A Cslnc170-CsLOX4 gene pair in tea plants and its application in improving anthracnose resistance

Abstract

The present invention discloses a Cslnc170-CsLOX4 gene pair in tea plants and their application in improving anthracnose resistance, belonging to the field of tea plant gene application technology. The gene is located on the chromosome of the tea genome. The Cslnc170 gene, with a total length of 1581bp, is located 9254bp downstream of the CsLOX4 gene, a member of the 13-lipoxygenase (13-LOX) family. Beneficial effects: The Cslnc170-CsLOX4 gene can be used to regulate tea plants' resistance to anthracnose. From the perspective of their mode of action, loop 4 (252bp-271bp) of the Cslnc170 secondary structure and the 930bp-952bp region of the CsLOX4 promoter are the main functional regions for their interaction. The present invention provides a new direction for improving tea plant disease resistance and has high application prospects and economic value.

Description

Technical Field

[0001] The present invention belongs to the technical field of tea tree gene application, and particularly relates to a Cslnc170-CsLOX4 gene pair in tea trees and their application in improving anthracnose resistance. Background Art

[0002] In warm and humid tea-growing regions, fungal diseases such as anthracnose are major diseases that affect the yield and quality of tea beverages. To defend against pathogen invasion, plants have evolved a complex innate immune system, including PAMP-triggered immunity (PTI) triggered by pathogen-associated molecular patterns (PAMPs) and effector-triggered immunity (ETI) triggered by effector factors. Fungal stress-induced plant hormone pathways, such as salicylic acid, jasmonic acid, ethylene, and auxin signaling pathways, play an important role in regulating plant defense responses to fungal stress.

[0003] Increasing evidence supports the key role of non-coding RNA genes in enhancing plant immunity. Non-coding RNAs (ncRNAs) with more than 200 nucleotides are defined as long non-coding RNAs (lncRNAs). LncRNAs are widely involved in plant immune responses to biotic and abiotic stresses, and their target genes are diverse and involved in various physiological aspects. Related studies have shown that stress-responsive lncRNA target genes are enriched in plant immunity, including ROS accumulation, PR gene expression, miRNA biosynthesis pathways, plant-pathogen infection interactions, and hormone signaling pathways such as jasmonic acid and salicylic acid.

[0004] For example, among 567 disease-responsive lncRNAs in rice infected with Xanthomonas oryzae, 73 interacted with 39 protein-coding genes in the jasmonic acid pathway. In tomato fruit, 273 lncRNAs were found to respond to Botrytis cinerea infection, and many more antisense lncRNAs were found to target and regulate the expression of hydrolase-activating genes. Transcription of tomato-responsive lncRNAs revealed a role for hydrolase-encoding genes in responding to Botrytis cinerea invasion. In tea plants, an evolutionarily conserved OPRL-OPR gene pair was also discovered, which influences plant resistance to anthracnose via the jasmonic acid pathway. To date, lncRNAs have been reported to be widely involved in regulating tea plant life, such as secondary metabolism. Tissue-specific long noncoding RNAs are involved in the aroma formation of black tea. To investigate the functions of long noncoding RNAs (lncRNAs) and the potential regulatory mechanisms of lncRNA-mRNA interactions, we used transcriptome sequencing to enrich lncRNAs induced in tea plants.

[0005] Defects and shortcomings of existing technology:

[0006] ① The existing tea tree anthracnose prevention technology relies on chemical control. The long-term and large-scale use of chemical agents such as pyraclostrobin emulsifiable concentrate, difenoconazole water-dispersible granules, and thiophanate-methyl wettable powder can easily lead to pesticide residues in tea leaves and soil, which not only affects the quality of tea, but also pollutes the ecological environment and threatens the balance of the tea garden ecosystem.

[0007] ②The research on the mechanism of lncRNA regulating anthrax resistance at the molecular level is not in-depth enough, and it is impossible to effectively prevent anthrax at the biomolecular level.

[0008] The Chinese patent application document with publication number CN116162645A discloses the use of an inducible transcription factor CoWRKY3 in plant resistance to anthracnose. This patent belongs to the field of transcription factor application technology and discloses the use of an inducible transcription factor CoWRKY3 in plant resistance to anthracnose. The use of the inducible transcription factor CoWRKY3 in plant resistance to anthracnose includes the use of the protein encoded by the inducible transcription factor CoWRKY3 to improve the ability of plants to resist anthracnose. The CoWRKY3 gene is of great significance for breeding transgenic crops resistant to anthracnose and improving the stress resistance of crops, enriching the genetic resources for breeding highly disease-resistant crops. However, there are few reports on long non-coding RNA genes related to anthracnose resistance in tea trees. Summary of the Invention

[0009] The technical problem to be solved by the present invention is how to propose a lncRNA for regulating the anthracnose resistance of tea trees and its application.

[0010] The present invention solves the above technical problems through the following technical means:

[0011] The first aspect of the present invention provides a long non-coding RNA (Cslnc170 gene), whose cDNA sequence includes the nucleotide sequence shown in SEQ ID NO.1.

[0012] The second aspect of the present invention proposes any of the following applications of the Cslnc170 gene:

[0013] (1) Application in activating the CsLOX4 gene promoter;

[0014] (2) Application in promoting CsLOX4 gene expression;

[0015] (3) Application in detecting anthracnose resistance in tea trees;

[0016] (4) Application in improving the anthracnose resistance of tea trees;

[0017] (5) Application in the cultivation of anthracnose-resistant tea varieties.

[0018] Preferably, in (1), Cslnc170 acts as a lncRNA to activate the CsLOX4 promoter.

[0019] The third aspect of the present invention provides a recombinant vector comprising the Cslnc170 gene according to claim 1.

[0020] The fourth aspect of the present invention provides a transfection vector comprising the above-mentioned recombinant vector.

[0021] Preferably, the transfection vector is Agrobacterium.

[0022] The fifth aspect of the present invention provides a drug for preventing and treating tea tree anthracnose, comprising the above-mentioned transfection vector.

[0023] In a sixth aspect, the present invention provides the use of CsLOX4 in improving the anthracnose resistance of tea plants. The CsLOX4 comprises a CsLOX4 gene and a CsLOX4 protein. The nucleotide sequence of the CsLOX4 gene is shown in SEQ ID NO. 2. The amino acid sequence of the CsLOX4 protein is shown in SEQ ID NO. 3.

[0024] A seventh aspect of the present invention provides a method for breeding anthracnose-resistant tea plants, comprising the following steps: obtaining tea plants having higher anthracnose resistance than the target plants by promoting the expression of the Cslnc170 gene or the CsLOX4 gene in the target plants.

[0025] Preferably, the method for promoting the expression of the Cslnc170 gene or the CsLOX4 gene in the target plant comprises: constructing a Cslnc170 gene or CsLOX4 gene overexpression vector and introducing the vector into the target plant.

[0026] The beneficial effects of the present invention are:

[0027] This study proposes a gene pair, Cslnc170-CsLOX4, in tea plants. On the chromosomes of the tea genome, the 1581-bp Cslnc170 gene is located 9254 bp downstream of the CsLOX4 gene, a member of the 13-lipoxygenase (13-LOX) family. This gene pair can enhance tea plant disease resistance, providing a new approach for improving tea plant disease resistance.

[0028] 2. Single base substitution experiments at the Cslnc170 site combined with CsLOX4 promoter activation experiments showed that Cslnc170, as a non-coding transcript, activated the expression of CsLOX4.

[0029] 3. CsLOX4 promoter and Cslnc170 truncation experiments revealed that loop 4 of the Cslnc170 secondary structure and the 930-952 bp region of the CsLOX4 promoter are the primary functional regions for their interaction. Agrobacterium-mediated transient gene overexpression and antisense oligonucleotide-mediated gene silencing experiments demonstrated that the Cslnc170-CsLOX4 gene pair enhances tea plant resistance to anthracnose.

[0030] 4. Dual-luciferase reporter assays demonstrated that Cslnc170 can activate the CsLOX4 promoter. To investigate the interaction mechanism between Cslnc170 and the CsLOX4 promoter, we used IntaRNA software (MechRNA: Predicting lncRNA mechanisms from RNA-RNA and RNA-protein interactions, IntaRNA 2.0: Predicting RNA-RNA interactions) to predict specific sequence-specific covalent binding sites. The prediction results revealed a binding region with a free energy of 9.82 kcal / mol at -930bp-952bp on the CsLOX4 promoter, which binds to the 252bp-271bp region of Cslnc170.

[0031] 5. The cis-acting Cslnc170-CsLOX4 gene pair was shown to positively regulate tea plant resistance to anthrax. In terms of their mode of action, loop 4 (252bp-271bp) of the Cslnc170 secondary structure and the 930bp-952bp region of the CsLOX4 promoter are the primary functional regions for their interaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Figure 2 shows the transcriptional map of Cslnc170 positively regulating its target gene CsLOX4, where A is the RACE cloning map of Cslnc170, B is the agarose gel electrophoresis analysis of the Cslnc170 RACE clone, C is a schematic diagram of single-base substitution, D is a schematic diagram of the effector and reporter vector constructs used for transient expression assays in tobacco leaves, and E and G are luciferase reporter assays showing activation of the CsLOX4 promoter by Cslnc170, Cslnc170-1, and Cslnc170-2 (**P < 0.01, Student's t test (two-way)).

[0033] Figure 2Figure 1 illustrates the mechanism of Cslnc170 regulating CsLOX4, where A is the structure of the CsLOX4 promoter interaction binding site, B is the CsLOX4 promoter truncation diagram, C is the luciferase reporter assay of Cslnc170 activating CsLOX4 promoters of different lengths, D is the secondary structure diagram of stem-loop4 and stem4, and E-F are luciferase reporter assays of stem-loop4 and stem4 activating the CsLOX4 promoter (**P < 0.01, Student's t test (two-way)).

[0034] Figure 3 Figure 2 is a diagram of the roles of CsLOX4 and Cslnc170 in tea plant anthracnose resistance, where A is a workflow diagram for studying tea plant anthracnose resistance based on Agrobacterium-mediated transient gene expression and antisense oligonucleotide-mediated gene silencing, BC is a functional diagram for analyzing CsLOX4 in tea plant anthracnose resistance through Agrobacterium-mediated transient expression and antisense oligonucleotide-mediated gene silencing, and DF is a functional diagram for analyzing Cslnc170 and stem4 in tea plant anthracnose resistance through Agrobacterium-mediated transient expression and antisense oligonucleotide-mediated gene silencing. DETAILED DESCRIPTION

[0035] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0036] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0037] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the field or according to the product instructions.

[0038] Example 1:

[0039] This embodiment provides a LncRNA for regulating anthracnose resistance in tea plants and its application. The method comprises the following steps:

[0040] First, to explore the function of Cslnc170, we first cloned the full-length sequence of Cslnc170 using RACE (rapid amplification of cDNA ends) based on the sequence information obtained by RNA-seq ( Figure 1 A, B).

[0041] The sequence (TL) obtained by RNA-seq was only 529 bp long. Based on this, a 1052 bp long product was obtained when 3'-RACE was performed. However, no product was obtained when 5'-RACE was performed. Further cloning of the full-length sequence of Cslnc170 revealed that the full length of Cslnc170 was 1581 bp. Genomic data showed that Cslnc170 was located on chromosome 14, with a full length of 1581 bp and no intron structure ( Figure 1 A), whose cDNA sequence includes the nucleotide sequence shown in SEQ ID NO.1.

[0042] The coding capacity of the full-length sequence of Cslnc170 was predicted, and it was found that Cslnc170 contained two putative ORFs ( Figure 1 C-green and red modules), which may encode two short peptides of 33 aa and 27 aa in length, respectively.

[0043] Second, to verify whether Cslnc170 functions as a long noncoding RNA (lncRNA) or by encoding a short peptide, we conducted single-base substitution experiments at the start and stop codons of two putative ORFs, replacing them with AT or TA to prevent their coding. The replacements were named Cslnc170-1 and Cslnc170-2. We constructed Cslnc170, Cslnc 170-1, and Cslnc170-2 into expression vectors, and constructed the CsLOX4 promoter into the pGreenII 0800 vector fused with the LUC reporter gene. Under the mediation of Agrobacterium, they were transiently co-expressed in tobacco to observe whether Cslnc170, Cslnc170-1, and Cslnc170-2 activated the CsLOX4 promoter. Figure 1 D).

[0044] Overexpression vector construction

[0045] 1. Construction of overexpression vectors for Cslnc170 and its mutant forms

[0046] (1) RNA obtained from Zhongcha 108 was used as the material to synthesize the 3′RACE-Ready cDNA template required for RACE cloning using the SMARTer RACE 5′ / 3′ Kit (Takara). PCR amplification was performed using the following primers, and the amplified product was recovered:

[0047] UPM-F (SEQ ID NO:4):5'-CTAATACGACTCACTATAGGGC-3';

[0048] Cslnc170-3'RACE-R(SEQ ID NO:5):

[0049] 3'-CTAGATGAGGCCACAACATGTGATGTG-5';

[0050] Cslnc170-F (SEQ ID NO:6): 5'-CATTAACGAGCAAGTTAATGTTATTC-3';

[0051] Cslnc170-R (SEQ ID NO:7): 3'-GGCGTTATTAATTAGACCAAATTAA-5';

[0052] (2) The amplified product of step (1) was recovered as a template, and the following primers were used to perform base mutation of Cslnc170 to obtain the cloned products of Cslnc170-1 and Cslnc170-2:

[0053] Cslnc170-1-F(SEQ ID NO:8):5'-TTACAAAATATTGTGTAAACT-3'

[0054] Cslnc170-1-R(SEQ ID NO:9):3'-TTGACTTTTAAGTTTTTTTAAC-5'

[0055] Cslnc170-2-F (SEQ ID NO:10): 5'-AAGCTTATTTTGTTTGGACAAATG-3'

[0056] Cslnc170-2-R (SEQ ID NO:11): 3'-TGTCTAAAAATAAAAAAATTATAC-5';

[0057] (3) Take the pCAMBIA1305.1 vector and perform double digestion with restriction endonucleases BamhI and XbaI to recover the vector backbone;

[0058] (4) The amplified products recovered in steps (1) and (2) and the vector backbone recovered in step (3) were connected to obtain recombinant plasmids 35S::Cslnc170, 35S::Cslnc 170-1 and 35S::Cslnc170-2.

[0059] 2. Construction of CsLOX4 overexpression vector

[0060] (1) Using the RNA obtained from Zhongcha 108 as a material and the cDNA obtained by reverse transcription as a template, PCR amplification was performed using the following primers, and the amplified product was recovered:

[0061] CsLOX4-F (SEQ ID NO:12): 5'-ATGTTGAACAGTCAAGTTCACC-3';

[0062] CsLOX4-R (SEQ ID NO:13): 3'-TCAAATTGAGATGCTATTTGGAAC-5';

[0063] (2) Take the pCAMBIA1305.1 vector and perform double digestion with restriction endonucleases BamhI and XbaI to recover the vector backbone.

[0064] (3) ligating the amplified product recovered in step (1) and the vector backbone recovered in step (3) to obtain the recombinant plasmid 35S::CsLOX4;

[0065] (4) The recombinant plasmid 35S::CsLOX4 was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium.

[0066] 3. Construction of overexpression vectors of CsLOX4 promoter and its truncated forms

[0067] (1) Using the DNA obtained from Zhongcha 108 as the material, PCR amplification was performed using the following primers, and the amplified product was recovered:

[0068] CsLOX4pro-F (SEQ ID NO: 14):

[0069] 5'-GGGTGAGACCCACTACCATATCATTAGTGG-3'

[0070] CsLOX4pro-R (SEQ ID NO: 15):

[0071] 3'-CCATGGAATTAGAATTTGGACAGTATG-5'

[0072] (2) The amplified product of step (1) was recovered as a template, and the following primers were used to truncate the sequence of the CsLOX4 promoter, respectively, to obtain cloning products of different truncation forms of the CsLOX4 promoter, P1, P2, P1-P2, P3, P4, and P5:

[0073] (3) Take the pGreenII 0800 vector and perform single enzyme digestion with the restriction endonuclease BamhI to recover the vector backbone.

[0074] (4) The amplified products recovered in steps (1) and (2) were ligated with the vector backbone recovered in step (3) to obtain recombinant plasmids CsLOX4pro::LUC, P1-LUC, P2-LUC, (P1-P2)-LUC, P3-LUC, P4-LUC and P5-LUC.

[0075] Dual-luciferase reporter assay

[0076] (1) Introducing all of the above recombinant vectors into Agrobacterium GV3101 to obtain recombinant Agrobacterium;

[0077] (2) The recombinant Agrobacterium strains containing effectors (35S::Cslnc170, 35S::Cslnc 170-1 and 35S::Cslnc170-2) and reporter genes (CsLOX4pro::LUC, P1-LUC, P2-LUC, (P1-P2)-LUC, P3-LUC, P4-LUC and P5-LUC) were activated and cultured to OD 600 is 0.8.

[0078] (3) The pGreenII 0800 vector was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium as a control, and the recombinant Agrobacterium was activated and cultured to OD 600 is 0.8;

[0079] (4) The cells were collected by centrifugation at room temperature and resuspended twice in a solution containing 10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone (pH 5.6);

[0080] (5) Adjust the OD of Agrobacterium suspension 600 The pH was adjusted to 0.8 and used to infiltrate 5-6 week old Nicotiana benthamiana leaves. The plants were then incubated for another 3 days.

[0081] (6) Luciferase substrate was sprayed onto Nicotiana benthamiana leaves, and the luminescence signal was detected using a CCD imaging device (Lumazone Pylon 2048B). Simultaneously, the activities of firefly LUC and Renilla (REN) were measured using a dual-luciferase assay reagent (Promega, Madison, WI, USA). The LUC / REN ratio represents the promoter activity.

[0082] LUC imaging and dual luciferase detection showed that when Cslnc170 was co-expressed with CsLOX4 promoter, the fluorescence intensity on the leaves was significantly higher than that of other control combinations; and the LUC activity was also significantly higher than that of other control combinations ( Figure 1E), indicating that Cslnc170 can activate the CsLOX4 promoter. This activation effect still exists when Cslnc170-1 or Cslnc170-2 is co-expressed with the CsLOX4 promoter ( Figure 1 F, G). (The nucleotide sequence of the CsLOX4 gene is shown in SEQ ID NO. 2, and the amino acid sequence of the protein encoded by the CsLOX4 gene is shown in SEQ ID NO. 3)

[0083] These results demonstrate that Cslnc170 can activate the CsLOX4 promoter as a lncRNA rather than through a short peptide.

[0084] 3. According to the genome data assembled at the chromosome level, Cslnc170 is located 9254 bp downstream of the CsLOX4 gene ( Figure 2 A) To investigate the interaction mechanism between Cslnc170 and the CsLOX4 promoter, we used IntaRNA software to predict the specific sequence-specific covalent binding sites between them.

[0085] The prediction results showed that there is a binding region with a free energy of 9.82 kcal / mol at -930bp-952bp of the CsLOX4 promoter, which can bind to the 252bp-271bp region of Cslnc170 ( Figure 2 A). This result was further confirmed by gene truncation of the LOX4 promoter and Cslnc170 and combined with dual luciferase assay (e.g. Figure 2 shown).

[0086] The results of dual luciferase assays showed that the main region activated by Cslnc170 was the 1005 bp (P1) to 884 bp (P2) fragment of the CsLOX4 promoter ( Figure 2 B, C), and the 252 bp to 271 bp region of Cslnc170 is a key regulatory element that regulates the transcriptional activity of the CsLOX4 target gene CsLOX4 ( Figure 2 D, E, F).

[0087] 4. To verify the role of Cslnc170-CsLOX4 in resisting tea tree anthracnose, we transiently overexpressed and silenced these two genes based on Agrobacterium-mediated transient overexpression technology and antisense oligonucleotide-mediated gene silencing technology, respectively.

[0088] 1. Transient overexpression in tea leaves

[0089] (1) Activate and culture the recombinant Agrobacterium of 35S::Cslnc170 and 35S::CsLOX4 to OD 600 is 0.8;

[0090] (2) The cells were collected by centrifugation at room temperature and resuspended twice in a solution containing 10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone (pH = 5.6);

[0091] (3) Adjust the OD of Agrobacterium suspension 600 To 0.8 injection of tea leaves.

[0092] 2. Tea Tree Instant Silence

[0093] (1) SOLIGO software was used to select and synthesize the following candidate antisense oligonucleotides (AsODNs) targeting Cslnc170 and CsLOX4 by General Biosystems:

[0094] Cslnc170-sODN (SEQ ID NO:16):ATAAGATGCTCCATGAGGGTG

[0095] Cslnc170-AsODN1(SEQ ID NO:17):GTGGGAGTACTCGTAGAATA

[0096] Cslnc170-AsODN2 (SEQ ID NO:18): TAACACATCACATGTTGTGG

[0097] Cslnc170-AsODN3 (SEQ ID NO:19):CGTTTGAAATTACGAGAACC

[0098] CsLOX4-sODN(SEQ ID NO:20):AGGATCGTGGTAATTTCGGT

[0099] CsLOX4-AsODN1 (SEQ ID NO:21): TGGCTTTAATGGTGCTAGGA

[0100] CsLOX4-AsODN2 (SEQ ID NO:22):TGGTTGCTATGGCTTTAATG

[0101] CsLOX4-AsODN3 (SEQ ID NO:23): TCTGGTGGGCCGTATATCTT

[0102] (2) 1 mL of a 100 μM AsODN mixed solution was injected into tea seedlings, while tea seedlings injected with sense oligonucleotides (sODNs) served as controls;

[0103] (3) Quantitative detection and analysis were performed after 48 hours.

[0104] 3. Anthracnose infection of tea leaves

[0105] (1) Cultivate anthrax strains (Camelliae camelliae) on PDA medium at 28°C for 5 days;

[0106] (2) Collect spores by centrifugation at 6000 g for 10 minutes. After collection, resuspend the spores in sterile water and adjust the concentration to 10^6 spores / mL under microscopic monitoring for subsequent inoculation.

[0107] (3) Inoculate the upper epidermis of plant leaves with a total of 50 μL of conidia suspension using a sterile syringe. Control plants are inoculated with an equal amount of sterile distilled water. Cover the inoculated leaves with plastic film to maintain high humidity and promote fungal growth.

[0108] (4) After a 24-hour incubation period, the films were removed and the symptoms of infected leaves were recorded within 6 days after inoculation.

[0109] We constructed the target gene on the pCAMBIA1305.1 vector driven by CaMV35S through one-step enzyme ligation technology to obtain the recombinant vector of the candidate gene. Then, we used Agrobacterium transient technology to transform it into tea leaves (Zhongcha 108) and inoculated the camellia anthracnose strain 24 hours later to induce the tea trees to develop disease ( Figure 3 A).

[0110] Subsequently, we detected the expression of the corresponding gene by qRT-PCR. The results showed that compared with the control, the expression level of CsLOX4 in tea leaves of the transient overexpression CsLOX4 experimental group was significantly increased, and the area of ​​lesions caused by inoculation was significantly reduced ( Figure 3 B); When the expression level of the CsLOX4 gene was silenced, the lesion area of ​​the tea leaves after inoculation was significantly larger than that of the control leaves. The above results indicate that the expression level of the CsLOX4 gene is positively correlated with the resistance of tea plants to anthracnose ( Figure 3 C).

[0111] Similarly, transient overexpression and antisense oligonucleotide-mediated gene silencing experiments showed a positive correlation between Cslnc170 gene expression and tea plant resistance to anthracnose. Compared with the control group, transient overexpression of Cslnc170 significantly increased the expression of CsLOX4 in tea leaves, which led to a significant reduction in lesion area ( Figure 3 D). In contrast, silencing Cslnc170 resulted in a significant decrease in the expression of CsLOX4 in tea leaves. The lesion area after inoculation was significantly larger than that observed in control leaves ( Figure 3E). In addition, when the Cslnc170-stem4 recombinant sequence lacking the 252bp-271bp region was transiently overexpressed in tea leaves, the expression level of CsLOX4 did not change significantly compared with the control group. There was also no significant difference in lesion size ( Figure 3 F). These results further confirm the critical role of the 252 bp-271 bp region in Cslnc170 in its resistance function.

[0112] Cslnc170 truncation experiments

[0113] (1) Using the Cslnc170 plasmid as a template, perform PCR amplification using the following primers and recover the amplified product:

[0114] Stem4-1-F (SEQ ID NO: 24):

[0115] CTCCTTATGAAGACAAAGAATGAAGAAAAAAAAATTC

[0116] Stem4(Stem4-1)-R(SEQ ID NO:25):

[0117] 3'-GGCGTTATTAATTAGACCAAATTAATATAATTC-5';

[0118] Stem4(Stem4-2)-F(SEQ ID NO:26):

[0119] 5'-CATTAACGAGCAAGTTAATGTTATTCTACG-3';

[0120] Stem4-2-R (SEQ ID NO: 27):

[0121] 3'-GAATTTTTTTTTCTTCATTCTTTGTCTTCATAAGGAG-5';

[0122] (2) The two amplified products obtained in step (1) were PCR-fused and used as templates. PCR amplification was performed using the following primers. The amplified product was recovered and named stem4:

[0123] Stem4(Stem4-2)-F(SEQ ID NO:26):

[0124] 5'-CATTAACGAGCAAGTTAATGTTATTCTACG-3';

[0125] Stem4(Stem4-1)-R(SEQ ID NO:25):

[0126] 3'-GGCGTTATTAATTAGACCAAATTAATATAATTC-5';

[0127] (3) The obtained stem4 was constructed on the pCAMBIA1305.1 expression vector to obtain a recombinant vector;

[0128] (4) The recombinant vector was introduced into Agrobacterium GV3101 for subsequent transient expression in Nicotiana benthamiana and Camellia sinensis leaves.

[0129] SEQ ID NO.1:

[0130]

[0131] SEQ ID NO.2:

[0132]

[0133] SEQ ID NO.3:

[0134] MLNSQVHQSHTVQILIPWHKPFPSGTASPSSSLHLLKPGLCGNQKDKGRVRCVPSTIKAIATTTTEQTTIVKAVVCVKLTVGGFLSNLGLSRGLDDVADMLGKSIQLELVSAELDPKTGLEKETIKGYAHRTSQEEDEVKYECNFVIPEGYGEIGAVLVENEHHKEMYLKQIVFHGFPPGGPVHVTCNSWVASKFHNPHKRIFFTNKSYLPSQTPDGLKRLREKELENLRGNGQGKRKIHERIYDYDVYNDIGDPDTSSTLKRPVLGGKQHPYPRRCRTGRPRSKTDPMSESWCSGSIYVPRDEAFSDVKQLTFSGMPVYSVLHALIPSIENAIVDIDLGFPYVTAIDSLFDEGVNLLPLSKNGLLKDLLPRLVKFVSDAEEGLLRFETPAMFERDKFSWLRDEEFSRQTLGGLNPCSIQLVKEWPLKSKLDLKIYGPPESAITKELIERQIRGFMTLEEALQTKKLFMLDYHDLLLPYVNKVRESKGTALYGSRTLFFLTPDGTLRPLAIELTRPPVDGKPQWKQVFTPTGDATGCWLWRLAKVHALAHDSGYHQLVSHWLRTHCVTEPYIIASNRQLSAMHPIYKLLHPHFRYTMEINALARQALINAGGIIETCFSPKKYSIELSSVAYDQQWRFDLQALPADLISRGMAMEDPTALHGLRLTIEDYPYASDGLLVWDAIKQWVTDYVKHYYQDASFVQSDKELQAWWTEIQTVGHGDKKDETWWPVLKTPQDLIGILTTMIWVTSGHHSAVNFGQYIYAGYFPNRPTIARTKMPTEEPTDEEWKCFINKPEVALLMCFPSQIQATKVMAVLDVLSNHSPDEEYLGKDMEASWIENPIIKAAFERFNGKLKELEGVIDRRNVDKNLKNRCGAGVVPYELLKPFSEPGVTGRGVPNSISI

[0135] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A Cslnc170 gene, characterized in that: The cDNA sequence is the nucleotide sequence shown in SEQ ID NO.

1.

2. Use of the Cslnc170 gene according to claim 1 in improving anthracnose resistance in tea plants.

3. Use of the Cslnc170 gene according to claim 1 in breeding anthracnose-resistant tea varieties.

4. A recombinant vector, characterized in that Contains the Cslnc170 gene according to claim 1.

5. A transfection vector, characterized in that Contains the recombinant vector according to claim 4.

6. The transfection vector according to claim 5, characterized in that The transfection vector is Agrobacterium.

7. A drug for preventing and treating tea tree anthracnose, characterized in that: Contains the transfection vector according to any one of claims 5-6.

Images