Method and system for regulating methylation modification of target mRNA (messenger ribonucleic acid) m6A and application of method and system

By connecting the functional domain of m6A-related enzymes to dCas7-11 and designing specific sgRNA, fine regulation of m6A modification of single mRNA sites is achieved, and the problem of difficulty in fine manipulating m6A sites in the prior art is solved, and a new way to modify mRNA m6A is provided.

CN120060209APending Publication Date: 2025-05-30HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510261821.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-06
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The prior art is difficult to finely manipulate the methylation modification of a single m6A site in a single transcript, resulting in the inability to avoid changes in the global m6A level of cells when studying m6A modification of mRNA.

Method used

By connecting the enzymatic activity domains of m6A methylase or demethylase to dCas7-11, a recombinant nuclease is formed, and a specific sgRNA is designed to target specific mRNA sites, so fine regulation of m6A modification is achieved.

Benefits of technology

Fine methylation or demethylation modification of a single m6A site in a single transcript is achieved, avoiding changes in the overall m6A level of the cell, and providing a new way to study m6A modification of mRNA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060209A_ABST
    Figure CN120060209A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of RNA (Ribonucleic Acid) editing, in particular to a method and a system for regulating methylation modification of target mRNA (Messenger Ribonucleic Acid) m6A and application of the method and the system. The system comprises RNA-targeted recombinant nuclease with an mRNA m6A methylation modification function and RNA-targeted sgRNA of the RNA-targeted recombinant nuclease, and the system can be used for manipulating a single m6A site in a single transcript so as to realize targeted mRNA methylation / demethylation modification without changing the overall m6A change of cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of RNA editing, and particularly relates to a method, a system and an application for regulating the m 6 A methylation modification of a target mRNA. Background Art

[0002] m 6 A modification (methylation modification occurring at the 6th N atom of adenine) is the most common and abundant post-transcriptional modification of RNA in eukaryotic cells. Research has confirmed that m 6 A modification occurs in the nucleus and is dynamically and reversibly regulated. There are three types of proteins involved: methyltransferases METTL3, METTL14, binding subunit WTAP and RBM15 (writer), demethylases FTO, ALKBH5 (eraser), and YTH domain proteins (reader). Methyltransferases and demethylases are responsible for catalyzing the methylation and demethylation of adenine on mRNA, respectively, while the function of m 6 A reading proteins is to recognize the methylation modification on mRNA and bind to the methylation modification site, thereby affecting processes such as transcription, splicing, nuclear export, degradation and translation of mRNA, and playing an important role in the metabolism of RNA.

[0003] The CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated) system is an adaptive immune system unique to many bacteria and archaea. This system specifically cleaves and degrades invading nucleic acids through RNA-guided nucleases. The CRISPR / Cas system can be divided into three types. Among them, the type II CRISPR / Cas system has been modified into a tool for genome-targeted editing due to its simple composition. By artificially designing and transcribing RNA in vitro, sgRNA (single guide RNA) with a guiding function can be synthesized. The sgRNA guides the Cas protein to specifically cleave the target DNA sequence. By modifying the Cas protein, under the guidance of the sgRNA, the CRISPR / Cas system can achieve various purposes in research, such as cutting, modifying, silencing, knocking out, and adjusting the expression of genes. CRISPR / Cas has become a powerful tool for gene editing and research and has broad application prospects.

[0004] The Cas7-11 RNA targeting technology was first reported by the Ahsen Özcan laboratory. They confirmed that the subtype III-E effector Cas7-11 is a single-protein effector in the type I CRISPR-Cas system. When expressed in Escherichia coli, it has significant RNA interference effects on mRNA and phages. It processes pre-CRISPR RNA into mature CRISPR RNA (crRNA), cuts RNA at target-defined positions, and Cas7-11 designed in mammalian cells has no effect on cell viability and is independent of PFS / PAM constraints. Therefore, Cas7-11 has begun to attract attention as a protein tool for specifically targeting mRNA, providing new ideas for new programmable RNA targeting tools. However, in traditional studies on m6A modification, knocking out or overexpressing methyltransferases / demethylases can lead to changes in the global m 6 A level in cells or changes in the RNA sequence in site mutation experiments, making it impossible to achieve changes in individual m 6 A sites in a single transcript. SUMMARY OF THE INVENTION

[0005] To solve the above problems, the present invention provides a method, system and application for regulating m 6 A methylation modification of target mRNA.

[0006] A system for regulating m 6 A methylation modification of target mRNA, the system comprising a recombinant nuclease with mRNA m 6 A methylation modification function that targets RNA and its sgRNA that targets RNA.

[0007] Preferably, the recombinant nuclease is formed by connecting the enzyme activity functional domain of the m 6 A regulatory enzyme with dCas7-11 to fuse into a recombinant nuclease with regulatory enzyme activity; The regulatory enzyme is a methyltransferase or a demethyltransferase.

[0008] Preferably, the recombinant nuclease is a dCas7-11-METTL3 fusion protein or a dCas7-11-FTO fusion protein; The dCas7-11-METTL3 fusion protein is dCas7-11-NLS-METTL3-HA, and the sequence of dCas7-11-NLS-METTL3-HA is shown in SEQ ID NO.57; The dCas7-11-FTO fusion protein is dCas7-11-NES-FTO-HA or dCas7-11-NLS-FTO-HA. The sequence of dCas7-11-NES-FTO-HA is shown in SEQ ID NO.58, and the sequence of dCas7-11-NLS-FTO-HA is shown in SEQ ID NO.59.

[0009] Preferably, the system for regulating the m 6 A methylation modification is the dCas7-11-METTL3 / sgRNA system or the dCas7-11-FTO / sgRNA system; The dCas7-11-METTL3 fusion protein constitutes the dCas7-11-METTL3 / sgRNA system; The dCas7-11-FTO fusion protein constitutes the dCas7-11-FTO / sgRNA system.

[0010] The preparation method of the described system includes the following steps: Construct an sgRNA vector targeting RNA; Transfect the dCas7-11-METTL3 fusion protein and the sgRNA vector into cells to obtain the dCas7-11-METTL3 / sgRNA system; Transfect the dCas7-11-FTO fusion protein and the sgRNA vector into cells to obtain the dCas7-11-FTO / sgRNA system.

[0011] The application of the described system in the preparation of disease target drugs.

[0012] A method for regulating the m 6 A methylation modification of the target mRNA uses the described system to guide the recombinant nuclease with the corresponding function to the corresponding mRNA to achieve the regulation of the m 6 A methylation modification of the target mRNA.

[0013] Preferably, the regulation of the m 6 A methylation modification of the target mRNA is to methylate the target mRNA m 6 A or to demethylate the target mRNA m 6 A; Use the dCas7-11-METTL3 / sgRNA system to methylate the target mRNA m 6 A; Use the dCas7-11-FTO / sgRNA system to target the mRNA m6 A undergoes demethylation.

[0014] Preferably, the target mRNA is the mRNA of ACTB, FOXM1, CYB5A, TPT1 or STING; Among them, the nucleotide sequence of the sgRNA of ACTB is GTAACGCAACTAAGTCATAGTCCGCCTAGA; the nucleotide sequence of the sgRNA of FOXM1 is CCTGAGTTCTCGTCAATGCCAGTCTCCCTG; the nucleotide sequence of the sgRNA of CYB5A is GCTGTGGTTGTGCTTCTGAATCTCCTCTAG; the nucleotide sequence of the sgRNA of TPT1 is ATCAGTCCCATTTGTCTTAAGTCCTGGTGT; the nucleotide sequence of the sgRNA of STING is GGTTATCAGGCACCCCACAGTCCAATGGGA.

[0015] Preferably, the spacer of the sgRNA at the target mRNA m 6 A site is 7 bp.

[0016] In order to develop molecular tools that can be used to manipulate a single m 6 A site in a single transcript without changing the primary RNA sequence or affecting accidental sites affected in methylase / demethylase knockout or overexpression experiments, the present invention first connects the enzyme activity functional domain of m 6 A methylase / demethylase to the C-terminus of dCas7-11, and connects the dCas7-11 protein and METTL3 / FTO through the linker XTEN. While the enzyme activity is not affected by the spatial position, a nuclear import or nuclear export cell localization signal is added to make the fusion protein play a better role. Then, a sgRNA specifically targeting mRNA is designed to specifically modify m 6 A at a single site. By fusing the enzyme related to RNA m 6 A modification to the Crispr-Cas7-11 system to specifically target the mRNA substrate to change the m 6 A modification at its specific site, this strategy provides a new approach for studying the m 6 A modification of mRNA.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: The system of the present invention can be used to manipulate a single m 6 A site in a single transcript to achieve targeted mRNA methylation / demethylation modification without changing the overall m 6 A change in the cell, which is accurate and efficient, and provides a new approach for studying the m of a single site of mRNA6 A modification provides a new approach. Brief Description of the Drawings

[0018] Figure 1 For specific editing of mRNA by dCas7-11-METTL3 and dCas7-11-FTO targeting mRNA 6 Schematic diagram of A modification.

[0019] Figure 2 Schematic diagram of different cellular localization signals of dCas7-11-METTL3 fusion protein and dCas7-11-FTO fusion protein.

[0020] Figure 3 For m of ACTB A1216, FOXM1 A3488, CYB5A A48 and TPT1 A687 6 Schematic diagram of A modification sites and Cas7-11 gRNA design diagram.

[0021] Figure 4 For m 6 m A RIP-PCR indicates that the dCas7-11-METTL3 fusion protein binds to the targeted gRNA to regulate the m A modification level of the target gene mRNA, where A is ACTB A1216, B is FOXM1 A3488, C is CYB5A A48, and D is TPT1A687. 6 A modification level, where A is ACTB A1216, B is FOXM1 A3488, C is CYB5A A48, and D is TPT1A687.

[0022] Figure 5 RT-PCR indicates that the dCas7-11-METTL3 fusion protein binds to the targeted gRNA to regulate its mRNA expression level, where A is ACTB A1216, B is FOXM1 A3488, C is CYB5A A48, and D is TPT1 A687.

[0023] Figure 6 For m 6 m A RIP-PCR indicates that the dCas7-11-FTO fusion protein binds to the targeted gRNA to regulate the m A modification level of the target gene mRNA, where A is ACTB A1216, B is FOXM1 A3488, C is CYB5A A48, and D is TPT1A687. 6 A modification level, where A is ACTB A1216, B is FOXM1 A3488, C is CYB5A A48, and D is TPT1A687.

[0024] Figure 7 RT-PCR indicates that the dCas7-11-FTO fusion protein binds to the targeted gRNA to regulate its mRNA expression level, where A is ACTB A1216, B is FOXM1 A3488, C is CYB5A A48, and D is TPT1 A687.

[0025] Figure 8 For MeRIP-qPCR, the dCas7-11-METTL3 fusion protein with nuclear localization and the dCas7-11-FTO fusion protein with cytoplasmic localization have good m6A modification efficiency for FOXM1 mRNA within -7 to +7 bp from the FOXM1 A3488 site of the gRNA. Among them, A is the schematic diagram of the gRNA designed to target FOXM1 mRNA, B is the m 6 A enrichment level of the nuclear localization dCas7-11-METTL3 / gRNA system for FOXM1 mRNA under the guidance of different gRNAs, and C is the m 6 A enrichment level of the cytoplasmic localization dCas7-11-FTO / gRNA system for FOXM1 mRNA under the guidance of different gRNAs.

[0026] Figure 9 Is the schematic diagram of the m 6 A modification site of STING mRNA.

[0027] Figure 10 For the nuclear localization dCas7-11-METTL3 fusion protein binding to the targeted gRNA to regulate the mRNA of the target gene. Among them, A is the m 6 A RIP-PCR indicates that the nuclear localization dCas7-11-METTL3 fusion protein binding to the targeted gRNA regulates the m 6 A modification level of the mRNA of the target gene, and B is the RT-qPCR indicating that the nuclear localization dCas7-11-METTL3 fusion protein binding to the targeted gRNA regulates the mRNA level of the mRNA of the target gene.

[0028] Figure 11 Western blot indicates that the nuclear localization dCas7-11-METTL3 fusion protein binding to the gRNA targeting STING mRNA regulates the expression level of STING protein.

[0029] Figure 12 For the cytoplasmic localization dCas7-11-FTO fusion protein binding to the targeted gRNA to regulate the mRNA of the target gene. Among them, A is the m 6 A RIP-PCR indicates that the cytoplasmic localization dCas7-11-FTO fusion protein binding to the targeted gRNA regulates the m 6 A modification level of the mRNA of the target gene, and B is the RT-qPCR indicating that the nuclear localization dCas7-11-FTO fusion protein binding to the targeted gRNA regulates the mRNA level of the mRNA of the target gene.

[0030] Figure 13 The dCas7-11-FTO fusion protein, which was indicated by Western blot to be localized in the cytoplasm, binds to the gRNA targeting STING mRNA to regulate the expression level of STING protein.

[0031] Note: In the figure, "*" indicates significant difference, p < 0.05, "**" indicates extremely significant difference, p < 0.01, "***" indicates extremely significant difference, p < 0.001, and "****" indicates extremely significant difference, p < 0.0001. Specific embodiments

[0032] The specific embodiments of the present invention will be described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.

[0033] The dCas7-11-METTL3 fusion protein and dCas7-11-FTO fusion protein in the present invention include various METTL3 / FTO fusion forms. For example, the fusion protein formed by dCas7-11 and METTL3 / FTO is labeled with a 3×HA tag. The dCas7-11-METTL3 fusion protein and dCas7-11-FTO fusion protein contain variants of the Cas7-11 protease, such as Cas7-11 variants that do not cleave single-stranded mRNA and thus lose part or all of their enzymatic activity and only have gRNA recognition activity. The protein connection part of the dCas7-11-METTL3 fusion protein and dCas7-11-FTO fusion protein contains the linker amino acid sequence XTEN.

[0034] In the present invention, the dCas7-11-METTL3 fusion protein refers to dCas7-11-NES-METTL3-HA or dCas7-11-NLS-METTL3-HA. dCas7-11-NES-METTL3-HA is a dCas7-11-METTL3 fusion protein localized in the cytoplasm, and dCas7-11-NLS-METTL3-HA is a dCas7-11-METTL3 fusion protein localized in the nucleus.

[0035] In the present invention, the dCas7-11-FTO fusion protein refers to dCas7-11-NES-FTO-HA or dCas7-11-NLS-FTO-HA. dCas7-11-NES-FTO-HA is a cytoplasm-localized dCas7-11-FTO fusion protein, and dCas7-11-NLS-FTO-HA is a nucleus-localized dCas7-11-FTO fusion protein.

[0036] Schematic diagrams of the different cell localization signals of the dCas7-11-METTL3 fusion protein and the dCas7-11-FTO fusion protein are as Figure 2 shown.

[0037] In the present invention, the dCas7-11-METTL3 / sgRNA system and the dCas7-11-FTO / sgRNA system are carried out in living cells, in vivo animals or in vitro. The dCas7-11-METTL3 / sgRNA system and the dCas7-11-FTO / sgRNA system comprise fusion combinations of various Cas7-11 protease variants and METTL3 / FTO protein variants.

[0038] In the present invention, the dCas7-11-METTL3 / sgRNA system includes any one of the products obtained by transfecting dCas7-11-NES-METTL3-HA with the sgRNA of the corresponding gene and the product obtained by transfecting dCas7-11-NLS-METTL3-HA with the sgRNA of the corresponding gene.

[0039] In the present invention, the dCas7-11-FTO / sgRNA system includes any one of the products obtained by transfecting dCas7-11-NES-FTO-HA with the sgRNA of the corresponding gene and the product obtained by transfecting dCas7-11-NLS-FTO-HA with the sgRNA of the corresponding gene.

[0040] The 3' end of the sgRNA of the present invention contains direct repeats, which can form an mRNA secondary structure similar to a hairpin structure and can be recognized and bound by dCas7-11, the dCas7-11-METTL3 fusion protein, the dCas7-11-FTO fusion protein or variants of other Cas7-11 proteases; the 5' end of the sgRNA is a specific sequence targeting the target mRNA and can be complementary paired with the 5'-UTR region, CDS coding region, intron region or 3'-UTR region of the mRNA.

[0041] The expression vectors dCas7-11-NES-METTL3-HA, dCas7-11-NES-FTO-HA, dCas7-11-NLS-METTL3-HA, and dCas7-11-NLS-FTO-HA are all circular DNAs, and the circular DNAs include eukaryotic expression vectors and the METTL3 / FTO enzyme activity region sequences inserted into the eukaryotic expression vectors. The localization signals of the expression vectors dCas7-11-NES-METTL3-HA, dCas7-11-NES-FTO-HA, dCas7-11-NLS-METTL3-HA, and dCas7-11-NLS-FTO-HA include the nuclear export signal (NES) at the C-terminus of the dCas7-11 protein and the nuclear localization signals (NLS) at the N-terminus and C-terminus of the dCas7-11 protein.

[0042] Example 1 Construct the expression vectors dCas7-11-NES-METTL3-HA and dCas7-11-NES-FTO-HA Add an XbaI restriction site after the dCas13b protein in the backbone vector pC0049-EF1a-dPSPCas13b-NES-HIV, H133A / H1058A (Addgene, #103865) to obtain a mutant backbone vector for facilitating subsequent gene insertion.

[0043] The wild-type METTL3 coding region sequence was amplified from HEK293T cDNA by PCR using SEQ ID NO.1 and SEQ ID NO.2, and the FTO coding region sequence was amplified from HEK293T cDNA by PCR using SEQ ID NO.15 and SEQ ID NO.16. Then, METTL3 was fused to the C-terminus of the above mutant backbone vector through the XTEN linker (SGSETPGTSESATPES) to form dCas13b-NES-METTL3, and FTO was fused to the C-terminus of the above mutant backbone vector to form dCas13b-NES-FTO. Specifically: SEQ ID NO.3 and SEQ ID NO.4 were annealed to form XTEN, and XTEN and METTL3 were subjected to overlapping PCR through SEQ ID NO.2, SEQ ID NO.5, and SEQ ID NO.6 to form XTEN-METTL3, and then ligated by homologous recombination to form dCas13b-NES-METTL3; XTEN and FTO were subjected to overlapping PCR through SEQ ID NO.16, SEQ ID NO.17, and SEQ ID NO.6 to form XTEN-FTO, and then ligated by homologous recombination to form dCas13b-NES-FTO.

[0044] The sequence of NES-XTEN-METTL3-HA was amplified from dCas13b-NES-METTL3 by PCR using SEQ ID NO.13 and SEQ ID NO.14, and then cloned into pDF0234-pCMV-huDisCas7-11 dead mutant (Addgene, #172509) to generate pCMV-dead-huDisCas7-11-NES-METTL3-HA, thereby obtaining dCas7-11-NES-METTL3-HA with correct sequencing.

[0045] The sequence of NES-XTEN-FTO-HA was amplified from dCas13b-NES-FTO by PCR using SEQ ID NO.13 and SEQ ID NO.14, and then cloned into pDF0234-pCMV-huDisCas7-11 dead mutant (Addgene, #172509) to generate pCMV-dead-huDisCas7-11-NES-FTO-HA, thereby obtaining dCas7-11-NES-FTO-HA with correct sequencing.

[0046] The specific conditions for the above operations are as follows: 1. The relevant gene sequences for PCR amplification are shown in Table 1.

[0047] 2. PCR reaction system, total 50 µL: 2×Primestar mix, 25 µL; Primer F (10 µM), 2.5 µL; Primer R (10 µM), 2.5 µL; plasmid, 2 µL; ddH 2 O, 18 µL.

[0048] PCR amplification conditions: 98°C, 3 min; (98°C, 10 s; Tm, 15 s; 72°C, 1 kb / min) 35 cycles; 72°C, 10 min; 4°C, hold.

[0049] 3. PCR product recovery 1) After the PCR product electrophoresis is completed, quickly cut the gel containing the target DNA fragment under ultraviolet light, weigh the gel, 100 mg of gel is equivalent to 100 µL in volume, regarded as one gel volume.

[0050] 2) Add an equal volume of Buffer GDP, water bath at 55°C for 10 min. Invert and mix 2 times during the water bath to accelerate the gel dissolution.

[0051] 3) Briefly centrifuge to collect the droplets on the tube wall. Place the FastPure DNAmini Columns-G adsorption column in a 2 mL Collection Tubes collection tube, centrifuge at 12,000 rpm for 60 s.

[0052] 4) Discard the filtrate, place the adsorption column in the collection tube. Add 300 µL of Buffer GDP to the adsorption column. Let it stand for 1 min. Centrifuge at 12,000 rpm for 60 s.

[0053] 5) Discard the filtrate, place the adsorption column in the collection tube.

[0054] 6) Add 700 µL of Buffer GW (anhydrous ethanol has been added) to the adsorption column. Centrifuge at 12,000 rpm for 60 s.

[0055] 7) Discard the filtrate, put the adsorption column back into the collection tube. Centrifuge at 12,000 rpm for 2 min. Place the adsorption column in a 1.5 mL sterilized centrifuge tube, add 30 µL of ddH 2 O to the center of the adsorption column, let it stand for 2 min.

[0056] 8) Centrifuge at 12,000 rpm for 1 min. Discard the adsorption column, store the DNA at -20°C.

[0057] 4. Restriction enzyme reaction system, total 50 µL: 10×NEB rCutsmart Buffer, 5 µL; AgeI enzyme, 1 µL; plasmid, 3 µg; ddH2 O, add to 50 μL; Digest with enzymes at 37 °C for 2 h.

[0058] 5. Recovery of the vector digestion product (same as the PCR product recovery steps) 6. Ligation of the target fragment and the vector Two PCR fragments with vector homologous arms at both ends were cloned into the pDF0234-pCMV-huDisCas7-11 dead mutant vector digested with AgeI using the homologous recombination seamless cloning technology. The operation steps were the same as the instructions of the ClonExpress II One Step Cloning Kit (vazyme#C112-01) kit. Among them, the two PCR fragments were dCas13b-NES-METTL3 and dCas13b-NES-FTO.

[0059] Prepare the ligation reaction system on ice, 20 μL: 1) 5×CE II Buffer, 4 μL; Exnase II enzyme, 2 μL; linearized vector, 160 ng; NES-XTEN-METTL3-HA, 68 ng; ddH 2 O, add to 50 μL.

[0060] 2) 5×CE II Buffer, 4 μL; Exnase II enzyme, 2 μL; linearized vector, 160 ng; NES-XTEN-FTO-HA, 60 ng; ddH 2 O, add to 50 μL.

[0061] 7. Transformation of the ligation product 1) Thaw the cloning-competent DH5α cells on ice. Take 10 μL of the recombinant product and add it to 100 μL of the competent cells. Gently flick the tube wall to mix and let it stand on ice for 30 min.

[0062] 2) Heat shock in a 42 °C water bath for 45 s and immediately cool on ice for 3 min.

[0063] 3) Add 900 μL of LB medium (without antibiotics), shake the bacteria at 37 °C and 220 rpm / min for 1 h.

[0064] 4) Preheat the LB solid medium plate with ampicillin (Amp) (100 μg / mL) in a 37 °C incubator. Centrifuge at 5,000 rpm for 5 min and discard 900 μL of the supernatant.

[0065] 5) Resuspend the bacteria with the remaining medium and gently spread it evenly on the solid medium with a sterile spreading rod. Incubate upside down in a 37 °C incubator for 14 h.

[0066] 8. Identification of Positive Clones by Bacterial Liquid PCR Pick 5 colonies from the plate into 1 mL of LB liquid medium containing ampicillin respectively, and culture at 37 °C and 220 rpm / min for 6 h as the bacterial liquid template.

[0067] PCR reaction system, 10 µL: 2×Taq Master Mix, 5 µL; Primer F (10 µM), 0.5 µL; Primer R (10 µM), 0.5 µL; bacterial liquid, 2 µL; ddH 2 O, 2 µL.

[0068] PCR reaction conditions are as follows: 95 °C, 5 min; (95 °C, 30 s; Tm 30 s; 72 °C, 1 kb / min) 30 cycles, 72 °C, 10 min, 4 °C, stay.

[0069] 9. Separation and identification of PCR products by 1% agarose gel electrophoresis.

[0070] 10. Send the bacterial liquid with correct size identified by PCR to Sangon Biotech (Zhengzhou) for sequencing. 11. The bacterial liquids with correct sequencing are named dCas7-11-NES-METTL3-HA and dCas7-11-NES-FTO-HA. The nucleotide sequence of dCas7-11-NES-METTL3-HA is shown in SEQ ID NO.56, and the nucleotide sequence of dCas7-11-NES-FTO-HA is shown in SEQ ID NO.58. After preserving the bacterial strains, expand the culture and extract the plasmid using the ConWin Biotech endotoxin-free plasmid extraction kit.

[0071] Example 2 Construction of dCas7-11-NLS-METTL3-HA and dCas7-11-NLS-FTO-HA The skeletal vector first inserts the NLS sequence before the dCas7-11 sequence by site-directed mutagenesis using SEQ ID NO.10 and SEQ ID NO.11. The nucleus-localized dCas7-11 coupled plasmid contains the incorporated SV40 nuclear localization signal (NLS, KRTADGSEFESPKKKRK) at both the C-terminus and N-terminus of dCas7-11 to ensure its accurate localization in the nucleus. Anneal the NLS sequence Oligo DNA purchased from Sangon Biotech (Shanghai) Co., Ltd. SEQ ID NO.7 and SEQ ID NO.8 are annealed to form NLS, and the NLS sequence is added to the N-terminus of pDF0234-pCMV-huDisCas7-11 dead mutant through the Site-Directed Mutagenesis Kit to form NLS-dCas7-11. Among them, the Site-Directed Mutagenesis Kit is the Mut Express II Fast Mutagenesis KitV2 (vazyme#C214-01) kit.

[0072] Amplify the XTEN-METTL3-HA sequence from pCMV-dead-huDisCas7-11-NES-METTL3-HA using SEQ ID NO.3 and SEQ ID NO.14. Fuse the annealed NLS sequence with the amplified XTEN-METTL3-HA sequence, and generate the NLS-XTEN-METTL3-HA DNA sequence by overlap PCR using SEQ IDNO.9, SEQ ID NO.12 and SEQ ID NO.14, and then clone it into the C-terminus of NLS-dCas7-11 through the ClonExpress II One Step Cloning Kit (Vazyme) to produce pCMV-dead-huDisCas7-11-NLS-METTL3-HA, thereby obtaining the correctly sequenced dCas7-11-NLS-METTL3-HA, whose nucleotide sequence is shown in SEQ ID NO.57.

[0073] Amplify the XTEN-FTO-HA sequence from pCMV-dead-huDisCas7-11-NES-FTO-HA using SEQ ID NO.3 and SEQ ID NO.16. Fuse the annealed NLS sequence with the amplified XTEN-FTO-HA sequence, generate the NLS-XTEN-FTO-HA DNA sequence by overlapping PCR using SEQ ID NO.9, SEQ ID NO.12, and SEQ ID NO.14, and then clone it into the C-terminus of NLS-dCas7-11 through the ClonExpress II One Step Cloning Kit (Vazyme) to produce pCMV-dead-huDisCas7-11-NLS-FTO-HA, thereby obtaining dCas7-11-NLS-FTO-HA with correct sequencing, and its nucleotide sequence is as shown in SEQ ID NO.59.

[0074] The specific conditions for forming NLS-dCas7-11 are as follows: 1. PCR reaction system, a total of 50 µL: 2×Primestar mix, 25 µL; SV40 F (10 µM), 2.5 µL; SV40R (10 µM), 2.5 µL; pDF0234-pCMV-huDisCas7-11 dead mutant vector, 1 µL; ddH 2 O, 19 µL.

[0075] 2. PCR amplification conditions: the same as in Example 1.

[0076] 3. PCR product recovery: the same as in Example 1.

[0077] 4. Digest the original plasmid with DpnI enzyme for the recovered product, and the enzyme digestion reaction system is as follows, a total of 50 µL: 10×NEBrCutsmart Buffer, 5 µL; DpnI enzyme, 2 µL; gel recovery product, 15 µL; ddH 2 O, make up to 50 µL.

[0078] Digest at 37 °C for 1 h 5. Vector enzyme digestion product recovery: the same as in Example 1.

[0079] 6. Prepare the recombination reaction system on ice, a total of 20 µL: 5×CE II Buffer, 4 µL; Exnase II enzyme, 2 µL; DpnI digestion product, 160 ng; ddH 2 O, make up to 20 µL.

[0080] 7. Transform the recombination product, pick colonies for colony PCR identification, and the sequencing steps are the same as above.

[0081] 8. The bacterial solution with correct sequencing is named NLS-dCas7-11. After preserving the bacterial strain, the plasmid is extracted for subsequent experiments.

[0082] The primers used in the present invention for constructing dCas7-11-NES-METTL3-HA, dCas7-11-NLS-METTL3-HA, dCas7-11-NES-FTO-HA, and dCas7-11-NLS-FTO-HA are shown in Table 1.

[0083] Table 1 Primer sequences Example 3 Construct the sgRNA plasmid targeting RNA.

[0084] The Cas 7-11 guiding plasmid (pDF0114 pU6-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site, Addgene #172508) has a human U6 polymerase III promoter itself, contains an sgRNA expression system, contains the DR sequence of DisCas7-11. The sgRNA plasmid is obtained by inserting the sgRNA primer sequence into the Cas 7-11 guiding plasmid. After inserting the sgRNA primer sequence after the DR sequence, the sgRNA targeting RNA can be expressed.

[0085] Table 2 sgRNA primer sequences of Cas7-11 used in the present invention Among them, gNT-RNA (Not Target RNA, non-target RNA sequence) is a negative control.

[0086] The construction steps of the gNT-RNA plasmid are as follows: 1) Non-targeting guide F (SEQ ID NO.18) and Non-targeting guide R (SEQ ID NO.19) are annealed to form a double strand, which is the inserted fragment.

[0087] 2) The PCR annealing program is as follows: 95°C, 5 min; 90°C, 10 min; 80°C, 10 min; 70°C, 10 min; 60°C, 10 min; 50°C, 10 min; 40°C, 10 min; 30°C, 10 min; 20°C, 10 min; 10°C, 10 min; 4°C, stay.

[0088] 3) Vector digestion Digest the plasmid pDF0114 pU6-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site using BsaI endonuclease. The digestion system is as follows: 10×NEB rCutsmart Buffer, 5 µL; BsaI enzyme, 1 µL; vector, 3 µg; ddH 2 O, make up to 50 µL.

[0089] After digesting at 37°C for 2 h, run a nucleic acid gel and then recover it. The steps are the same as above.

[0090] 4) Dilute the annealed oligo double strand 100-fold and then ligate it with the digested pDF0114 pU6-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site vector. The ligation system is as follows, totaling 10 µL: Solution I (Takara, 6022Q), 5 µL; vector, 2 µL; oligo, 1 µL; ddH 2 O, 2 µL.

[0091] 5) Transform the ligated plasmid into DH5α competent cells. The transformation and plating steps are the same as above.

[0092] 6) Pick colonies, identify them by colony PCR, and sequence them. The steps are the same as above.

[0093] 7) After preserving the bacterial strain, extract the plasmid without endotoxin for subsequent experiments.

[0094] The construction steps of the remaining sgRNA plasmids are the same as those of the gNT-RNA plasmid. Among them, the primer sequences of the sgRNA of ACTB are shown in SEQ ID NO.20-21, the primer sequences of the sgRNA of FOXM1 are shown in SEQ ID NO.22-23, the primer sequences of the sgRNA of CYB5A are shown in SEQ ID NO.24-25, and the primer sequences of the sgRNA of TPT1 are shown in SEQ ID NO.26-27. In the sequence of the F strand shown in SEQ ID NO.18-45, remove "GAACg" at the 5' end of the F strand to obtain the corresponding sgRNA sequence.

[0095] Example 4 Use the dCas7-11-METTL3 / sgRNA and dCas7-11-FTO / sgRNA systems to target ACTB, FOXM1, CYB5A, and TPT1 mRNA m 6A undergoes methylation / demethylation modification and regulates its expression level. Targeted mRNA-specific editing m 6 The schematic diagram of A modification is as Figure 1 shown. Specific experimental methods:

[0096] 1. Obtain the dCas7-11-METTL3 / sgRNA and dCas7-11-FTO / sgRNA systems by cell transfection (1)Culture HEK293T cells to a confluence density of 70-80%.

[0097] (2)Plasmid transfection is carried out based on the PEI transfection reagent (Polysciences) according to the manufacturer's protocol. In 24-well assays, use an Opti-MEM (Gibco) solution of 1.6 µL PEI per well, and transfect HEK293T cells or Hela cells with 640 ng of dCas7-11 conjugated plasmid and 960 ng of the corresponding sgRNA plasmid. Among them, the dCas7-11 conjugated plasmids are dCas7-11-NES-METTL3-HA, dCas7-11-NES-FTO-HA, dCas7-11-NLS-METTL3-HA, and dCas7-11-NLS-FTO-HA respectively.

[0098] (3)The transfected cells are cultured at 37 °C under 5% CO 2 for 36 h, and then the total cellular RNA is isolated. Obtain the dCas7-11-METTL3 / sgRNA and dCas7-11-FTO / sgRNA systems.

[0099] 2. Extract total RNA by the FreeZol Reagent precipitation method (1)Lyse the samples. Add 100 µL of FreeZol Reagent (Vayme) to each well of a 12-well plate, shake, let stand at room temperature for 5 min, add 35 µL / well of Dilution Buffer, shake well, and let stand at room temperature for 5 min.

[0100] (2)Centrifuge at 11,200 rpm (12,000×g) at room temperature for 15 min, and pipette approximately 90 µL of the supernatant into a new 1.5 mL centrifuge tube.

[0101] (3)Add an equal volume of isopropanol, invert to mix well, and let stand at room temperature for 10 min.

[0102] (4)Centrifuge at 11,200 rpm (12,000×g) at room temperature for 10 min to precipitate the RNA.

[0103] (5) Add 700 µL of 75% ethanol, resuspend the pellet, centrifuge at 9,100 rpm (8,000×g) for 3 min at room temperature, and discard the supernatant; repeat once.

[0104] (6) Aspirate all the residual liquid and air-dry for 2 - 3 minutes.

[0105] (7) Add 30 µL of RNase-free water, pipette to dissolve the RNA, measure the concentration, and store at -80 °C.

[0106] 3. Detection of target mRNA levels by RT-PCR (1) According to the manufacturer's protocol, reverse transcribe the extracted RNA using HiScript III RT SuperMix for qPCR (Vazyme). First, react at 42 °C for 2 min to remove genomic DNA, and then react at 50 °C for 15 min to reverse transcribe to obtain cDNA.

[0107] (2) Perform Real Time PCR analysis using ChamQ Blue Universal SYBR qPCR Master Mix (Vazyme). Set the starting temperature at 65 °C; set the temperature change at 0.5 °C, and the ending temperature at 95 °C to measure the mRNA expression level with BIO radcfx 3.1.

[0108] (3) Data analysis: Normalize using the housekeeping GAPDH gene, and calculate the relative amount of PCR products using the 2-ΔΔCt method. Where ΔCt = Ct value of the target gene - Ct value of the internal reference gene, ΔΔCt = ΔCt of the experimental group - ΔCt of the control group, and relative gene expression = 2-ΔΔCt.

[0109] 4. Detection of the methylation level of target mRNA by MeRIP-RT-PCR (1) Take 1 µg of RNA and reverse transcribe it using HiScript II Q RT SuperMix for qPCR (Vazyme, R223) as the Input sample.

[0110] (2) Preparation of immunomagnetic beads. ① Wash 50 µL of Protein A / G beats once with 500 µL of 1×IP buffer, and then resuspend the beads with 300 µL of 1×IP buffer; ② Subsequently, add 10 µL of m6A antibody and incubate by inversion at room temperature for 2 h; ③ Discard the supernatant on the magnetic stand, and resuspend the beads with 500 µL of 1×IP buffer and wash 3 times.

[0111] (3)MeRIP. ① Dilute the fragmented RNA to 390 µL with nuclease-free water, add it to the immunomagnetic beads, then add 100 µL of 5× IP buffer and 10 µL of RNase inhibitor, making the total volume of the system 500 µL. ② Incubate on a rotator shaker at 4 °C for 2 h. Then place it on a magnetic stand, discard the waste liquid, and add 750 µL of 1× IP buffer to wash the beads. ③ Then add 1 mL of Trizol to the beads and extract the fragmented mRNA that has been enriched according to the above RNA extraction steps.

[0112] (4)Perform qPCR on the enriched RNA according to the above RT-PCR steps. The data analysis steps are as follows: ① Calculate the dilution factor: input dilution factor = 1 / (amount of RNA used for IP / IgG); ② Calculate ΔCt normalized RIP =Average Ct RIP -Average Ct input -log 2 (input dilution factor) ③ Calculate ΔCt normalized RIP / negative control =ΔCt normalized RIP -ΔCt negative control ④ Calculate Fold Enrichment = 2 -ΔCtnormalized RIP / negative control .

[0113] For ACTB detection, use SEQ ID NO.46 and SEQ ID NO.47; for FOXM1 detection, use SEQ ID NO.48 and SEQ ID NO.49; for CYB5A detection, use SEQ ID NO.50 and SEQ ID NO.51; for TPT1 detection, use SEQ ID NO.52 and SEQ ID NO.53. Use GAPDH as the internal reference control for RT-qPCR.

[0114] Table 3 qPCR primer sequences used in the present invention In this example, gRNAs ( Figure 3 ) corresponding to the target gene sites were designed. HEK293T cells were co-transfected with the dCas7-11-METTL3 fusion protein and the sgRNAs corresponding to the target gene sites. The MeRIP-qPCR experiment found that for ACTB, FOXM1, CYB5A, and TPT1 mRNAs treated with the nucleus-localized dCas7-11-METTL3 fusion protein, m 6The methylation level of A was significantly up-regulated; while for the ACTB, FOXM1, CYB5A, and TPT1 mRNAs treated with the cytoplasm-localized dCas7-11-METTL3 fusion protein, the m 6 A methylation level did not change significantly ( Figure 4 ). Subsequently, quantitative analysis of the target gene mRNA was performed using the nucleus-localized dCas7-11-METTL3 fusion protein, and it was found that the expression levels of ACTB, FOXM1, CYB5A, and TPT1 mRNAs with m 6 A methylation modification were all significantly down-regulated ( Figure 5 ).

[0115] HEK293T cells were co-transfected with the dCas7-11-FTO fusion protein and the gRNA of the corresponding target gene locus. The MeRIP-qPCR experiment found that for the ACTB, FOXM1, CYB5A, and TPT1 mRNAs treated with the dCas7-11-FTO fusion protein with two types of cell localization, the m 6 A methylation levels were all significantly down-regulated ( Figure 6 ). Subsequently, quantitative analysis of the target gene mRNA was performed using the cytoplasm-localized dCas7-11-FTO fusion protein, and it was found that the expression levels of ACTB, FOXM1, CYB5A, and TPT1 mRNAs with the m 6 A methylation modification removed were all significantly up-regulated ( Figure 7 ).

[0116] The above experimental results indicate that the dCas7-11-METTL3 / gRNA and dCas7-11-FTO / gRNA systems can effectively perform methylation / demethylation modification editing on the target gene and regulate its mRNA expression level.

[0117] Example 5 Explore the editing window of the dCas7-11-METTL3 / sgRNA and dCas7-11-FTO / sgRNA systems In this example, the sequence of the FOXM1 sgRNA is shown in SEQ ID NO.28-43. The designed sgRNAs are strategically located at different intervals of the A3488 site on the FOXM1 transcript, from 28 base pairs upstream to 28 base pairs downstream of this site ( Figure 8 ). HEK293T cells were co-transfected with the nucleus-localized dCas7-11-METTL3 fusion protein and the FOXM1 sgRNA. The MeRIP-qPCR experiment found that the sgRNAs showed significant methylation editing efficiency for FOXM1 A3488 within the -7 to +7 nucleotide (nt) window, and the sgRNA designed to contain this site showed the best editing efficiency.

[0118] HEK293T cells were co-transfected with the cytoplasm-localized dCas7-11-FTO fusion protein and FOXM1 sgRNA. The MeRIP-qPCR experiment found that the sgRNA showed significant demethylation editing efficiency for FOXM1 A3488 within the -7 to +7 nt window, and the sgRNA designed to contain this site showed the best editing efficiency ( Figure 8 ).

[0119] The above experimental results together indicate that when the spacer of the target RNA m 6 A site is 7 bp, the dCas7-11-METTL3 / sgRNA and dCas7-11-FTO / sgRNA systems are the most active and can install or erase m 6 A on the determined adenosine of the target RNA.

[0120] Example 6 The dCas7-11-METTL3 / sgRNA and dCas7-11-FTO / sgRNA systems were used to edit and regulate the expression of specific mRNAs.

[0121] Specific experimental method Western-Blotting analysis (1) Protein samples were collected 36 h after cell transfection, and 2×SDS loading buffer was added and stirred well. The lysate was boiled at 95 °C for 30 min, then 20 µL of the protein sample was added, and then it was subjected to 10% SDS-PAGE. SDS-PAGE electrophoresis separation was carried out at a voltage of 80 - 120 V.

[0122] (2) Electrotransfer was carried out onto a methanol-pretreated polyvinylidene fluoride (PVDF) membrane under the conditions of a constant current of 200 mA for 90 min.

[0123] (3) The PVDF membrane was blocked with 5% non-fat milk (20 mM Tris, 0.9% NaCl, and 0.05% Tween 20) for 2 h.

[0124] (4) The detection antibody was diluted with the blocking solution at a ratio of 1:1000, and the PVDF membrane was incubated overnight at 4 °C. The membrane was washed 3 times with PBST, 10 min each time, and then added with an HPR-labeled goat anti-rabbit or goat anti-mouse IgG secondary antibody (1:5000, diluted with the blocking solution), and incubated at room temperature for 1 h. The membrane was washed 3 times with PBST, 10 min each time.

[0125] (5) Add the ECL luminescent solution and image it on an Amersham Imager 680 (GE Health) (NCM Biotech) with enhanced chemiluminescence.

[0126] In this example, an sgRNA targeting the m 6 A site of the STING mRNA CDS region was designed, and the sequence is shown in SEQ ID NO. 44 - 45. Transfection of the dCas7-11-METTL3 fusion protein into HEK293T cells significantly increased the m Figure 9 A methylation level of STING mRNA ( 6 ). Analysis of the Western blot results indicated that the expression level of the STING protein was significantly decreased after the addition of m Figure 10 A methylation modification ( 6 ). Figure 11

[0127] Transfection of the dCas7-11-FTO fusion protein into HEK293T cells significantly decreased the m 6 A methylation level of STING mRNA ( Figure 12 ). Analysis of the Western blot results indicated that the expression level of the STING protein was significantly decreased after the addition of m 6 A methylation modification ( Figure 13 ).

[0128] The above experimental results show that the dCas7-11-METTL3 / sgRNA and dCas7-11-FTO / sgRNA systems can be used to target the study of m 6 A modification of STING and perform editing regulation on its expression.

[0129] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints can be selected. To avoid redundancy, the preferred embodiments of the present invention are described.

[0130] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they know the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0131] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A regulatory target mRNA m 6 A methylation modification system, characterized in that The system includes an RNA-targeting mRNA m 6 A recombinant nuclease with methylation modification function and its sgRNA targeting RNA.

2. The system according to claim 1, characterized in that The recombinant nuclease is prepared by 6 The enzymatic activity functional domain of the regulatory enzyme of A is connected to dCas7-11 and fused into a recombinant nuclease with regulatory enzyme activity; The regulatory enzyme is a methyltransferase or a demethyltransferase.

3. The system according to claim 2, characterized in that The recombinant nuclease is a dCas7-11-METTL3 fusion protein or a dCas7-11-FTO fusion protein; The dCas7-11-METTL3 fusion protein is dCas7-11-NLS-METTL3-HA, and the sequence of the dCas7-11-NLS-METTL3-HA is shown in SEQ ID NO.57; The dCas7-11-FTO fusion protein is dCas7-11-NES-FTO-HA or dCas7-11-NLS-FTO-HA, the sequence of the dCas7-11-NES-FTO-HA is shown in SEQ ID NO.58, and the sequence of the dCas7-11-NLS-FTO-HA is shown in SEQ ID NO.

59.

4. The system according to claim 3, characterized in that The regulated target mRNA m 6 A methylation modification system is dCas7-11-METTL3 / sgRNA system or dCas7-11-FTO / sgRNA system; The dCas7-11-METTL3 fusion protein constitutes the dCas7-11-METTL3 / sgRNA system; The dCas7-11-FTO fusion protein constitutes the dCas7-11-FTO / sgRNA system.

5. The system according to claim 4, characterized in that The preparation method of the system comprises the following steps: Constructing RNA-targeting sgRNA vectors; Transfecting cells with the dCas7-11-METTL3 fusion protein and the sgRNA vector to obtain the dCas7-11-METTL3 / sgRNA system; The dCas7-11-FTO fusion protein and the sgRNA vector are transfected into cells to obtain the dCas7-11-FTO / sgRNA system.

6. Use of the system according to claim 1 in preparing disease target drugs.

7. A regulatory target mRNA m 6 A methylation modification method, characterized in that, Using the system described in claim 3, the recombinant nuclease with corresponding function is guided to the corresponding mRNA to achieve the regulation of the target mRNA m 6 A methylation modification.

8. The method according to claim 7, characterized in that The regulated target mRNA m 6 A methylation modification is the modification of target mRNA m 6 A methylates or modifies the target mRNA m 6 A undergoes demethylation; The dCas7-11-METTL3 / sgRNA system was used to target mRNA m 6 A undergoes methylation; The dCas7-11-FTO / sgRNA system was used to target mRNA m 6 A undergoes demethylation.

9. The method according to claim 8, characterized in that The target mRNA is mRNA of ACTB, FOXM1, CYB5A, TPT1 or STING; Among them, the nucleotide sequence of the sgRNA of ACTB is GTAACGCAACTAAGTCATAGTCCGCCTAGA; The nucleotide sequence of the sgRNA for FOXM1 is CCTGAGTTCTCGTCAATGCCAGTCTCCCTG; The nucleotide sequence of the sgRNA for CYB5A is GCTGTGGTTGTGCTTCTGAATCTCCTCTAG; The nucleotide sequence of the sgRNA for TPT1 is ATCAGTCCCATTTGTCTTAAGTCCTGGTGT; The nucleotide sequence of STING's sgRNA is GGTTATCAGGCACCCCACAGTCCAATGGGA.

10. The method according to claim 7, characterized in that The sgRNA is expressed in the target mRNA m 6 The A site spacer is 7 bp.