DsFAR2 (at) ZIF-8 nano-composite, preparation method thereof and application of dsFAR2 (at) ZIF-8 nano-composite in prevention and treatment of manioc sponge mealybug

Abstract

The invention belongs to the technical field of biology, and particularly discloses a dsFAR2 (at) ZIF-8 nano complex and a preparation method and application thereof in prevention and treatment of mealybug solani manihot, an RNAi technology and a nano material are combined, the dsFAR2 (at) ZIF-8 nano complex prepared by wrapping dsRNA with ZIF-8 nano particles can effectively inhibit expression of a key gene FAR2 for wax synthesis of the mealybug solani manihot, and the dsFAR2 (at) ZIF-8 nano complex can be used for preventing and treating the mealybug solani manihot. The death rate of the mealybug solani is remarkably increased, and the reproductive capacity of the mealybug solani is remarkably reduced; and the FAR2 gene plays a role only when the mealybug solani is fed by a plant, so that the FAR2 gene has obvious species specificity. Therefore, the nano-complex of the key gene dsFAR2 (at) ZIF-8 synthesized by the waxiness of the manioc cotton powdered scale for preventing and treating the manioc cotton powdered scale has the advantages of good species specificity, safety, high efficiency and the like, and has a good market application prospect and potential economic and ecological benefits in green prevention and control of the manioc cotton powdered scale; and a new target technology and a new idea can be provided for innovating a mealybug control method.

Description

Technical Field

[0001] The present invention relates to the field, in particular to a dsFAR2@ZIF-8 nanocomposite, a preparation method thereof, and an application thereof in controlling Phenacoccus manihoti Matile-Ferrero. Background Art

[0002] Phenacoccus manihoti Matile-Ferrero Phenacoccus manihoti Matile-Ferrero ), belonging to Hemiptera, Pseudococcidae, Phenacoccus, is one of the four major pests of cassava, often causing a reduction in yield of more than 50%. In severe cases, it can lead to the death of the whole plant and crop failure, and the annual damage loss can reach more than $2 billion. Given the widespread and serious occurrence and damage of Phenacoccus manihoti Matile-Ferrero in the main cassava producing areas such as Hainan, Guangdong, Guangxi, and Yunnan in China, especially the outbreak of Phenacoccus manihoti Matile-Ferrero throughout the growth period, there are very few registered effective chemical agents at present. Seeking a green and efficient way to control Phenacoccus manihoti Matile-Ferrero has become a major problem that urgently needs to be solved in the development of the cassava industry.

[0003] The body surface of scale insects is covered with wax, which has the functions of preventing water loss from the insect body, reducing the penetration of harmful substances such as chemical agents into the insect body, protecting the insect from infection by pathogenic microorganisms and attack by natural enemies, and affecting the behavior of parasitic wasps. Therefore, the body surface wax is an important factor restricting the control effect of scale insects. Breaking the wax barrier of scale insects is the core of effectively controlling scale insects. FAR2 is the most characteristic key gene for wax synthesis in Phenacoccus manihoti Matile-Ferrero identified by us, but there are few reports on its function and application.

[0004] RNAi technology (RNA interference, RNAi) is a phenomenon in which double-stranded RNA (dsRNA) homologous to the target gene is introduced into a living organism to cause gene silencing. Compared with other research methods, it has advantages such as specificity, safety, and high efficiency, and is recognized as a pest control and resistance management method with broad prospects at home and abroad. Mining efficient functional genes and constructing a stable double-stranded RNA (dsRNA) delivery system are of great significance for improving the application potential of RNAi technology.

[0005] If RNAi technology can be combined with nanomaterials, the encapsulation of dsRNA by ZIF-8 nanoparticles may inhibit the expression of the key gene FAR2 for wax synthesis in Phenacoccus manihoti Matile-Ferrero, significantly increase the mortality rate of Phenacoccus manihoti Matile-Ferrero, and significantly reduce the reproductive ability of Phenacoccus manihoti Matile-Ferrero.

[0006] Therefore, there is an urgent need to develop a dsFAR2@ZIF-8 nanocomposite. Summary of the Invention

[0007] To solve the above technical problems, the present invention provides a dsFAR2@ZIF-8 nanocomposite, a preparation method thereof, and an application thereof in the control of Phenacoccus manihoti.

[0008] To achieve the above object, the present invention is implemented according to the following technical solutions: The first technical solution provided by the present invention is a preparation method of a dsFAR2@ZIF-8 nanocomposite, comprising the following steps: S1. According to the gene sequence of the key gene for wax synthesis of Phenacoccus manihoti FAR2 , primers carrying a T7 promoter designed for synthesizing dsRNA are used to synthesize dsFAR2 as described in SEQ ID NO.2; the primers include: ds FAR2 -F: taatacgactcactatagggTGTTCGCCTTACCACTAT; vsFAR2-R: taatacgactcactatagggCGATCATAAATCCCACAG; S2. Dissolve 1 g of Zn(NO 3 ) 2 ·6H 2 O in 10 mL of deionized water, and obtain solution A after magnetic stirring and dissolution; S3. Add 100 mg of dsFAR2 to the above solution A and stir evenly to obtain solution B; S4. Dissolve 13.76 g of 2-methylimidazole in 90 mL of deionized water to obtain solution C; S5. Add solution C to the above solution B, magnetically stir at room temperature for 30 minutes, centrifuge to collect the nanoparticles, and wash with deionized water 3 times to obtain the dsFAR2@ZIF-8 nanocomposite.

[0009] Further, in the step S5, the centrifugal force for centrifuging and collecting the nanoparticles is 10000 g.

[0010] The second technical solution provided by the present invention is a dsFAR2@ZIF-8 nanocomposite prepared by the above method.

[0011] The third technical solution provided by the present invention is an application of a dsFAR2@ZIF-8 nanocomposite in the control of Phenacoccus manihoti. An aqueous solution of dsFAR2@ZIF-8 obtained by dissolving the dsFAR2@ZIF-8 nanocomposite in clear water is sprayed onto the upper and middle leaves of cassava plants.

[0012] Preferably, the concentration of the aqueous solution of dsFAR2@ZIF-8 is 500 ng / mL or 1000 ng / mL.

[0013] The fourth technical solution provided by the present invention is a cassava mealybug control agent, which is composed of an aqueous solution of dsFAR2@ZIF-8 with a concentration of 500 ng / mL or 1000 ng / mL.

[0014] Compared with the prior art, the present invention combines RNAi technology and nanomaterials. The dsFAR2@ZIF-8 nanocomplex prepared by encapsulating dsRNA with ZIF-8 nanoparticles can effectively inhibit the expression of the FAR2 gene, a key gene for wax synthesis in cassava mealybugs, significantly increase the mortality rate of cassava mealybugs, and significantly reduce the reproductive ability of cassava mealybugs. Moreover, the FAR2 gene only plays a role when cassava mealybugs feed on plants, showing obvious species specificity. Therefore, the application of the dsFAR2@ZIF-8 nanocomplex, a key gene for wax synthesis in cassava mealybugs, in controlling cassava mealybugs has advantages such as good species specificity, safety, and high efficiency, and has good market application prospects and potential economic and ecological benefits in the green prevention and control of cassava mealybugs, providing a new target technology and new idea for innovating mealybug control methods. Description of the Drawings

[0015] Figure 1 This is the PCR amplification electrophoresis map of the FAR2 gene, a key gene for wax synthesis in cassava mealybugs of the present invention: M, DNA marker; 1, FAR2.

[0016] Figure 2 This shows the inhibitory effect of aqueous solutions of different concentrations of dsFAR2@ZIF-8 nanocomplexes on the expression of the FAR2 gene, a key gene for wax synthesis in cassava mealybugs.

[0017] Figure 3 This shows the inhibitory effect of aqueous solutions of different concentrations of dsFAR2@ZIF-8 nanocomplexes on the reproductive ability of cassava mealybugs.

[0018] Figure 4 This shows the lethal effect of aqueous solutions of different concentrations of dsFAR2@ZIF-8 nanocomplexes on cassava mealybugs.

[0019] Figure 5 This shows the field control effect of the aqueous solution of 500 ng / mL dsFAR2@ZIF-8 nanocomplex on cassava mealybugs.

[0020] Figure 6Physicochemical property characterization diagrams of ZIF-8 nanoparticles and dsFAR2@ZIF-8 nanocomposites: (A) Scanning electron microscopy image of ZIF-8 nanoparticles; (B) Scanning electron microscopy image of dsFAR2@ZIF-8 nanocomposites; (C) Particle size distribution diagrams of ZIF-8 nanoparticles and dsFAR2@ZIF-8 nanocomposites; (D) Zeta potential of ZIF-8 nanoparticles and dsFAR2@ZIF-8 nanocomposites. Detailed implementation manners

[0021] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0022] Example 1. Synthesis of dsFAR2@ZIF-8 nanocomposites The sequence of the key gene FAR2 for wax synthesis was obtained through de novo transcriptome analysis of Phenacoccus manihoti, and the sequence of FAR2 (see SEQ ID NO.3) is as follows: AATAAATTTTCTTCTTTCGTACGCTCGTGGTGCGAATTAGATACGAAAATGGTATAGAGTTTCCAATTTGTTCGTACTAATAGAGAAATTGTGGAGTAATTTGTTACGATTAGCCGGATCAAGGTAAACATTTACCATCCAATTTAGCCAAACATGGAAGAATCGATCGAGCATTTCTTCGACGGACGTTCGCTGTTCATCACCGGCGGCACCGGGTTTATGGGTAAAGTGCTGATCGAGAAGTTGCTACGCTCGTGCCCGGGTATCGAGAGAATTTACGTACTCGTTAGACCCTCCAGGGAAGGCAAATGCGCCGCAGATAAGCTCAAAGATT TGTTCGCCTTACCACTATACGATCGGCTGAAACGAGAA AAAACCGAGCAGATTTTCAAAAAGGTGTATCCAATCGCCGGCGATATCAGGCAAATCGGTCTCGGCATTTCCGCCG AAGATAGGAAGGTGTTAACGGAAAACGTATCGGTGATATTTCACGCAGCCGCCAGCGTCAGATTCGACGATCCCAT CCACGAGGCTATTATCGTGAATACCCGAGGAACCAGGGAAGTAGTCGCGTTGGCCAAAGAGATCAAGAATATCGCG GTTTTAGTTCATGTATCGACTACATACTGTAATTGCTATCGTAAAGTGGTGGAGGAAAAGATTTATCCTCCGCCGA TGGATTGGAGAGAGGCGATAGCTATGGCGGAGAATTGCGATCCCGTTATCACAAATTTACTATCGAAGAAGTACTT GGGAGAGTTCCCGAATTCTTATGTTTTCACGAAAAATCTCGCGGAACACGTTCTACAGGACGAATGCAAAAATATA CCGGTAGTCATATTCAGACCATCGATAGTAATATCTTCGTTCAAAGAACCGGTACCAGGTTGGATCGATAATTTCA ACGGACCTGTGGGATTTATGATCG

[0023] In the above sequence, the shaded sequence is the CDS sequence of FAR2 (see SEQ ID NO.1), the double-underlined sequence is the dsFAR2 fragment (see SEQ ID NO.2), and the dsFAR2 fragment is part of the CDS.

[0024] Use the primer design website E-RNAi (https: / / www.dkfz.de / signaling / e-rnai3 / idseq.php) to design primers carrying the T7 promoter for synthesizing dsRNA: dsFAR2-F: taatacgactcactatagggTGTTCGCCTTACCACTAT (see SEQ ID NO.4); vsFAR2-R: taatacgactcactatagggCGATCATAAATCCCACAG (see SEQ ID NO.5); Synthesize dsFAR2 as shown in SEQ ID NO.2, and the synthesis process refers to the MEGAscript RNAi Kit instruction manual (Thermo Scientific, Wilmington, DE, USA). (https: / / www.thermofisher.com / cn / zh / home / references / protocols / rnai-epigenetics-and-gene-regulation / rnai-protocol / megascript-rnai-kit.html).

[0025] Dissolve 1 g of Zn(NO 3 ) 2 ·6H 2 O in 10 mL of deionized water, and obtain solution A after magnetic stirring and dissolution; add 100 mg of dsFAR2 to the above solution A and stir evenly to obtain solution B; dissolve 13.76 g of 2-methylimidazole in 90 mL of deionized water to obtain solution C; add solution C to the above solution B and stir magnetically at room temperature for 30 minutes, centrifuge at 10000 g to collect the nanoparticles, and wash with deionized water 3 times to obtain the dsFAR2@ZIF-8 nanocomposite.

[0026] Comparative Example 1: Synthesis of ZIF-8 nanoparticles Dissolve 1 g of Zn(NO 3 ) 2 ·6H 2O was dissolved in 10 mL of deionized water, and after magnetic stirring and dissolution, solution A was obtained; 13.76 g of 2-methylimidazole was dissolved in 90 mL of deionized water to obtain solution C; solution C was added to the above solution A, and magnetic stirring was carried out at room temperature for 30 minutes. Nanoparticles were collected by centrifugation at 10000 g, and ZIF-8 nanoparticles were obtained after washing 3 times with deionized water.

[0027] The physicochemical property characterization diagrams of the prepared ZIF-8 nanoparticles and dsFAR2@ZIF-8 nanocomposites are as Figure 6 shown. As can be seen from Figure 6 (A) in, ZIF-8 is a stable three-dimensional porous network structure with a smooth surface; as can be seen from Figure 6 (C) in, the particle size of ZIF-8 is 317.4 nm; as can be seen from Figure 6 (D) in, the Zeta potential is 22.3 Mv. After loading dsFAR2, as can be seen from Figure 6 (B) in, the surface of dsFAR2@ZIF-8 becomes rough; as can be seen from Figure 6 (C) in, the particle size becomes 367.0 nm; as can be seen from Figure 6 (D) in, the Zeta potential is -24.2 mV.

[0028] Example 2. Control effect of dsFAR2@ZIF-8 nanocomposite on Phenacoccus manihoti Taking water and ZIF-8 as controls, ZIF-8 and dsFAR2@ZIF-8 nanocomposites were dissolved in water and set up 5 concentration gradients of 100 ng / mL, 200 ng / mL, 300 ng / mL, 500 ng / mL, and 1000 ng / mL respectively. Then, female adults of Phenacoccus manihoti with the same developmental stage and size, which were collected from the field cassava variety SC205 plants and reared on indoor potted SC205 cassava plants, were inoculated onto the upper-middle leaves of cassava variety SC205 plants that had been transplanted for 30 days and sprayed with aqueous solutions of different concentrations of ZIF-8 and dsFAR2@ZIF-8 nanocomposites. The number of dead insects and the number of eggs laid per female of Phenacoccus manihoti were observed and counted at 1 d, 2 d, 4 d, and 8 d after insect inoculation respectively, and live insects were collected for the extraction of total RNA of Phenacoccus manihoti, and then qPCR determination and analysis of the expression level of the key gene FAR2 for wax synthesis of Phenacoccus manihoti were carried out. 6 insect-inoculated leaves were used for each plant, 30 mites were inoculated on each leaf, and 3 replicates were set for each concentration treatment.

[0029] The PCR amplification electrophoresis diagram of the key gene FAR2 for wax synthesis of Phenacoccus manihoti is as Figure 1 shown. The inhibitory effects of aqueous solutions of different concentrations of dsFAR2@ZIF-8 nanocomposites on the gene expression of the key gene FAR2 for wax synthesis of Phenacoccus manihoti are asFigure 2 As shown. From Figure 1 and Figure 2 it can be seen that the aqueous solution of ZIF-8 at 500 ng / mL has no effect on the expression of the key gene FAR2 for wax synthesis in Phenacoccus manihoti, and has no lethal effect on Phenacoccus manihoti; the aqueous solutions of 500 ng / mL and 1000 ng / mL dsFAR2@ZIF-8 nanocomposites have the best effects and can significantly inhibit the expression of the key gene FAR2 for wax synthesis in Phenacoccus manihoti.

[0030] The inhibitory effects of aqueous solutions of dsFAR2@ZIF-8 nanocomposites at different concentrations on the fecundity of Phenacoccus manihoti are as shown in Figure 3 as shown, and the lethal effects of aqueous solutions of dsFAR2@ZIF-8 nanocomposites at different concentrations on Phenacoccus manihoti are as shown in Figure 4 as shown, and the field control effects of the aqueous solution of dsFAR2@ZIF-8 nanocomposite on Phenacoccus manihoti are as shown in Figure 5 as shown. From Figure 3 , Figure 4 and Figure 5 it can be seen that spraying the aqueous solution of dsFAR2@ZIF-8 nanocomposite can significantly reduce the fecundity of Phenacoccus manihoti and significantly increase the mortality of Phenacoccus manihoti.

[0031] In summary, the dsFAR2@ZIF-8 nanocomposite has good control effects on Phenacoccus manihoti, provides a direct scientific basis for the wide application of the dsFAR2@ZIF-8 nanocomposite in the control of Phenacoccus manihoti, and provides a new target technology and new idea for innovating the control methods of mealybugs. Therefore, it can be used to prepare pesticides for controlling Phenacoccus manihoti.

[0032] The technical solution of the present invention is not limited to the limitations of the above specific embodiments, and any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.

Claims

1. A method for preparing a dsFAR2@ZIF-8 nanocomposite, characterized in that: The following steps are involved: S1. According to the gene sequence of FAR2, a key gene for wax synthesis in cassava mealybugs, dsFAR2 as described in SEQ ID NO.2 was synthesized using primers carrying T7 promoter designed for synthesizing dsRNA; Primers include: dsFAR2-F:taatacgactcactataggggTGTTCGCCTTACCACTAT; vsFAR2-R:taatacgactcactataggggCGATCATAAATCCCACAG; S2. Dissolve 1 g Zn(NO3)2·6H2O in 10 mL deionized water and stir magnetically to obtain solution A. S3, adding 100 mg of dsFAR2 to the above solution A and stirring evenly to obtain solution B; S4, dissolving 13.76 g of 2-methylimidazole in 90 mL of deionized water to obtain solution C; S5. Solution C was added to the above solution B and magnetically stirred at room temperature for 30 minutes. The nanoparticles were collected by centrifugation and washed with deionized water for three times to obtain the dsFAR2@ZIF-8 nanocomplex.

2. The method for preparing the dsFAR2@ZIF-8 nanocomposite according to claim 1, characterized in that: In step S5, the centrifugal force for collecting nanoparticles is 10000 g.

3. A dsFAR2@ZIF-8 nanocomposite prepared by the method according to claim 1 or 2.

4. Use of the dsFAR2@ZIF-8 nanocomposite as claimed in claim 3 in the control of cassava mealybugs.

5. The use according to claim 4, characterized in that: The dsFAR2@ZIF-8 nanocomposite is dissolved in clean water to obtain an aqueous solution of dsFAR2@ZIF-8, and the aqueous solution of dsFAR2@ZIF-8 is sprayed onto the middle and upper leaves of cassava plants.

6. The use according to claim 5, characterized in that: The concentration of the dsFAR2@ZIF-8 aqueous solution is 500 ng / mL or 1000 ng / mL.

7. A cassava mealybug control agent, characterized in that: It consisted of an aqueous solution of dsFAR2@ZIF-8 at a concentration of 500 ng / mL or 1000 ng / mL.

Images