Novel normal-temperature prokaryotic Argonaute protein as well as gene and application thereof

Abstract

The invention relates to the technical field of molecular biology, in particular to Argonaute protein derived from normal-temperature prokaryotes and gene editing application of the Argonaute protein. The amino acid sequence of the Argonaute protein is as shown in SEQ ID No.1, or the Argonaute protein has more than 90%, more than 95%, more than 98%, preferably more than 99% of identity with the sequence as shown in SEQ ID No.1, has the same function and comes from normal-temperature prokaryotes. The prokaryote Ago protein and PLD nuclease AgaP coupled with the prokaryote Ago protein are used for endowing a host with a virus defense function for the first time, and a strain with antiviral capacity can be constructed; furthermore, on the basis of the function of the Ago protein, the NpAgo can be used for remarkably improving the gene editing efficiency in escherichia coli, and the practical application of bacterial gene editing is effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and relates to an Argonaute protein derived from prokaryotes at room temperature, its gene and application. Background Art

[0002] Based on the ability of nucleases to specifically cleave target DNA under the guidance of short nucleotide molecules, gene editing tools can be developed, such as the CRISPR-Cas nuclease system. The CRISPR-Cas gene editing system requires RNA guidance, and there are certain difficulties in the preparation and delivery of RNA guidance, and there may be accidental secondary structures. The editing sites of the CRISPR gene editing system are restricted by the PAM sequence, and there is also an off-target risk. Therefore, it is necessary to explore new nucleases and develop corresponding editing systems.

[0003] The Argonaute (Ago) protein in eukaryotes is a key component of RNA silencing (RNA interference, RNAi). The prokaryotic Argonaute protein (pAgo) is homologous to the eukaryotic Ago protein. A typical full-length pAgo contains an N domain, a PAZ domain, a MID domain, and a PIWI domain. Existing research reports mainly focus on full-length pAgo. As a microbial immune system, pAgo can usually use short RNA or DNA as a guide to specifically bind and cleave target DNA.

[0004] Since some full-length pAgos have programmability and the ability to cleave target nucleic acids, it is expected to develop pAgo into a new type of gene editing tool. However, most of the reported pAgos currently have activity at high temperatures (>65°C), which limits their gene editing applications in the room temperature environment. Currently, pAgo has many application scenarios in gene detection, genetic engineering technology, etc. For example, based on PfAgo (Pyrococcus furiosus Argonaute), a nucleic acid detection method PAND has been established, which can achieve single nucleotide mutant detection and multiplex detection; based on TtAgo (Thermus thermophilus Argonaute), an Ago-FISH technology has been established to promote the ability of fluorescently labeled DNA probes to bind to target RNA for specific visualization detection of miRNA; based on PfAgo, a programmable and universal artificial restriction endonuclease has been developed.

[0005] Recently, scientists have promoted gene editing in Escherichia coli using NgAgo (Natronobacterium gregoryi Argonaute) and CbAgo (Clostridium butyricum Argonaute). By adding short DNA guides or plasmid-derived DNA guides to direct the Ago protein to cleave the target, recombination is promoted to achieve improved gene editing efficiency. However, there are some limiting factors in the use of these proteins. For example: (1) Protein solubility. When expressed in other hosts, there is poor solubility, resulting in inclusion bodies that affect their normal active functions; (2) DNA guide delivery limitation. Single-stranded DNA guides cannot be efficiently delivered, and plasmid-derived DNA guides require the preparation of delivery vectors, which is cumbersome; (3) CbAgo has chopping activity and can exert cleavage activity to generate DNA guides in a DNA-guide-independent manner. Therefore, the method of encoding DNA guides by plasmids may cause off-target site editing. In summary, exploring novel room-temperature pAgo proteins is of great significance for the development of high-performance novel gene editing tools. Summary of the Invention

[0006] The present invention provides an Argonaute protein derived from a room-temperature prokaryote, which can be used to construct antiviral strains and improve gene editing efficiency. By introducing NpAgo into the target strain, the present invention can endow the host bacterium with the ability to resist viruses. Importantly, by expressing NpAgo in the target strain, in the presence of a homologous template, the gene editing efficiency can be significantly improved in a DNA-guide-independent manner. This method is easy to design, does not cause genome breakage, reduces off-target effects, and has good operability.

[0007] Therefore, the object of the present invention is to provide an Argonaute protein derived from a prokaryote and its application in gene editing.

[0008] The present invention provides an Argonaute protein derived from a room-temperature prokaryote, the amino acid sequence of which is shown in SEQ ID No. 1, or has more than 90%, more than 95%, more than 98%, preferably more than 99% identity with the sequence shown in SEQ ID No. 1, has the same function, and is derived from a room-temperature prokaryote.

[0009] The present invention also provides a gene encoding the Argonaute protein derived from the room-temperature prokaryote, preferably with nucleotide sequence optimization based on the codon preference of Escherichia coli.

[0010] The present invention also provides a conjugated protein, which is obtained by conjugating the Argonaute protein derived from the mesophilic prokaryote with the AgaP protein. Preferably, the amino acid sequence of the AgaP protein is as shown in SEQ ID No. 2.

[0011] The present invention further provides a recombinant expression vector for expressing the conjugated protein, which comprises an expression cassette for co-expressing the Argonaute protein gene and the AgaP protein gene derived from the mesophilic prokaryote.

[0012] The present invention further provides a method for improving the virus defense ability of a prokaryotic host bacterium, which co-transforms the host bacterium by introducing the above-mentioned gene and the AgaP protein coding gene into the host bacterium and realizes co-transcription.

[0013] Specifically, the prokaryotic host bacterium is Haloarcula hispanica; preferably, the gene as claimed in claim 2 and the AgaP protein coding gene are integrated into the genome of the prokaryotic host bacterium.

[0014] The present invention also provides the application of the Argonaute protein derived from the mesophilic prokaryote in improving the gene editing efficiency in Escherichia coli.

[0015] The present invention further provides a method for improving the gene editing efficiency in Escherichia coli, which co-transforms Escherichia coli by mixing an editing plasmid and a plasmid containing the above-mentioned gene.

[0016] The present invention also provides a kit for improving the gene editing efficiency in Enterobacteria based on NpAgo, which is characterized by comprising: (a) the coding DNA encoding the Argonaute protein for improving the editing efficiency; (b) a homologous arm template DNA; and optionally further comprising (c) a screening marker gene for screening a recombinant resistance selection marker gene.

[0017] The present invention first uses the prokaryotic Ago protein and its conjugated PLD nuclease AgaP to endow the host with virus defense function, and can construct a strain with antiviral ability; further based on the function of the Ago protein, NpAgo can significantly improve the gene editing efficiency in Escherichia coli, effectively improving the practical application of bacterial gene editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The gene arrangement structure of ago-agaP;

[0019] Figure 2 Reverse transcription PCR analysis of ago gene transcription;

[0020] Figure 3, Reverse transcription PCR analysis of agaP gene transcription;

[0021] Figure 4 , Reverse transcription PCR analysis of co-transcription of ago and agaP genes;

[0022] Figure 5 , Schematic diagram of the insertion of ago and agaP genes into Haloarcula hispanica;

[0023] Figure 6 , NpAgo / AgaP confers virus defense ability on the host bacterium;

[0024] Figure 7 , Schematic diagram of editing by homologous recombination in Escherichia coli;

[0025] Figure 8 , Schematic diagram of plasmid and DNA-guided transformation of Escherichia coli;

[0026] Figure 9 , Number of surviving clones of plasmid and DNA-guided transformation of Escherichia coli;

[0027] Figure 10 , Schematic diagram of subculture of Escherichia coli containing dual plasmids;

[0028] Figure 11 , NpAgo improves the editing efficiency of Escherichia coli. Detailed implementation mode

[0029] The present invention will be further described below through specific examples for better understanding of the present invention, but it does not constitute a limitation to the present invention.

[0030] Example 1, Analysis of full-length Argonaute derived from Natrinemapellirubrum

[0031] Based on the existing genomic sequences in the NCBI database, proteins containing the PIWI domain were analyzed. We found an Ago protein derived from the mesophilic archaeon Natrinemapellirubrum (its amino acid sequence is shown in SEQ ID NO: 1), which contains 4 complete domains (N domain, PAZ domain, MID domain and PIWI domain), and has only 22.16% and 16.26% similarity with the amino acid sequences of NgAgo and CbAgo, respectively. Analysis found that there is a PLD nuclease gene (named agaP, the protein encoded by it is AgaP, and its amino sequence is shown in SEQ ID NO: 2) coupled to it downstream of NpAgo, and there is an intergenic region of 64 bases between them ( Figure 1 ), indicating that they are in an operon.

[0032] NpAgo amino acid sequence SEQ ID No.1:

[0033] MPTQSDIEDGERIDIQVKVLSELDRPSEKMAKRLRVRDTDGNEFPLTIWKNNALCDFAWERGRWYELENARGNEFRGEKSLNGSSRLHADPVDNPIDSDRSQQSTTAESTDKQFDSLEDGLPYLSLFPIDREFETVDVYEYRIEADGPFDDDPMDATYTLAAYLRSCSDAAVTHAGIFSVIATNRLTNALPDPFELTDESRVTLRADDETDNECLVRLLQQVFKTAVDDETYETGRVDRIRTQDPVITGQDGLFEACLAYTARLEILPSGKAFVGIDISYHARSQVTVDKYVDRINASVDELIDTPVEHDPERYEKSGSGRLKGFADVTFTDPVDDFGNQSLADWYEQKGRISDDMLERLRSEDPQLVEIQYNPNSDETNLHVPQLLRVAPRKEIVKKLAPTFHRKWDRAAKMLPDDRFRKATRFVARLDSLSEVDAQIEPNPVGPNISFMSTEVDRSDNLRFGDDQTTTLPNNGLKRYGIYRRPSSLHLHYLVPERYTDEFASFREQLERQLATIGCSPDDISYDEYGLGNAINYNTTAAAVDDVDIVLAVVPAPDNDFIRNGTIDDPYPEFKKSLGKQTIPSQMVREDNLDDRWILRNTALGVIAGAGGVPWRVDEMPGDVDCFVGLDATRDPETGQFLGASANVVLSDGTVFVSKTQSLQSGETFDENAIVDVLKDVHREFVREEGKSPNNIVIHRDGRLFEDVDTILEPFDETDIDIDILDVRKSGAPRAAVYQDDQFQVDHKGRLFVAQSGDYGFLTTTGRPEFDEDDGLGTPRSLRIVRRAGETPMRTLLEQVYWLSESHVGSAQRSTRLPITTYYADRCAEHAREGYLVNGELIRGVPYL

[0034] AgaP amino acid sequence SEQ ID No.2:

[0035] MQFDIPIDTAETDDSYVEIFKSWRSFSDLFEDARRMRVVTYCDSPEFILDLFEDLDELESLEVIVGDVDDYRERLIDKPDLADRLERLRREGKLVIYLCENKEVHSKLYLIEYADTANGSDDDIESEGKSDQMTFDYDEQSGEEDEAERSPAKVIVGSPNLSRNAWSNQTNVGVVYETTTASDLFGEFEDLYRDHRDSYNNSGPFLEDLTEQIEHSEDDREEVIKLFTEGAVGTQDELGEVHGRLADHIDAEVDTVDLVLGDGHDEESSSDESETTESDPVSETDDAEPGLEDAPQDRITLSLRGYDESTVDTLSQMSDFDATVSNDTLTATPDAFQRYAQQVFDVPTMHLDQEEDQLKFHYDGTVYRLTRPPGEPQQVNDALAEIEAYFETVDDYGNSNNPTAVKAHMYEALLWFFWAPFANRQAEFYQRHGINLDKALPYLYVFGESNGGKGTFCRFALSLISGNRVEAPVDADEIGKRKVRNLRSVHTSFPVVVDDITKQKVNSLDTLRNYWSGWTGETSYPMFAFISNDKRPGEWFRNRAKILRFDVNFMTSHQGEAEVNRLIDTENPLYQWFGYEYLNRDLELGEDSDALREVREAMLDLYEYADRSVPNYFPKDPAENAYDTGRERWRNLIDREDVTITRDGDTLQVTFPESMNFELHEYKRDPPMTVRIEKRGLDLIIKTPDEFFEWLGESTETGPRGSFLSRARSILKR。

[0036] Furthermore, we tested the gene transcription pattern of ago-agaP. Total RNA was extracted from Natrinemapellirubrum cells, and the DNA residues in the RNA were digested with DNase. The digested RNA was used to generate cDNA by reverse transcription PCR. Then, using the cDNA as a template and KOD Plus DNA high-fidelity polymerase, primer pairs F1 / R1 were designed to test the transcription of the ago gene, primer pairs F2 / R2 were designed to test the transcription of the agaP gene, and primer pairs F3 / R3 were designed to test the co-transcription of the ago-agaP gene.

[0037] Primer sequences:

[0038] F1: CTCGACGACAGGTGGATTCT, R1: CGTCGAACGGTTCGAGGAT;

[0039] F2: GATCGCCGGCGAAAGTCAT, R2: GGATTCATCGCTCGATGAT;

[0040] F3: GGAGCAGGTGTACTGGCTAA, R3: GTCACCGACGATCACCTCAA.

[0041] Set the PCR reaction program: 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 68°C for 30 s; 68°C for 5 min. The PCR products were subjected to agarose gel electrophoresis. The results showed that, compared with the control using DNA-digested RNA as the template, using cDNA as the template, the primer pair F1 / R1 amplified a 373-bp target band from the PCR products ( Figure 2 ), indicating the transcription of the ago gene.

[0042] Set the PCR reaction program: 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 68°C for 30 s; 68°C for 5 min. The PCR products were subjected to agarose gel electrophoresis. The results showed that, compared with the control using DNA-digested RNA as the template, using cDNA as the template, the primer pair F2 / R2 amplified a 374-bp target band from the PCR products ( Figure 3 ), indicating the transcription of the agaP gene.

[0043] Set the PCR reaction program: 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 68°C for 30 s; 68°C for 5 min. The PCR products were subjected to agarose gel electrophoresis. The results showed that, compared with the control using DNA-digested RNA as the template, using cDNA as the template, the primer pair F3 / R3 amplified a 422-bp target band from the PCR products ( Figure 4 ), indicating the co-transcription of the ago-agaP genes. This also indicates the existence of a functional coupling between Ago and AgaP.

[0044] Example 2. Natrinema pellirubrum Ago confers the ability of the strain to defend against viruses and can be used to construct antiviral strains

[0045] pAgo is an immune system in prokaryotes. We found that the ago-agaP genes are co-transcribed and hypothesized that NpAgo or NpAgo together with AgaP play an immune function. To test whether the NpAgo system has virus defense function, the ago gene and the ago-agaP gene sequences were amplified by PCR respectively and integrated into the genome of Haloarcula hispanica ATCC33960 for virus infection test. The specific experimental procedures are as follows:

[0046] 1) Construct Haloarcula hispanica ago+ and ago+ / agaP+ strains

[0047] First, the ago gene was knocked into the Haloarcula hispanica DF60Δcas6 strain to construct the ago+ strain, and the ago-agaP gene sequence was knocked into the Haloarcula hispanica DF60Δcas6 strain to construct the ago+ / agaP+ strain.

[0048] (a) Primer design (underlined indicates restriction enzyme sites; complementary sequences are in bold)

[0049] Primers were designed for the ago gene and the ago-agaP gene, and upstream and downstream homologous arm primers for the insertion site were also designed. The amplification primers for the ago gene (containing its own promoter) are:

[0050] ago-F: 5′-AGGGACATTTGAAACACGCTA-3′

[0051] ago-R: 5′-GCTGTCTCAGAGGTATGGGA-3′

[0052] The amplification primers for the ago-agaP gene (containing its own promoter) are:

[0053] agoP-F: 5′-AGGGACATTTGAAACACGCTA-3′

[0054] agoP-R: 5′-CGGCTAACGAATAACTGATGGT-3′

[0055] The amplification primers for the upstream and downstream sequences of the inserted ago gene are:

[0056] ago-UF: 5′-CGG GGTACC CGACTCGGCTCGGCAATA-3′

[0057] ago-UR: 5′-TAGCGTGTTTCAAATGTCCCTCGGCTGGCAGCGATACAA-3′

[0058] ago-DF: 5'-TCCCATACCTCTGAGACAGCCCGAAACAGCTCAAACAGCGACTG-3'

[0059] ago-DR: 5'-CCC AAGCTT CCAGCATTCCGAGTATCCAGAG-3'

[0060] The amplification primers for the upstream and downstream sequences of the ago-agaP gene are:

[0061] agoP-UF: 5'-CGG GGTACC CGACTCGGCTCGGCAATA-3'

[0062] agoP-UR: 5'-TAGCGTGTTTCAAATGTCCCTCGGCTGGCAGCGATACAA-3'

[0063] agoP-DF: 5'-ACCATCAGTTATTCGTTAGCCGAAACAGCTCAAACAGCGACTG-3'

[0064] agoP-DR: 5'-CCC AAGCTT CCAGCATTCCGAGTATCCAGAG-3'

[0065] (b) Amplification of the target gene and the homologous arms upstream and downstream of the insertion site

[0066] Extract the genomic DNA of Natrinema pellirubrum DSM 15624 strain. Using its genomic DNA as a template, use KOD Plus DNA high-fidelity polymerase to amplify 2937 bp of the ago gene with ago-F / ago-R primers; amplify 5214 bp of the ago-agaP gene with agoP-F / agoP-R primers. Set the PCR reaction program: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 68°C for 6 min for a total of 30 cycles; 68°C reaction for 10 min.

[0067] Extract the genomic DNA of Haloarcula hispanica ATCC 33960 strain. Using the genomic DNA as a template, with KOD Plus DNA high-fidelity polymerase, amplify the 585-bp upstream homologous arm inserted into the ago gene with the ago-UF / ago-UR primers; amplify the 547-bp downstream homologous arm inserted into the ago gene with the ago-DF / ago-DR primers; amplify the 585-bp upstream homologous arm inserted into the ago-agaP gene with the agoP-UF / agoP-UR primers; amplify the 547-bp downstream homologous arm inserted into the ago-agaP gene with the agoP-DF / agoP-DR primers. Set the PCR reaction program: 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 68°C for 45 s; 68°C for 5 min.

[0068] Use the PCR products of the upstream and downstream homologous arms of the ago gene and its insertion site together as a template, and amplify the 4069-bp homologous arm ligation fragment inserted into ago with the ago-UF / ago-DR primer pair; use the PCR products of the upstream and downstream homologous arms of the ago-agaP gene and its insertion site together as a template, and amplify the 6346-bp homologous arm ligation fragment inserted into ago-agaP with the agoP-UF / agoP-DR primer pair; set the PCR reaction program: 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 68°C for 7 min; 68°C for 10 min.

[0069] (c) Restriction digestion and ligation of the homologous arm fragments and the integration plasmid pHAR

[0070] Digest the ligation products obtained in the above steps with HindIII and Kpn I respectively. At the same time, treat the plasmid pHAR with HindIII and Kpn I to obtain the linearized pHAR backbone. Use DNA ligase to ligate the double-digested ligation products and the pHAR backbone to obtain the plasmid pKIA for knocking in the ago gene and the plasmid pKIAP for knocking in the ago-agaP gene.

[0071] (d) Transformation of pKIA and pKIAP into Haloarcula hispanica DF60Δcas6

[0072] (1) Monoclonal culture of Halobacterium salinarum DF60Δcas6 (i.e., WT strain) in AS-168 liquid medium (supplemented with 50 mg / l uracil) was carried out at 37 °C and 200 rpm for 5 days. Subsequently, it was transferred to a new liquid medium at a ratio of 1:30 and cultured for about 20 h for subsequent transformation experiments. AS-168 medium is composed of 200.0 g of sodium chloride, 5.0 g of acid-hydrolyzed casein, 5.0 g of yeast extract, 1.0 g of sodium glutamate, 3.0 g of sodium citrate, 2.0 g of KCl, 20.0 g of MgSO 4 ·7H 2 O, 0.36 g of FeSO 4 ·7H 2 O and 0.36 mg of MnCl 2 ·4H 2 O are dissolved in deionized water and finally made up to 1 liter with a pH of 7.0 - 7.2.

[0073] (2) After step (1), 1 ml of the bacterial solution was centrifuged at 6,000 rpm for 3 min;

[0074] (3) After step (2), the supernatant was completely discarded, 200 μl of BSS-LS solution was added and the cells were suspended, and then centrifuged at 6,000 rpm for 3 min; BSS-LS solution is composed of 5.85 g of sodium chloride, 0.201 g of potassium chloride, 15.0 g of sucrose dissolved in deionized water and made up to 95 ml, and 5 ml of sterile 1 M Tris-HCl (pH 8.2) was added after sterilization.

[0075] (4) After step (3), the supernatant was completely discarded, 100 μl of BSS-LS / +glycerol solution was added and the cells were suspended, and then centrifuged at 6,000 rpm for 3 min; BSS-LS / +glycerol is composed of 5.85 g of sodium chloride, 0.201 g of potassium chloride, 15.0 g of sucrose, 15 ml of glycerol dissolved in deionized water and made up to 95 ml, and 5 ml of sterile 1 M Tris-HCl (pH 8.2) was added after sterilization.

[0076] (5) After step (4), 10 μl of 0.5 M EDTA (pH 8.0) solution was added, mixed well and left standing for 10 min; 0.5 M EDTA (pH 8.0) solution is composed of 18.612 g of EDTA added to deionized water, and NaOH was gradually added to dissolve EDTA, and made up to 100 ml with a pH of 8.0.

[0077] (6) After step (5), 5 μl of pKIA or pKIAP plasmid was added to the mixture in the previous step (5), mixed well and left standing for 5 min;

[0078] (7) After step (6), continue to add 115 μl of 60% PEG 600 solution. After mixing evenly, let it stand for 25 min;

[0079] (8) After step (7), add 1 ml of 23% MGM + sucrose medium, mix well, and centrifuge at 6,000 rpm for 3 min. The 23% MGM + sucrose medium is prepared by dissolving 0.5 g of soy peptone, 0.1 g of yeast extract, and 15 g of sucrose in 76.7 ml of 30% artificial saline, and making up the volume to 100 ml, with a pH of 7.5.

[0080] (9) After step (8), centrifuge at 6,000 rpm for 3 min, discard all the supernatant, add 500 μl of 23% MGM + sucrose medium to resuspend the cells, and culture at 37 °C and 200 rpm for 10 h.

[0081] (10) After step (9), spread the culture solution on an AS-168 medium plate (containing 1.2% agar) without yeast extract, and culture at 37 °C for about 6 days.

[0082] (e) Identify the clones of single crossover

[0083] Using the obtained pKIA and pKIAP transformant cells as templates, perform colony PCR identification using the ago-UF / ago-DR or agoP-UF / agoP-DR primer pairs respectively. Electrophoresis shows that the correct clones are those that contain both the wild-type band and the inserted band.

[0084] (f) Screen the inserted strains of double crossover

[0085] Pick the single crossover clones screened in the previous step into the AS-168 medium (containing 150 mg / l of 5-fluorouracil and 50 mg / l of uracil) and culture for about 5 days. Then, transfer them again at a ratio of 1:30 to the AS-168 medium (containing 150 mg / l of 5-fluorouracil and 50 mg / l of uracil) and culture for about 4 days. Subsequently, streak the bacterial solution on the AS-168 medium (containing 150 mg / l of 5-fluorouracil and 50 mg / l of uracil) plate. After about 6 days, single colonies grow. Perform colony PCR identification using the ago-UF / ago-DR or agoP-UF / agoP-DR primer pairs respectively. Electrophoresis shows that the correct clones are those that only contain the inserted band, thus obtaining the ago+ and ago+ / agaP+ strains ( Figure 5 ).

[0086] 2) Detect the virus defense functions of the ago+ and ago+ / agaP+ strains

[0087] The ago+ and ago+ / agaP+ monoclonal antibodies were respectively inoculated into AS-168 liquid medium (supplemented with 50 mg / l uracil) and cultured at 37 °C with 200 rpm for 5 days. Subsequently, they were transferred to a new liquid medium at a ratio of 1:30 and cultured at 37 °C with 200 rpm until the logarithmic phase. At the same time, the HHPV-2 virus solution that can infect Haloarcula hispanica was serially diluted 10-fold. 100 μl of HHPV-2 at different dilution concentrations was mixed with 200 μl of the bacterial solution. After standing for 30 min, the mixture was mixed with 3 ml of AS-168 liquid medium (containing 0.7% agar) at 55 °C supplemented with 50 mg / l uracil. Subsequently, the mixture was poured onto a pre-prepared AS-168 plate (supplemented with 50 mg / l uracil and containing 1.2% agar). After solidification, it was cultured at 37 °C, and the virus defense ability of ago+ or ago+ / agaP+ was evaluated by plaque-forming units / ml ( Figure 6 ).

[0088] (a) In three repeated experiments of HHPV-2 infecting Haloarcula hispanica DF60Δcas6 (i.e., the WT control strain), the plaque-forming units were 5.8×10 9 , 6.1×10 9 , 4.5×10 9 / ml( Figure 6 ).

[0089] (b) In three repeated experiments of HHPV-2 infecting the ago+ strain of Haloarcula hispanica, the plaque-forming units were 2.4×10 9 , 1.9×10 9 , 2.7×10 9 / ml. Compared with the WT control strain, it was reduced by about 57%( Figure 6 ), showing a significant difference, indicating that NpAgo has a virus defense function.

[0090] (c) In three repeated experiments of HHPV-2 infecting the ago+ / agaP+ strain of Haloarcula hispanica, the plaque-forming units were 4.0×10 8 , 8.0×10 8 , 5.0×10 8 / ml( Figure 6 ). Compared with the WT control strain, it was reduced by about 90%, showing a significant difference, indicating that NpAgo / AgaP has a virus defense function.

[0091] In summary, by expressing NpAgo, the strain can have a certain virus defense function. Further co-expressing NpAgo and AgaP can enhance the virus defense function of the host strain. Therefore, based on NpAgo / AgaP, an engineered strain with virus defense function can be constructed.

[0092] Example 3: Natrinema pellirubrum Ago Improves Gene Editing Efficiency

[0093] We tested whether the Ago system could be used for gene editing in Escherichia coli MG1655. First, we inserted the coding sequence (without promoter) of the kanamycin resistance gene and the gfp gene sequence into the MG1655 strain to construct the strain MG1655-tKan-gfp. Subsequently, we ligated a partial sequence of the kanamycin resistance gene, the promoter fragment (tKan), and a partial fragment of gfp together as a recombinant homologous arm and connected it to the pACYC vector with chloramphenicol resistance to construct the editing plasmid pE. In theory, the MG1655-tKan-gfp strain (i.e., the original cell) cannot grow in the kanamycin medium, and the edited cells after successful recombination of the homologous arm fragment of the pE plasmid with the homologous sequence of the MG1655-tKan-gfp genome can express the kanamycin resistance gene and can grow in the LB screening medium containing kanamycin ( Figure 7 ). The LB medium was prepared by dissolving 10.0 g of sodium chloride, 5.0 g of yeast extract, and 10.0 g of tryptone in deionized water and finally adjusting the volume to 1 liter with the pH adjusted to 7.0.

[0094] We optimized the codons of the ago gene and the agaP gene sequence for the Escherichia coli host, cloned the ago gene and the ago-agaP gene sequence into the pUC19 vector respectively, and used the L-arabinose inducible promoter to control the expression of the ago gene and the ago-agaP gene. Further, the empty vector pUC19, the plasmid pA containing NpAgo, and the plasmid pAP containing NpAgo and AgaP were respectively transformed into MG1655-tKan-gfp. The transformants containing each plasmid were picked to prepare electrocompetent cells. 500 ng of the editing plasmid pE was mixed with 1 μg of DNA guide. In the control group, 500 ng of the editing plasmid pE was mixed with an equal volume of sterile water. The mixed samples were respectively transformed into MG1655-tKan-gfp cells containing the empty vector, the pA plasmid, and the pAp plasmid ( Figure 8 ). Subsequently, 1 ml of LB medium supplemented with 100 mg / l ampicillin and 2 g / l L-arabinose was added to each for resuscitation culture. The resuscitation culture was carried out at 37 °C and 200 rpm for 3 h. The resuscitation culture broth was spread on the LB medium plate containing 50 mg / l kanamycin and 2 g / l L-arabinose and incubated at 37 °C for 16 - 24 h.

[0095] The DNA guide sequence is as follows: 5′-P-CAAGAATGTTTCCATCTTCTTTAA-3′.

[0096] (a) On LB plates containing kanamycin, without adding DNA guide, the numbers of surviving clones in five repeated experiments after transforming the empty vector pUC19 into MG1655-tKan-gfp were 4, 3, 10, 0, 3 respectively; the numbers of surviving clones in five repeated experiments after transforming the plasmid pA into MG1655-tKan-gfp were 71, 20, 87, 5, 43( Figure 9 ), and there was a significant difference between them (P value was 0.0278), indicating that the recombination of the strain expressing Ago protein was significantly improved, and NpAgo could improve the gene editing efficiency of Escherichia coli. The numbers of surviving clones in five repeated experiments after transforming the plasmid pAP into MG1655-tKan-gfp were 28, 2, 6, 0, 0( Figure 9 ), and there was no significant difference compared with the empty vector pUC19 (P value was 0.5809), indicating that Ago / AgaP did not improve the gene editing efficiency of Escherichia coli.

[0097] (b) When adding DNA guide, the numbers of surviving clones in five repeated experiments after transforming the empty vector into MG1655-tKan-gfp on the screening plate were 3, 2, 0, 4, 0; the numbers of surviving clones in five repeated experiments after transforming the plasmid pA into MG1655-tKan-gfp were 65, 57, 177, 44, 47( Figure 9 ), and there was a significant difference between them (P value was 0.0159), indicating that the recombination of the strain expressing Ago protein was significantly improved, and NpAgo could improve the gene editing efficiency of Escherichia coli. The numbers of surviving clones in five repeated experiments after transforming the plasmid pAP into MG1655-tKan-gfp were 4, 5, 23, 0, 0( Figure 9 ), and there was no significant difference compared with the empty vector (P value was 0.3209), indicating that Ago / AgaP did not improve the gene editing efficiency of Escherichia coli.

[0098] (c) Without adding DNA guide, the numbers of surviving clones in five repeated experiments after transforming the plasmid pA into MG1655-tKan-gfp were 71, 20, 87, 5, 43; when adding DNA guide, the numbers of surviving clones in five repeated experiments after transforming the plasmid pA into MG1655-tKan-gfp were 65, 57, 177, 44, 47( Figure 9 ), and there was no significant difference in the numbers of surviving clones between them (P value was 0.2957). These results indicate that NpAgo improves the editing efficiency of Escherichia coli in a DNA guide-independent manner.

[0099] To further confirm that NpAgo can improve the editing efficiency of Escherichia coli, we mixed 200 ng of the editing plasmid pE with 200 ng of the empty vector, 200 ng of the plasmid pA containing NpAgo, and 200 ng of the plasmid pAP containing NpAgo and AgaP respectively, and transformed them into MG1655-tKan-gfp. The mixtures were spread on LB plates containing 100 mg / l ampicillin and 25 mg / l chloramphenicol and cultured at 37°C. Three transformant clones containing the double plasmid were picked from each transformed sample and inoculated into LB medium containing 100 mg / l ampicillin, 25 mg / l chloramphenicol and 2 g / l L-arabinose, and cultured with shaking at 37°C and 200 rpm for 10 h. Subsequently, the cultures were transferred to fresh LB medium containing 100 mg / l ampicillin, 25 mg / l chloramphenicol and 2 g / l L-arabinose at a ratio of 1:30 and cultured at 37°C and 200 rpm for 10 h. Then, two samples were taken simultaneously from each sample and serially diluted 10-fold and spread on LB plates containing 100 mg / l ampicillin, 25 mg / l chloramphenicol and 2 g / l L-arabinose (non-selection medium, used to count the total number of original cells) and on LB plates containing 50 mg / l kanamycin and 2 g / l L-arabinose (selection medium, used to count the number of edited cells)( Figure 10 ), and cultured at 37°C for 16 - 24 h. The editing efficiency was expressed as the relative survival rate, and the relative survival rate = (total number of cells / ml in non-selection medium) / (number of edited cells / ml in selection medium) × 100%.

[0100] Statistical analysis showed that on the non-selection medium plates (containing 100 mg / l ampicillin and 25 mg / l chloramphenicol), the number of clones of the empty vector pUC19 and the editing plasmid pE in three repeated experiments were 48000000, 188000000, 68000000 / ml respectively; on the selection medium plates (containing 50 mg / l kanamycin), the number of clones of the empty vector and the editing plasmid pE in three repeated experiments were 81, 754, 124 / ml( Figure 11 ). Therefore, the relative survival rates of the empty vector pUC19 were 0.00016%, 0.00040%, 0.00018% respectively.

[0101] On non-screened LB agar plates (containing 100 mg / l ampicillin and 25 mg / l chloramphenicol), the numbers of colonies grown from the pA plasmid and the editing plasmid pE in three repeated experiments were 12,000,000, 20,000,000, and 36,000,000 / ml respectively; on screened LB agar plates (containing 50 mg / l kanamycin), the numbers of colonies grown from the pA plasmid and the editing plasmid pE in three repeated experiments were 295, 1020, and 1076 / ml( Figure 11 ), and thus, the relative survival rates of the pA plasmid were 0.0025%, 0.0051%, and 0.0030% respectively.

[0102] As can be seen from the above, in the absence of NpAgo, the relative survival rates in three repeated experiments were 0.00016%, 0.00040%, and 0.00018% respectively; in the presence of NpAgo, the relative survival rates in three repeated experiments were 0.0025%, 0.0051%, and 0.0030%( Figure 11 ). Therefore, the relative survival rates in the presence of NpAgo were increased by 14.5, 12.7, and 16.3 times respectively (P value = 0.0079). In summary, these results indicate that NpAgo can significantly improve the editing efficiency of E. coli by promoting homologous recombination.

Claims

1. An Argonaute protein derived from a mesophilic prokaryote, characterized in that, Its amino acid sequence is as shown in SEQ ID No. 1, or has more than 90%, more than 95%, more than 98%, preferably more than 99% identity with the sequence shown in SEQ ID No. 1, has the same function, and is from mesophilic prokaryotes Natrinemapellirubrum .

2. A gene encoding the Argonaute protein derived from a mesophilic prokaryote as claimed in claim 1, preferably with nucleotide sequence optimization based on the codon preference of Escherichia coli.

3. A conjugate protein, which is obtained by conjugating the Argonaute protein derived from a mesophilic prokaryote as claimed in claim 1 with the AgaP protein, preferably, the amino acid sequence of the AgaP protein is as shown in SEQ ID No.

2.

4. A recombinant expression vector expressing the conjugate protein as claimed in claim 3, characterized in that, it comprises an expression cassette for co-expression of the Argonaute protein gene derived from a mesophilic prokaryote as claimed in claim 1 and the AgaP protein gene.

5. A method for enhancing the viral defense ability of a prokaryotic host bacterium, characterized in that, the gene as claimed in claim 2 and the AgaP protein coding gene are co-transformed into the host bacterium and co-transcription is achieved.

6. The method as claimed in claim 5, characterized in that, The prokaryotic host bacterium is **Halorubrum spainense** ( Haloarculahispanica ); preferably, the gene as described in claim 2 and the AgaP protein-encoding gene are integrated into the genome of the prokaryotic host bacterium.

7. Use of the Argonaute protein derived from a mesophilic prokaryote as claimed in claim 1 in enhancing gene editing efficiency in Escherichia coli.

8. A method for enhancing gene editing efficiency in Escherichia coli, characterized in that, an editing plasmid and a plasmid containing the gene as claimed in claim 2 are mixed and transformed into Escherichia coli.

9. A kit for enhancing gene editing efficiency in Enterobacter based on NpAgo, characterized in that, it comprises: (a) the coding DNA encoding the Argonaute protein as claimed in claim 1 for enhancing editing efficiency; (b) a homologous arm template DNA.

10. The kit as claimed in claim 9, characterized in that, it further comprises (c) a selection marker for screening recombinant resistance selection marker genes.

Images