043] OsZmPIPLC4 was amplified from the cDNA of the maize cultivar Ye478 leaves ef and cloned into the pCAMBIA1300 plasmid. Specifically, the pCAMBIA1300-ZmPIPLC4 ef obtained in Example 1 was inserted between the recognition sites of XbaI and SmaI of pCAMBIA1300 to obtain a recombinant expression vector for subcellular localization; after correct verification by sequencing, it was named pCAMBIA1300-ZmPIPLC4.

[0044] II. Subcellular localization in tobacco

[0045] The pCAMBIA1300-ZmPIPLC4-eGFP vector was transferred into Agrobacterium tumefaciens GV3101, and the transformed Agrobacterium was cultured in LB liquid medium (containing 50 mg / L kanamycin and 100 mg / L rifampicin) until the OD 600 was about 0.6, centrifuged at 5000 rpm for 5 min, the cells were collected, and gently resuspended with the prepared MMA (10 mM MgCl 2 , 10 mM MES, 200 μM AS) solution, and the cell concentration was adjusted to OD 600 = about 0.6. After standing at room temperature for 1 - 3 hours, it was injected into the tobacco leaves at four weeks old for transient expression. After 48 hours, fluorescence observation and photography were carried out using a confocal microscope (Leica SP8). The results showed that the GFP signal of ZmPIPLC4 ef -GFP and the RFP signal of AtPIP2-RFP overlapped on the plasma membrane of tobacco epidermal cells ( Figure 3 A).

[0046] III. Subcellular localization in maize

[0047] The pCAMBIA1300-ZmPIPLC4-eGFP plasmid was also used to transform maize protoplasts. The GFP signal of ZmPIPLC4-eGFP in protoplasts was captured using a laser scanning confocal microscope 16-20 hours after infiltration. FM4-64 was used as a membrane marker in the confocal experiments.

[0048] We further used ZmPIPLC4 ef -GFP transfected protoplasts of ZmPIPLC4 in maize and stained with the endocytic / membrane tracer FM4-64. ef -GFP signal overlaps with FM4-64 ( Figure 3 B), confirmed that ZmPIPLC4 ef Localization at the plasma membrane.

[0049] Example 3, Transfection of ZmPIPLC4 ef Disease resistance testing

[0050] 1. Transfection of ZmPIPLC4 ef Construction of overexpression vector for transforming rice

[0051] OsZmPIPLC4 was amplified from the cDNA of the leaves of the maize cultivar Ye 478 according to the method of Example 1. ef , cloned into pCAMBIA1390U plasmid. Specifically, pCAMBIA1390U-ZmPIPLC4 obtained in Example 1 was cloned into pCAMBIA1390U plasmid. ef The recombinant expression vector was inserted between the KpnI and BamHI enzyme recognition sites of pCAMBIA1390U to obtain a recombinant expression vector for transforming rice; the vector was verified to be correct by sequencing and named pCAMBIA1390U-ZmPIPLC4.

[0052] 2. Transfection of ZmPIPLC4 ef Obtaining rice

[0053] Take 1 μL of plasmid pCAMBIA1390U-ZmPIPLC4 and add it to 50 μL EHA105 / GV3101 Agrobacterium competent cells. After thorough mixing, incubate in liquid nitrogen for 5 minutes, at 37°C for 5 minutes, and on ice for 5 minutes. After transformation, add 1 mL of LB liquid culture medium (without antibiotics) and mix thoroughly. Pipet it into a 1.5 mL centrifuge tube and culture it on a shaker at 30°C and 180 rpm for 3 hours. Pipet 100 μL of the activated Agrobacterium culture solution and inoculate it on LB solid culture medium and culture it in the dark at 30°C for 48 hours.

[0054] Select rice grains without mildew spots and normal germ pores, disinfect them with 75% alcohol for 1 min, wash them with sterile water, 1 min / time; disinfect them with 15% sodium hypochlorite for 20 min, and wash them with sterile water 3 times, 1 min / time; inoculate the disinfected Zhonghua 11 rice grains on the induction medium and culture them under light at 26 °C for 20 days. Pick Agrobacterium into the MMA infection solution to prepare an Agrobacterium resuspension with an OD 600 = 0.2. Pick the callus into a triangular flask, add the Agrobacterium resuspension, discard the bacterial solution after infection for 10 - 15 min, and inoculate the callus on the co-culture medium and co-culture it at 20 °C for 48 - 72 h. Inoculate the cultured callus on the Hygromycin B medium and culture it at 26 °C for 20 - 30 days; inoculate the positive callus onto the secondary screening medium. When picking the callus, be sure to pick monoclonal callus and culture it at 26 °C for 7 - 10 days; inoculate the positive callus onto the differentiation medium and culture it under light at 25 - 27 °C for 15 - 20 days. After the buds of 2 - 5 cm are differentiated, inoculate them onto the rooting medium and culture them under light at 30 °C for 7 - 10 days; take the leaves of the transgenic plants, extract gDNA, use hyg(481)F: CTGCCCGCTGTTCTACAACCGG and hyg(481)R: GGAGCATATACGCCCGGAGTC as detection primers, and the transgenic plants verified correctly by PCR detection are positive seedlings for subsequent breeding experiments.

[0055] For the identification of the transgenic expression efficiency of T2 seedlings, extract the RNA of rice leaves by the above RNA extraction method and reverse transcribe it into cDNA, and synthesize the corresponding detection primers: qZmPIPLC4 ef -F: GTGAAGGTGTACATGGGCGA and qZmPIPLC4 ef -R: CTCGATCGCGTTGGTCTTCT are used as gene detection primers; qOsActin-F: TCCATCTTGGCATCTCTCAG and qOsActin-R: GTACCCTCATCAGGCATCTG are used as internal reference detection primers, and semi-quantitative RT-PCR is carried out to verify the presence and expression of ZmPIPLC4 ef in the T2 transgenic lines. Obtain the transgenic lines of the japonica rice cultivar Zhonghua 11 (ZH11) overexpressing ZmPIPLC4 ef , including OsZmPIPLC4 ef -1, OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14.

[0056] The reagents used in the above transformation process:

[0057] Induction medium: 100 mL of N6max stock solution (10x), 10 mL of N6min stock solution (100x), 10 mL of 100x Fe 2+ -EDTA stock solution, 10 mL of 100x Vitamin stock solution, 2.5 mL of 2,4-D stock solution, 0.6 g of Proline, 0.8 g of CH, 30 g of Sucrose, 3 g of Phytagel, adjusted to pH = 5.8 with KOH, made up to 1 L with ddH 2 O and autoclaved.

[0058] Suspension medium: 12.5 mL of N6max stock solution (10x), 1.25 mL of N6min stock solution (100x), Fe 2+ -EDTA stock solution (100x) 1.25 mL, Vitamin stock solution (100x) 2.5 mL, 0.15 g of Proline, 0.2 g of CH, 0.625 mL of 2,4-D stock solution, 5 g of Sucrose, adjusted to pH = 5.2 with KOH, made up to 250 ml and autoclaved. Add 5 mL of 50% glucose and 250 μL of AS stock solution before use.

[0059] Co-culture medium: 12.5 mL of N6max stock solution (10x), 1.25 mL of N6min stock solution (100x), Fe 2+ -EDTA stock solution (100x) 1.25 mL, Vitamin stock solution (100x) 2.5 mL, 0.625 mL of 2,4-D stock solution, 0.15 g of Proline, 0.2 g of CH, 7.5 g of Sucrose, 2 g of Agar powder, adjusted to pH = 5.6 with KOH, made up to 250 ml and autoclaved. Add 5 ml of 50% glucose and 250 μl of AS stock solution before use.

[0060] Selection medium: 25 mL of N6 stock solution (10x), 2.5 mL of N6 stock solution (100x), Fe 2+ -EDTA stock solution (100x) 2.5 mL, Vitamin stock solution (100x) 2.5 mL, 0.625 mL of 2,4-D stock solution, 0.15 g of Proline, 0.2 g of CH, 7.5 g of Sucrose, 2 g of Agar powder. First add 200 mL of distilled water, adjusted to pH = 6.0 with KOH, made up to 250 mL and autoclaved. Add 250 μL of Hn (50 mg / mL) and 500 μL of Cn (250 mg / mL) before use.

[0061] Differentiation medium: MSmax stock solution (10x) 100 ml, MSmin stock solution (100x) 10 ml, Fe2+-EDTA stock solution (100x) 10 ml, Vitamin stock solution (100x) 10 ml, KT stock solution 2.0 ml, NAA stock solution 0.2 ml, Proline 0.6 g, CH 0.8 g, D-sorbitol 30 g, Sucrose 30 g, Phytagel 3.0 g. First, add 900 ml of distilled water, adjust the pH to 5.8 with KOH, make up to 1 L, and autoclave.

[0062] Rooting medium: MSmax mother liquor (10x) 50 mL, MSmin mother liquor (100x) 5 mL, Fe2+-EDTA stock solution (100x) 5 mL, Vitamin mother liquor (100x) 5 mL, Sucrose 20 g, Phytagel 3 g. Adjust the pH to 5.8 with KOH, make up to 1 L, and autoclave.

[0063] MSmax mother liquor (10x): NH 4 NO 3 16.5 g KH 2 PO 4 1.7 g, KNO 3 19.0 g, MgSO 4 ·7H 2 O 3.7 g, CaCl2·2H2O 4.4 g, make up to 1 L.

[0064] MSmin mother liquor (100x): MnSO 4 ·4H 2 O 2.23 g, ZnSO 4 ·7H 2 O 0.86 g, H 3 BO 3 0.62 g, KI 0.083 g Na 2 MoO 4 ·2H 2 O 0.025 g, CoCl 2 ·6H 2 O 0.0025 g, CuSO 4 ·5H 2 O 0.0025 g, Na 2 MoO 4 ·2H 2 O Make up to 1 L and store at room temperature.

[0065] N6max mother liquor (10x): KNO 3 28.3 g; KH 2 PO4 4.0 g; (NH 4 ) 2 SO 4 4.63 g; MgSO 4 ·7H 2 O 1.85 g; CaCl 2 ·2H 2 O 1.66 g, made up to 1 L.

[0066] N6 min Mother liquor (100x): MnSO 4 ·4H 2 O 0.44 g; ZnSO 4 ·7H 2 O 0.15 g; H 3 BO 3 0.16 g, KI 0.08 g, dissolved one by one, added ddH 2 O made up to 1 L.

[0067] Fe2+-EDTA mother liquor (100x): FeSO 4 ·7H 2 O 2.78 g dissolved in 300 mL ddH 2 O, and in addition, 3.73 g of Na 2 EDTA·2H 2 O was dissolved in 300 mL at 70 °C. The two solutions were mixed, incubated at 70 °C for 2 h, made up to 1 L, and stored in the dark at 4 °C.

[0068] Vitamin mother liquor (100x): Nicotinic acid 0.1 g, Pyridoxine HCl (VB6) 0.1 g, Thiamine HCl (VB1) 0.1 g, Glycine 0.2 g, Inositol 10 g, dissolved and made up to 1 L, stored at 4 °C.

[0069] 2,4-D mother liquor (1 mg / mL): 100 mg of 2,4-D was added to 1 mL of 1 M KOH and stirred for 5 min, then 10 mL of ddH 2 O was added and stirred until 2,4-D was completely dissolved, made up to 100 mL, and stored at 4 °C.

[0070] IAA mother liquor (1 mg / mL): 100 mg of IAA was added to 1 mL of 1 M KOH and stirred until IAA was completely dissolved, and ddH 2 O was added and made up to 100 mL, stored in the dark at 4 °C.

[0071] NAA stock solution (1 mg / mL): Add 100 mg of NAA to 1 mL of 1 M KOH and stir until the NAA is completely dissolved. Then add ddH 2 O to make up the volume to 100 mL and store it in the dark at 4°C.

[0072] 1 M KOH mother liquor: Dissolve 5.6 g of KOH in 100 mL of ddH 2 O and store it at room temperature.

[0073] 0.15% HgCl 2 : Dissolve 1.5 g of HgCl 2 in ddH 2 O, make up the volume to 1000 mL, add 1,000 μL of Tween 20, mix well, store it in the dark at room temperature.

[0074] 200 mM AS mother liquor: Dissolve 0.39 g of AS in 10 ml of DMSO, aliquot and store at -20°C.

[0075] 250 mg / ml Cn: Add 2.5 g of Cn in a laminar flow hood to sterilized ddH 2 O to a final volume of 10 mL, dissolve completely, and store at -20°C. 50% glucose: Dissolve 50 g of glucose in ddH 2 O, make up the volume to 100 ml, sterilize at 121°C for 15 min, and store at 4°C.

[0076] III. Rice infection experiment

[0077] To evaluate the role of ZmPIPLC4 ef in cross-variety disease resistance, we generated transgenic lines of the japonica rice cultivar Zhonghua 11 (ZH11) overexpressing ZmPIPLC4 ef under the control of the Ubi promoter, including OsZmPIPLC4 ef -1, OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14 ( Figure 4 ). Lines OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14 (T2) were selected for further evaluation.

[0078] We evaluated the resistance of these transgenic lines to the main fungal and bacterial diseases affecting rice production. We tested ZH11, OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef-14 lines were phenotypically analyzed for their responses to the rice blast fungus (Magnaporthe oryzae) strain SZ5 (kindly provided by Professor Peng Youliang of the College of Plant Protection, China Agricultural University, Wang Y, Yue J, Yang N, Zheng C, Zheng Y, Wu X, Yang J, Zhang H, et al. (2023). An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food 4(9):774–787; the public can obtain it from China Agricultural University) and the bacterial blight pathogen (Xanthomonas oryzae) PXO99A (kindly provided by Associate Professor Cui Fuhao of the College of Plant Protection, China Agricultural University, Mou B, Zhao G, Wang J, Wang S, He F, Ning Y, Li D, Zheng X, Cui F, Xue F, Zhang S, Sun W. The OsCPK17-OsPUB12-OsRLCK176 module regulates immune homeostasis in rice. Plant Cell 36(4):987–1006; the public can obtain it from China Agricultural University). Leaves of 28-day-old T2 transgenic lines (OsZmPIPLC4-8 and OsZmPIPLC-14) and the O. sativa cv. parental line Zhonghua 11 (ZH11) were spray-inoculated.

[0079] After SZ5 was cultured on OMA for 7 - 10 days, conidia were collected, centrifuged at 3000g for 30 s, and rinsed three times with ddH 2 O. After counting with a hemocytometer, a conidial suspension (1×10 5 conidia per milliliter, containing 0.025% Tween 20) was prepared, and the phenotype of the rice blast response was observed at 6 days post inoculation (dpi). Lesion areas were measured with ImageJ six days later.

[0080] The strain PXO99A was cultured in an inverted position on an NA plate at 28 °C for 48 h. Using NA liquid medium, after shaking at 200 rpm for 12 h, the cells were collected at 8000 rpm for 2 min and then suspended in 10 mM MgCl 2 and the concentration was adjusted to OD 600= 0.8. The virulence was evaluated using the leaf - cutting method. Rice leaves that had grown for 6 - 8 weeks were selected for inoculation. The scissors were immersed in the bacterial suspension, and the cut ends were inoculated. The disease incidence of rice was observed regularly during this period. The lesion length was measured at 14 dpi, and the calculation method of the ratio of the lesion length to the total leaf length was as described previously (Khaipho - Burch M, Cooper M, Crossa J, de Leon N, Holland J, Lewis R, McCouch S, Murray SC, et al. (2023) Genetic modification can improve crop yields - but stop overselling it. Nature 621(7979):470–473.).

[0081] The transgenic lines showed quantitative resistance to rice blast. Six days after inoculation, the rice blast lesions on the inoculated leaves decreased ( Figure 6 A), and the leaf area affected by rice blast decreased significantly (the lesion areas of OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14 were 0.28 cm 2 and 0.24 cm 2 , respectively, while that of ZH11 was 1.29 cm 2 )( Figure 6 B; p < 0.001).

[0082] Similarly, the transgenic lines showed quantitative resistance to bacterial blight ( Figure 7 A), and the lesion length became significantly smaller after 14 dpi (the lesion lengths of OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14 were 0.50 cm and 0.34 cm, respectively, while that of ZH11 was 2.50 cm)( Figure 7 B; p < 0.001). These data confirm that OsZmPIPLC4 ef can confer broad - spectrum, cross - variety resistance without causing yield loss.

[0083] Example 3. Yield evaluation

[0084] In accordance with the randomized complete block design and related best practices outlined by Khaipho - Burch et al. (2023) and Wang et al. (2023), the yield components of the transgenic lines and ZH11 were rigorously evaluated. ZH11, OsZmPIPLC4 ef -8 and OsZmPIPLC4 efThe mature seedlings of the -14 strain were measured, including yield components such as panicle length, 1000-grain weight, and grain size, and evaluated according to the standard methods outlined by Khaipho-Burch et al. (Khaipho-Burch M, Cooper M, Crossa J, de Leon N, Holland J, Lewis R, McCouch S, Murray SC, et al. (2023) Genetic modification can improve crop yields - but stop overselling it. Nature 621(7979):470–473.) and Wang et al. (Wang Y, Yue J, Yang N, Zheng C, Zheng Y, Wu X, Yang J, Zhang H, et al. (2023). An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food 4(9):774–787.). The experiment used a randomized complete design with three biological replicates.

[0085] Comparative analysis of the yield components of the harvested crops revealed that there were no significant differences between the transgenic lines (OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14) and ZH11 in terms of panicle length ( Figure 5 A), grain size ( Figure 5 B, C), 1000-grain weight ( Figure 5 D; p>0.01), and grain weight per hill ( Figure 5 E; p>0.01). These results indicate that the expression of ZmPIPLC4 ef does not have a negative impact on the grain yield of transgenic rice lines.

[0086] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this utility are also within the scope of the present invention. Therefore, equivalent transformations and modifications made without departing from the spirit and scope of the present invention should all be covered within the scope of the present invention.

Claims

1. Use of corn phosphatidylphospholipase C4 or its encoding gene in enhancing plant disease resistance, wherein the corn phosphatidylphospholipase C4 protein is the protein shown in 1) or 2) below: 1) A protein consisting of the amino acid residue sequence of SEQ ID No. 2 in the sequence listing; 2) A protein derived from SEQ ID No. 1 in which one or more amino acid residues of the amino acid residue sequence of SEQ ID No. 2 in the sequence list are replaced and / or deleted and / or added and which has the function of corn phosphatidyl phospholipase C4.

2. The use according to claim 1, characterized in that: The cDNA nucleotide sequence of the coding gene is shown in 1), 2) or 3) below: 1) the nucleotide sequence of SEQ ID No.: 1 in the sequence listing; 2) a nucleotide sequence that can hybridize with the DNA sequence described in 1) under stringent conditions; 3) A nucleotide sequence having more than 90% homology with the nucleotide sequence of SEQ ID No.: 1 in the sequence list and encoding a protein having the function of the maize phosphatidylphospholipase C4 gene.

3. The use according to claim 1 or 2, characterized in that: The plant is rice.

4. The use according to claim 3, characterized in that: The disease resistance is the resistance of rice to rice blast caused by Magnaporthe oryzae and / or rice bacterial blight caused by Xanthomonas oryzae.

5. A method for improving plant disease resistance, comprising transferring the gene encoding maize phosphatidylphospholipase C4 shown in SEQ ID No. 2 into plants, and screening transgenic plants with improved disease resistance.

6. The method according to claim 5, wherein the plant is rice, and the disease resistance is resistance of rice to rice blast caused by Magnaporthe oryzae and / or rice bacterial blight caused by Xanthomonas oryzae.

Citation Information

Patent Citations

  • Use of rice polypeptides / nucleic acids for plant improvement

    CN102037125A

  • Gossypium hirsutum phosphatidylinositol specific phospholipase C gene GhPIPLC4-1 and application thereof

    CN114196687A

  • Rice adiponectin receptor OsPLS3 protein as well as coding gene and application thereof

    CN119613517A

  • Corn NAC transcription factor and application thereof in enhancing disease resistance

    CN120098099A

  • Coatings and surface treatments having active enzymes and peptides

    EP2324087A2