Aptamer targeting ZBP1, covalent PROTAC derived from aptamer and application of aptamer and covalent PROTAC

Abstract

The invention provides an aptamer targeting ZBP1, covalent PROTAC derived from the aptamer, and application of the aptamer and the covalent PROTAC in preparation of products for targeted degradation of ZBP1 and preparation of drugs for treating infectious inflammation. According to the present invention, the targeting ability of the DNA aptamer, the covalent recognition characteristic of the N-acyl-N-alkyl sulfonamide (NASA), and the ability of the Von Hippel-Lindau (VHL) ligand to recruit the E3 ligase are integrated, such that the covalent recognition and the targeting degradation of the ZBP1 are achieved; according to the covalent PROTAC (C-PROTAC) method, while the treatment effect is improved, the off-target effect is minimized, and the risk of adverse reaction is reduced. The development of stable and efficient C-PROTAC overcomes the problem of non-covalent stability in the existing PROTAC technology. The ZBP1 is directly degraded through C-PROTAC, an effective method is provided for managing inflammatory virus infection in vivo, the potential of improving the treatment effect is achieved, and a foundation is laid for development of next-generation antiviral and anti-inflammatory therapy.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to an aptamer targeting ZBP1 and its derivative covalent PROTAC and applications. Background Art

[0002] The inflammatory response triggered by viral infection is a key defense mechanism of the body against pathogens. However, when this response gets out of control, it may lead to tissue damage and disease progression. Recent studies have identified Z-DNA binding protein 1 (ZBP1) as an important pathogen-sensing protein that plays an important role during viral infection by recognizing Z-DNA or Z-RNA and activating the downstream necroptosis signaling pathway, ultimately triggering a strong inflammatory response. ZBP1 interacts with proteins such as RIPK3 and MLKL, promotes programmed cell death and triggers the release of a large number of pro-inflammatory cytokines. Compared with other proteins involved in the inflammatory response, the activation of ZBP1 acts as an upstream signal switch. The over-activation of ZBP1 can lead to systemic inflammation, necrosis and organ damage. Therefore, inhibiting the activation and function of ZBP1 has become a key strategy for controlling the inflammatory response triggered by viral infection.

[0003] Current strategies for treating these processes mainly focus on inhibiting downstream molecules after ZBP1 activation, such as RIPK3 and MLKL. However, this approach fails to comprehensively address the problems caused by the over-activation of ZBP1 and also fails to fundamentally curb the progression of inflammation and disease. Directly targeting ZBP1 for inhibition shows greater therapeutic potential. As the forefront of the signaling pathway, ZBP1 controls multiple branch pathways, making direct inhibition of ZBP1 a more effective means of regulating the inflammatory response. In addition, intervention targeting ZBP1 can reduce the impact on physiological pathways, thereby reducing potential side effects. In addition, early inhibition of ZBP1 activity can provide protection against the occurrence of inflammation and cell death. However, research on specific inhibitors targeting ZBP1 is still limited, and no widely recognized specific inhibitor has been developed. Therefore, developing highly efficient and specific inhibitors or strategies to induce the degradation of ZBP1 has become a preferred option for controlling the inflammatory response.

[0004] The Proteolysis Targeting Chimeras (PROTAC) technology is an innovative drug discovery method that selectively degrades specific target proteins by harnessing the body's inherent protein degradation mechanisms. A PROTAC molecule consists of three parts: a ligand for the target protein, a ligand for the E3 ubiquitin ligase, and a linker that connects them. This design enables PROTAC to bring the target protein close to the E3 ubiquitin ligase, promoting the ubiquitination of the target protein and its degradation by the proteasome. A significant advantage of the PROTAC method is the ability to design ligands that highly selectively degrade target proteins, thereby reducing side effects. The PROTAC technology even has the potential to target proteins that are traditionally considered "undruggable" or for which there are no existing therapies, such as ZBP1, thus paving the way for new treatment options. However, traditional RPROTAC technology relies on non-covalent interactions to achieve the binding of PROTAC molecules to targets, which often faces problems such as reduced degradation efficacy and an increased risk of non-specific side effects. Recently, reports have shown that covalent PROTACs can form stable and irreversible bonds with target proteins, providing a promising approach to improving the stability and specificity of PROTAC technology. Therefore, the development of covalent PROTAC molecules targeting ZBP1 is crucial for ensuring the efficacy, specificity, and safety of treatment. Summary of the Invention

[0005] In view of this, the present invention has developed a covalent PROTAC targeting a target protein, which realizes the covalent recognition and targeted degradation of the target protein by integrating the targeting ability of DNA aptamers, the covalent recognition characteristics of N-acyl-N-alkylsulfonamides (NASA), and the ability of the E3 ubiquitin ligase ligand to recruit the E3 enzyme. ZBP1 plays an important role in viral infection and inflammatory responses. However, current treatment strategies for ZBP1 are still insufficient. Therefore, the present invention proposes a covalent PROTAC targeting a target protein and its application to solve the problems of poor non-covalent stability, obvious off-target effects, and low degradation efficiency in existing PROTAC technologies.

[0006] To achieve the above object, the technical solution of the present invention is realized as follows:

[0007] The first aspect of the present invention provides a covalent PROTAC compound, comprising a ligand for the E3 ubiquitin ligase, an aptamer targeting the target protein, and a linker containing an N-acyl-N-alkylsulfonamide group (NASA) that connects the ligand for the E3 ubiquitin ligase and the aptamer targeting the target protein;

[0008] Preferably, the ligand for the E3 ubiquitin ligase is a Von Hippel-Lindau (VHL) ligand;

[0009] Preferably, the aptamer targeting the target protein is a DNA aptamer;

[0010] Preferably, the target protein is ZBP1.

[0011] Furthermore, the aptamer targeting ZBP1 is Z1 aptamer, Z2 aptamer, Z3 aptamer, Z4 aptamer or Z5 aptamer. The nucleic acid sequence of Z1 aptamer is shown as SEQ ID No.1, the nucleic acid sequence of Z2 aptamer is shown as SEQ ID No.2, the nucleic acid sequence of Z3 aptamer is shown as SEQ ID No.3, the nucleic acid sequence of Z4 aptamer is shown as SEQ ID No.4, and the nucleic acid sequence of Z5 aptamer is shown as SEQ ID No.5.

[0012] Nucleic acid sequence of Z1 aptamer

[0013] TTCAGCACTCCACGCATAGCCCGCCCCCCCGAACTGCCATCCGAGTCGCGCCGCTGTCCTATGCGTGCTACCGTGAA (SEQ ID No.1).

[0014] Nucleic acid sequence of Z2 aptamer

[0015] TTCAGCACTCCACGCATAGCCCGGCACACACCAACACACCATCGTATCGCGCGTGTCCCTATGCGTGCTACCGTGAA (SEQ ID No.2).

[0016] Nucleic acid sequence of Z3 aptamer

[0017] TTCAGCACTCCACGCATAGCCCGCCACCACCCAACCCTGCTCGTTCGTCTGCGCTCCCTATGCGTGCTACCGTGAA (SEQ ID No.3).

[0018] Nucleic acid sequence of Z4 aptamer

[0019] TTCAGCACTCCACGCATAGCCCGCCACCCCGACGACACCCCGGCTCCGGACCGCATCCTATGCGTGCTACCGTGAA (SEQ ID No.4).

[0020] Nucleic acid sequence of Z5 aptamer

[0021] TTCAGCACTCCACGCATAGCCCGGCCACCAACTCCGGCAGTTTTGGTCCGTGTCGCCCTATGCGTGCTACCGTGAA (SEQ ID No.5).

[0022] Further, the aptamer targeting ZBP1 is the Z3 aptamer. Further, the structural formula of the covalent PROTAC compound is shown in Formula I:

[0023]

[0024] The second aspect of the present invention provides a preparation method of the covalent PROTAC compound according to the first aspect of the present invention, comprising the following steps:

[0025] S1: 4-Vinylbenzenesulfonamide reacts with dibenzocyclooctene to form compound 1b;

[0026] S2: Compound 1b reacts with iodoacetonitrile to generate compound 1c;

[0027] S3: Compound 1c reacts with (S,R,S)-AHPC-PEGs-N 3 to generate compound 1e;

[0028] S4: Compound 1e is coupled with the aptamer to obtain the coupled aptamer-1e product.

[0029] The third aspect of the present invention provides an aptamer targeting ZBP1. The aptamer targeting ZBP1 is the Z3 aptamer, and the nucleic acid sequence of the Z3 aptamer is shown in SEQ ID No.3.

[0030] Nucleic acid sequence of the Z3 aptamer

[0031] TTCAGCACTCCACGCATAGCCCGCCACCACCCAACCCTGCTCGTTCGTCTGCGCTCCCTATGCGTGCTACCGTGAA (SEQ ID No.3).

[0032] The fourth aspect of the present invention provides a pharmaceutical composition, which comprises an effective therapeutically amount of the covalent PROTAC compound according to the first aspect of the present invention, or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

[0033] The fifth aspect of the present invention provides the application of the covalent PROTAC compound according to the first aspect of the present invention, the aptamer targeting ZBP1 according to the third aspect of the present invention, or the pharmaceutical composition according to the fourth aspect of the present invention in the preparation of products for targeted degradation of ZBP1.

[0034] The sixth aspect of the present invention provides the application of the covalent PROTAC compound according to the first aspect of the present invention, the aptamer targeting ZBP1 according to the third aspect of the present invention, or the pharmaceutical composition according to the fourth aspect of the present invention in the preparation of drugs for treating infectious inflammation.

[0035] Furthermore, the infectious inflammation includes respiratory infectious inflammation, digestive tract infectious inflammation, urogenital tract infectious inflammation, or skin and soft tissue infectious inflammation;

[0036] Preferably, the infectious inflammation includes acute tonsillitis, bronchitis, acute gastroenteritis, cholecystitis, urethritis, pyelonephritis, furuncle, or carbuncle.

[0037] Compared with the prior art, the aptamer targeting ZBP1, its derived covalent PROTAC, and the application thereof according to the present invention have the following advantages:

[0038] By integrating the targeting ability of DNA aptamers, the covalent recognition property of N-acyl-N-alkylsulfonamide (NASA), and the ability of Von Hippel-Lindau (VHL) ligands to recruit E3 enzymes, the present invention achieves covalent recognition and targeted degradation of target proteins. This covalent PROTAC (C-PROTAC) method minimizes off-target effects, reduces the risk of adverse reactions, and maintains the function of non-pathological pathways while improving the therapeutic effect. The development of stable and efficient C-PROTACs overcomes the problem of non-covalent stability in current PROTAC technologies. Directly degrading target proteins through C-PROTAC provides an effective method for in vivo management of inflammatory viral infections, has the potential to improve therapeutic effects, and lays the foundation for the development of the next generation of antiviral and anti-inflammatory therapies.

[0039] In addition, an aptamer targeting ZBP1 has also been developed. The aptamer specifically binds to ZBP1, while the NASA-containing linker promotes the formation of covalent bonds between PROTAC and the target protein. Subsequently, the E3 enzyme recruitment unit guides the ubiquitin-proteasome system to degrade the ZBP1-PROTAC complex. This method combines the high specificity of DNA aptamers, the high efficiency of covalent binding, and the degradation-inducing ability of PROTAC, providing a powerful tool for targeted protein degradation. The successful application of this technology to the degradation of ZBP1 highlights its potential in selectively removing disease-related proteins and developing new therapeutic strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0041] Figure 1Structural and binding analysis of the ZBP1-aptamer interaction revealed the high affinity and specificity of the aptamer Z3; among them, 1a is a schematic diagram of the ZBP1 protein structure, and five aptamers (Z1-Z5) targeting the Zα domain were screened by SELEX; 1b is the SPR binding curve of the five aptamers (Z1-Z5) to ZBP1; 1c is the predicted secondary structure of the Z3 aptamer; 1d is a schematic diagram of the Z-DNA structure; 1e is SPR analysis showing the binding affinity of Z3 (KD = 2.71 nM) to ZBP1 and comparison with Z-DNA (KD = 47.35 nM); 1f is the Gibbs energy landscape from molecular dynamics simulations, showing the stable conformational state when Z3 binds to ZBP1, Rg represents the radius of gyration, and RMSD represents the root mean square deviation; 1g is a close-up view of the hydrogen bond interaction between ZBP1 and Z-DNA; 1h is a close-up view of the hydrogen bond interaction between ZBP1 and Z3; 1i is the hydrogen bond analysis of the Z3-ZBP1 and Z-DNA-ZBP1 complexes over time; 1j is the comparison of the binding energies of the Z3-ZBP1 and Z-DNA-ZBP1 complexes; 1k is the residue cross-correlation analysis, showing significant dynamic interactions between the Zα domain (residues 1-64) of ZBP1 and Z3 (residues 65-140).

[0042] Figure 2 Characterization and functionality of aptamer-based C-PROTAC in ZBP1 degradation; among them, 2a is a schematic diagram of the C-PROTAC and PROTAC molecules, which are composed of an aptamer, NASA (for covalent binding), and an E3 ligase recruitment module (ligand of the VonHippel-Lindau (VHL) protein) respectively; 2b is PAGE analysis to confirm the successful construction of C-PROTAC; 2c is UV absorption spectroscopy to verify the successful construction of C-PROTAC; 2d is PAGE analysis to verify the successful synthesis of PROTAC; 2e is UV absorption spectroscopy to verify the successful construction of PROTAC; 2f is Western blot showing the expression of ZBP1 in cells treated with different concentrations of CBL0137; 2g is Western blot comparing the effects of traditional PROTAC and C-PROTAC on ZBP1 degradation; 2h is quantitative analysis of CBL0137-induced ZBP1 expression; 2i is the statistical comparison of the ZBP1 degradation efficiency between PROTAC and C-PROTAC, and the data are expressed as mean ± standard deviation (n = 3), ns (not significant) = p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.

[0043] Figure 3To verify C-PROTAC-mediated ZBP1 degradation and its effect on the downstream necroptosis pathway; among them, 3a shows the effect of different modules in C-PROTAC on ZBP1 degradation ability by Western blot analysis, and the concentrations of the aptamer, C-PROTAC, and NASA-VHL ligand are all 100 nM; 3b shows the time-dependent degradation of ZBP1 by C-PROTAC (100 nM) within 48 hours; 3c-d show the expression levels of ZBP1 under treatment with different concentrations of C-PROTAC and PROTAC by Western blot analysis; 3e shows the quantitative analysis of the Western blot results in 3a; 3f shows the quantitative analysis of ZBP1 degradation over time, with a half-life (t1 / 2) of 17.03 hours (n = 3); 3g shows the dose-response curve showing ZBP1 degradation, with a DC50 value of 25.69 nM for C-PROTAC, lower than 81.52 nM for PROTAC (n = 3); 3h shows the quantitative analysis of the confocal images in 3j; 3i shows the effect of C-PROTAC at different concentrations on downstream necroptosis pathway proteins (MLKL, pMLKL, RIPK3, pRIPK3, and Caspase-8) by Western blot analysis; 3j shows the immunofluorescence staining of ZBP1 in different treatment groups, showing the degradation of ZBP1 by C-PROTAC (100 nM) and its effect under inhibition by MG132 (10 μM), scale bar: 10 μm (n = 50 cells per group), ns (not significant) = p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.

[0044] Figure 4To verify the ability of C-PROTAC to degrade ZBP1 and alleviate virus-induced inflammation in vitro; among them, 4a shows by immunofluorescence staining that compared with the control group and other treatment groups, C-PROTAC can effectively reduce the level of ZBP1 in virus-infected cells; 4b shows by live / dead cell staining that the cell survival rate in the C-PROTAC treatment group is higher than that in the virus-infected group and the PROTAC treatment group; 4c is the quantitative analysis of the confocal images in 4a, scale bar: 10 μm (n = 50 cells per group); 4d is the quantitative analysis of the confocal images in 4b, scale bar: 100 μm (n = 50 cells per group); 4e shows by CCK-8 assay that C-PROTAC can more effectively restore cell viability after virus infection than PROTAC (n = 3); 4f shows by qRT-PCR analysis that C-PROTAC reduces the levels of pro-inflammatory cytokines (IL-18, IL-1β, IL-6, TNF-α, IFN-β) in virus-infected cells (n = 3). The concentrations of the aptamer, C-PROTAC, PROTAC, and NASA-VHL ligand are all 100 nM. ns (not significant) = p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.

[0045] Figure 5 To evaluate the anti-inflammatory effect of C-PROTAC in vivo; among them, 5a is a schematic diagram of the experimental timeline showing the process of virus infection and C-PROTAC treatment; 5b is the survival rate of mice in different groups (n = 5); 5c is the change in body weight of mice in different groups (n = 5); 5d is the ratio of wet weight to dry weight of the lungs of mice in different groups (n = 5); 5e is the measurement of lung index (n = 5); 5f is a representative image of the lungs of mice showing the inflammation level in each group; 5g is the qRT-PCR analysis of pro-inflammatory cytokines (IL-18, IL-1β, IL-6, TNF-α, IFN-β) in mouse lung tissues; 5h is the HE staining of lung tissues showing the infiltration of inflammatory cells; 5i is the TUNEL staining of lung tissues for detecting apoptosis. TUNEL staining (green) is used to detect dead cells, and Hoechst 33342 (blue) staining is used to label cell nuclei; 5j is the quantitative analysis of the alveolar air spaces in 5h, scale bar: 100 μm; 5k is the quantitative analysis of the images in 5i, scale bar: 100 μm. ns (not significant) = p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.

[0046] Figure 6To analyze the binding characteristics between the aptamer and ZBP1, the structure and binding stability of Z3 were highlighted; among them, 6a shows the secondary structures of the predicted 5 aptamers (Z1-Z5), indicating their different hairpin formations; 6b-c are the SPR binding reaction curves of the interaction between different concentrations of Z3 and Z-DNA with ZBP1; 6d is the binding energy decomposition analysis showing that the Z3-ZBP1 interaction is mainly driven by hydrogen bonds, consistent with the early dynamic hydrogen bond analysis; 6e is the RMSD graph comparing the molecular dynamics simulations of the Z3-ZBP1 and Z-DNA-ZBP1 complexes; 6f is the RMSF analysis showing that the flexibility of ZBP1 residues decreases when binding to Z3 compared to Z-DNA.

[0047] Figure 7 1H NMR, 13C NMR, and high-resolution mass spectrometry spectra of compound 1b.

[0048] Figure 8 1H NMR, 13C NMR, and high-resolution mass spectrometry spectra of compound 1c.

[0049] Figure 9 1H NMR, 13C NMR, and high-resolution mass spectrometry spectra of compound 1e.

[0050] Figure 10 1H NMR, 13C NMR, and high-resolution mass spectrometry spectra of compound 2a.

[0051] Figure 11Supporting data for the effects of C-PROTAC on cell viability and downstream necroptosis proteins. Among them, 11a shows the time-dependent degradation of ZBP1 after CBL0137 induction by Western blot analysis; 11b is the quantitative analysis of the Western blot results shown in 11a; 11c is the mutagenesis of nucleophilic amino acids in the Zα domain of ZBP1, replacing lysine (K), arginine (R), and glutamine (Q) with aspartic acid (D) or alanine (A), while retaining the key binding residues with the aptamer; 11d is the in vitro labeling of wild-type and mutant Zα domains with Z3-NASA-Cy5 (simulating C-PROTAC) and Z3-Cy5 (simulating PROTAC) to compare the fluorescence intensities. (Left) Schematic diagram of the fluorescence change principle. (Right) Fluorescence intensities of wild-type and mutant ZBP1 labeled with Z3-NASA-Cy5 and Z3-Cy5; 11e shows that cell viability assays indicate that C-PROTAC has no significant cytotoxicity in the concentration range of 0 - 400 nM; 11f-g are the quantitative analysis of Western blot results as shown in 3i: pMLKL (11f), pRIPK3 (11g). Data are presented as mean ± SD, n = 3. NS (non-significant) = p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.

[0052] Figure 12 Preparation and characterization of C-PROTAC-loaded liposomes. Among them, 12a shows the change of Zeta potential with the ratio of nanoliposomes to C-PROTAC (molar ratio) to determine the optimal encapsulation conditions (n = 3); 12b shows the size change of nanoliposomes after loading C-PROTAC (n = 3); 12c is the stability test of nanoliposomes within 72 hours, showing consistent size (n = 3); 12d is to verify the cellular uptake of the fluorescently labeled aptamer; 12e is the quantitative analysis of the fluorescence results shown in 12d; 12f is the flow cytometry analysis of cells incubated with NLP@C-PROTAC Z3-Cy5; 12g shows that the fluorescence tracing results indicate that DiD-labeled NLP@C-PROTAC remains in the lungs for up to 24 hours after administration.

[0053] Figure 13 To evaluate the effects of C-PROTAC on major organs, HE staining of the heart, liver, spleen, and kidneys showed no obvious toxicity or adverse reactions after NLP@C-PROTAC treatment. Scale bar: 100 μm.

[0054] Figure 14Schematic diagram of C-PROTAC design and its effect on ZBP1 signaling during virus infection; among them, 14a is a schematic diagram of C-PROTAC covalently recognizing ZBP1, resulting in the degradation of the E3 ligase. The NASA group in C-PROTAC can react with the Nu (nucleophilic group) of ZBP1 to form a covalent bond between the E3 ligand and ZBP1; 14b is a schematic diagram of C-PROTAC degrading ZBP1 and inhibiting necroptosis caused by virus infection. By degrading ZBP1 with C-PROTAC, the activation of ZBP1 is inhibited, preventing necroptosis (through MLKL phosphorylation) and apoptosis (through Caspase-8 activation), and ultimately reducing tissue damage. Detailed implementation mode

[0055] The present invention develops a covalent PROTAC targeting a target protein. By integrating the targeting ability of DNA aptamers, the covalent recognition characteristics of N-acyl-N-alkylsulfonamides (NASA), and the ability of E3 ubiquitin ligase ligands to recruit E3 enzymes, covalent recognition and targeted degradation of the target protein are achieved. ZBP1 plays an important role in virus infection and inflammatory responses. However, current therapeutic strategies targeting ZBP1 are still insufficient. Therefore, the present invention proposes a covalent PROTAC targeting a target protein and its application to solve problems such as poor non-covalent stability, obvious off-target effects, and low degradation efficiency in existing PROTAC technologies.

[0056] In the following examples, the experiment of the Z3 aptamer is taken as an example. In addition to the Z3 aptamer, the present invention has also conducted related experiments on other aptamers targeting other target proteins through N-acyl-N-alkylsulfonamides (NASA) (not shown).

[0057] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other.

[0058] The present invention will be described in detail below with reference to the drawings and in combination with the embodiments.

[0059] Example 1, Recognition module selectively targeting ZBP1

[0060] The Zα domain of ZBP1 can bind to the Z-DNA conformation and plays a key role in immune responses, viral infection responses, and cell signaling. Due to the specific role of the Zα domain in recognizing Z-DNA or Z-RNA, these molecules are crucial in viral infections and inflammation. Therefore, we selected this domain as the target for aptamer screening. Compared with targeting the full-length ZBP1 protein, targeting the Zα domain can provide higher specificity and reduce off-target effects. To improve the specificity and efficiency of screening, we used the Zα domain of ZBP1 to screen for nucleic acid aptamers with the goal of obtaining aptamers with high affinity and specificity. We employed the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique and started with a library containing 10 14 random DNA sequences. After multiple rounds of screening and enrichment, we finally obtained five potential aptamers ( Figure 1 a, 6a). To further verify the affinity of these aptamers, we analyzed their binding ability to ZBP1 using surface plasmon resonance (SPR) technology ( Figure 1 b). The SPR results showed that aptamer Z3 exhibited the most excellent binding affinity and was thus selected as the final aptamer. The secondary structure of aptamer Z3 is shown in Figure 1 c, demonstrating a stable binding conformation. To quantitatively evaluate the binding strength between Z3 and ZBP1, we measured its dissociation constant (KD) using SPR. The KD for the binding of Z3 to ZBP1 was 2.71 nM ( Figure 1 e and 6b), while the KD for classical Z-DNA was 47.35 nM ( Figure 1 e and 6c), indicating that the affinity of Z3 for ZBP1 is approximately 20 times that of classical Z-DNA, highlighting the high specificity and excellent binding ability of Z3 in recognizing ZBP1. These results verified the effectiveness of aptamer screening by targeting the Zα domain.

[0061] To further elucidate the binding mechanism between aptamer Z3 and the ZBP1 protein, we performed molecular dynamics simulations. First, analysis of the free energy landscape of the Z3-ZBP1 complex ( Figure 1 f) revealed a significant minimum energy distribution, indicating that Z3 adopts a low-energy, stable conformation when binding to ZBP1, thermodynamically confirming their high binding affinity. Subsequently, we compared the hydrogen bond patterns in the Z3-ZBP1 complex and the Z-DNA-ZBP1 complex ( Figure 1 g, 1h). Over time, Z3 formed a more extensive and evenly distributed hydrogen bond network with ZBP1 ( Figure 1 i), providing a structural basis for its strong binding. The simulated RMSD analysis further supported these findings ( Figure 6e) The RMSD value of the Z3-ZBP1 complex remained low and stable, indicating its highly stable conformation. In contrast, the Z-DNA-ZBP1 complex showed higher RMSD values and fluctuations, indicating poor binding stability.

[0062] To quantitatively evaluate the binding strength of Z3 and Z-DNA to ZBP1, we calculated that the binding energy of the Z3-ZBP1 complex was significantly lower than that of the Z-DNA-ZBP1 complex ( Figure 1 j), indicating higher stability. Dynamic cross-correlation matrix analysis showed a strong correlation between ZBP1 Zα and Z3 ( Figure 1 k), indicating that these long-range interactions further enhanced the stability of the complex. RMSF analysis ( Figure 6 f) showed that the binding of Z3 significantly reduced the flexibility of the key residues of ZBP1, providing additional evidence of stability. Binding energy decomposition ( Figure 6 d) revealed that the interaction between Z3-ZBP1 was mainly driven by hydrogen bonds, which was consistent with the previous analysis results. In summary, both experimental and computational studies confirmed that the aptamer Z3 has higher affinity and specificity for ZBP1 than Z-DNA, forms a stable hydrogen bond network, and reduces the flexibility of key residues. These findings deepen our understanding of the aptamer-protein recognition mechanism, provide a theoretical basis for developing aptamers specifically targeting ZBP1, and offer new ideas for biological research.

[0063] Example 2: Construction of C-PROTAC molecules targeting the degradation of ZBP1

[0064] As a component of the E3 ubiquitin ligase, the VHL protein is responsible for attaching ubiquitin molecules to HIF-1α, thereby promoting its degradation in the proteasome. Therefore, we selected the VHL ligand as the unit for recruiting the E3 enzyme in the C-PROTAC system. We synthesized a VHL ligand containing an N-acyl-N-alkylsulfonamide (NASA) group and conjugated it with the Z3 aptamer to assemble a complete C-PROTAC molecule (molecular weight approximately 24.3 kDa). The synthesis of C-PROTAC followed a four-step process. First, 4-vinylbenzenesulfonamide reacted with dibenzocyclooctene to form an amide bond. This amide then reacted with iodoacetonitrile to generate NASA. Next, the alkyne group on dibenzocyclooctene was connected to the azide group on the VHL ligand using the azide-alkyne cycloaddition reaction in click chemistry. The final step was a thiol-ene reaction between the thiol group on the Z3 aptamer and the vinyl group on 4-vinylbenzenesulfonamide.

[0065] The specific synthesis steps of C-PROTAC are as follows:

[0066] Synthesis of 1b: 4-Vinylbenzenesulfonamide (175 mg, 0.96 mmol) was dissolved in anhydrous N,N-dimethylformamide (DMF, 6 mL). After stirring evenly, dibenzocyclooctene acid (350 mg, 1.05 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (366 mg, 1.91 mmol), 4-dimethylaminopyridine (DMAP) (35 mg, 0.29 mmol) and N,N-diisopropylethylamine (DIEA) (500 μL, 2.87 mmol) were added. The mixture was stirred overnight at room temperature. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (CHCl 2 :MeOH = 25:1) to obtain compound 1b. 1 1H NMR (400 MHz, chloroform-d) δ: 9.44 (s, 1H), 7.71 (d, J = 8.4 Hz, 2H), 7.49 (d, J = 7.3 Hz, 1H), 7.24 (s, 2H), 7.16 (d, J = 4.6 Hz, 2H), 7.09 (d, J = 1.5 Hz, 1H), 7.09 - 7.03 (m, 2H), 7.02 (dt, J = 7.4, 4.4 Hz, 2H), 6.49 (dd, J = 17.6, 10.9 Hz, 1H), 5.63 (d, J = 17.6 Hz, 1H), 5.19 (d, J = 10.9 Hz, 1H), 5.01 (d, J = 32.8 Hz, 1H), 4.95 (d, J = 13.8 Hz, 1H), 3.45 (d, J = 13.8 Hz, 1H), 1.99 (dd, J = 10.0, 5.8 Hz, 1H), 1.68 - 1.52 (m, 2H), 1.52 - 1.40 (m, 1H), 0.90 - 0.82 (m, 1H), 0.61 (dd, J = 12.8, 6.8 Hz, 1H). 13 13C NMR (125 MHz, CDCl 3 ) δ: 173.85, 171.33, 151.40, 147.83, 142.68, 137.97, 135.42, 132.61, 129.01, 128.67, 128.43, 127.96, 127.22, 126.44, 125.55, 122.98, 122.45, 117.83, 115.01, 107.88, 55.57, 35.41, 34.50, 23.96. Mass spectrum (MALDI-TOF, m / z): C29H26N2O4S+[H]+, theoretical value 498.1613, measured value 499.16796.

[0067] Synthesis of 1c: Compound 1b (39 mg, 72.54 μmol) was dissolved in anhydrous DMF (1 mL). After stirring, iodoacetonitrile (85 μL, 1.17 mmol) and DIEA (40 μL, 234 μmol) were added. The mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (CHCl 2 :MeOH = 25:1) to obtain compound 1c. 1 1H NMR (400 MHz, chloroform-d) δ: 7.83 (d, J = 8.4 Hz, 2H), 7.58 (d, J = 6.9 Hz, 1H), 7.37 (d, J = 8.4 Hz, 2H), 7.32 - 7.21 (m, 3H), 7.22 - 7.06 (m, 4H), 6.61 (dd, J = 17.6, 10.9 Hz, 1H), 5.75 (d, J = 17.6 Hz, 1H), 5.30 (d, J = 10.9 Hz, 1H), 5.06 (d, J = 13.9 Hz, 1H), 3.55 (d, J = 13.9 Hz, 1H), 2.16 - 2.02 (m, 1H), 1.84 - 1.53 (m, 3H), 1.17 (dq, J = 14.6, 7.4 Hz, 3H), 1.00 (dt, J = 13.7, 6.6 Hz, 1H). 13 13C NMR (125 MHz, CDCl 3 ) δ: 172.84, 170.04, 150.31, 146.66, 141.65, 136.87, 134.37, 131.64, 127.93, 127.64, 127.51, 127.36, 126.94, 126.18, 125.36, 124.47, 121.89, 121.40, 113.97, 106.80, 54.52, 34.32, 33.41, 28.68, 22.97, 22.61. Mass spectrum (MALDI-TOF, m / z): C31H27N3O4S+[H]+, theoretical value 537.1722, measured value 538.17849.

[0068] Synthesis of 1e: Compound 1c (55 mg, 102.30 μmol) was dissolved in anhydrous DMF (1 mL). After stirring, (S,R,S)-AHPC-PEGs-N 3 (76 mg, 120.39 μmol) was added. The mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (CHCl 2 :MeOH = 25:1) to obtain compound 1e. 1 1H NMR (400 MHz, DMSO-d 6)δ: 8.96 (s, 1H), 8.60 (s, 1H), 7.95 (dd, J = 22.0, 11.0 Hz, 3H), 7.89 - 7.40 (m, 12H), 6.85 (t, J = 14.3 Hz, 1H), 4.87 (s, 1H), 4.43 (d, J = 18.2 Hz, 3H), 4.36 (s, 2H), 4.31 - 4.20 (m, 2H), 4.16 - 3.84 (m, 4H), 3.74 (s, 1H), 3.55 (dd, J = 65.2, 25.1 Hz, 10H), 3.45 - 3.40 (m, 2H), 2.17 - 1.80 (m, 4H), 1.76 - 1.42 (m, 2H), 1.23 (s, 3H), 0.92 (s, 9H). 13 C NMR (150 MHz, DMSO-d 6 )δ: 171.13, 168.48, 167.94, 150.80, 147.09, 142.46, 138.77, 135.94, 134.31, 130.49, 129.04, 128.74, 128.23, 128.03, 127.51, 126.81, 126.47, 118.60, 115.71, 69.71, 69.22, 69.03, 68.88, 68.22, 58.09, 55.92, 55.03, 54.10, 50.15, 47.83, 41.02, 37.26, 35.04, 33.17, 28.37, 25.49. Mass spectrometry (MALDI-TOF, m / z): C61H72N10O10S2+[H]+, theoretical value 1168.4874, measured value 1169.4882.

[0069]

[0070] Conjugation of 1e with the aptamer: Compound 1e (11.69 mg, 10 μmol) was dissolved in DMSO (500 μL). The thiol-modified aptamer (230 μg, 10 nmol) was dissolved in PBS (500 μL). Azobisisobutyronitrile (AIBN) (1.64 mg, 10 μmol) was dissolved in DMSO and added to the 1e solution. Then the aptamer solution was carefully mixed with the 1e-AIBN solution. The mixture was heated at 68 °C with continuous stirring overnight. After the reaction was completed, it was cooled to room temperature. Purification was carried out through a NAP-5 desalting column and eluted with water to obtain the conjugated aptamer-1e product.

[0071]

[0072] The success of the conjugation reaction was characterized by PAGE and UV-Vis spectroscopy.

[0073] The detailed steps for the synthesis of other PROTACs (with a molecular weight of approximately 24.0 kDa) are as follows:

[0074] Synthesis of compound 2a: Dissolve dibenzocyclooctene acid (35 mg, 104.98 μmol) in anhydrous DMF (1 mL), stir evenly, and then add (S,R,S)-AHPC-PEGs-N 3 (76 mg, 120.39 μmol). Stir the mixture overnight at room temperature. After the reaction is complete, remove the solvent and purify it under reduced pressure. Use silica gel column chromatography (CHCl 2 :MeOH = 25:1) for separation and purification to obtain compound 2a. 1 1H NMR (400 MHz, chloroform-d) δ: 11.93 (s, 1H), 8.97 (s, 1H), 8.60 (s, 1H), 7.84 (d, J = 7.5 Hz, 1H), 7.70 - 7.60 (m, 1H), 7.48 - 7.25 (m, 12H), 5.16 (s, 1H), 4.57 (t, J = 14.8 Hz, 2H), 4.45 (dd, J = 18.0, 12.7 Hz, 2H), 4.07 - 3.70 (m, 4H), 3.66 (d, J = 10.1 Hz, 1H), 3.65 - 3.42 (m, 10H), 3.45 (d, J = 9.3 Hz, 3H), 2.41 (d, J = 25.1 Hz, 4H), 2.21 - 1.93 (m, 5H), 1.71 (ddd, J = 58.6, 15.4, 7.7 Hz, 2H), 1.51 - 1.24 (m, 4H), 0.92 (s, 9H). 13 13C NMR (150 MHz, DMSO-d6) δ 173.59, 171.14, 168.49, 167.96, 150.82, 147.10, 142.96, 141.66, 139.65, 138.79, 135.04, 133.39, 131.76, 130.50, 130.32, 130.01, 129.58, 129.12, 128.05, 126.82, 126.18, 69.75, 69.24, 68.97, 68.23, 37.26, 35.05, 33.13, 32.70, 28.37, 23.68, 23.13, 15.26. MS (MALDI-TOF, m / z): Calculated value for C51H64N8O9S+[H]+ is 964.4517, measured value is 965.4522.

[0075]

[0076] Conjugation of 2a with the aptamer: Compound 2a (9.65 mg, 10 μmol) was dissolved in PBS (500 μL). The amino-modified aptamer (230 μg, 10 nmol) was dissolved in PBS (500 μL). EDC (1.18 mg, 10 μmol) was added to the 2a solution to activate the carboxyl group. Then the aptamer solution was carefully mixed with the 2a and EDC solutions. The mixture was stirred at room temperature for 2 - 4 hours to promote the conjugation reaction. After the reaction was completed, the product was purified using a NAP-5 desalting column and eluted with water to obtain the conjugated aptamer-2a product. Successful conjugation was characterized using PAGE and UV-visible spectroscopy.

[0077] All PROTAC molecules were comprehensively characterized by nuclear magnetic resonance (NMR) and high-resolution mass spectrometry (HRMS). The relevant data are shown in Figures 7 - 10 .

[0078] Next, we verified the successful synthesis of C-PROTAC using 10% polyacrylamide gel electrophoresis (PAGE) and ultraviolet spectroscopy. The PAGE results showed that after the conjugation of the aptamer with the NASA-VHL ligand, there was a significant change in the migration rate, and the ultraviolet absorption spectrum also changed, further confirming the success of the conjugation ( Figure 2 b and 2c). As a control, we also synthesized a traditional PROTAC molecule without NASA and confirmed its successful synthesis using similar characterization methods ( Figure 2 d and 2e).

[0079] After successfully constructing C-PROTAC and traditional PROTAC, we conducted preliminary functional verification experiments to evaluate their ability to degrade ZBP1. Previous studies have shown that CBL0137 (an Hsp90 inhibitor that can affect the stability and function of multiple proteins, including key signaling proteins such as ZBP1) increases the expression of ZBP1 by inducing an inflammatory response. Therefore, we utilized the increase in ZBP1 levels induced by CBL0137 to evaluate the degradation ability of C-PROTAC and traditional PROTAC. To determine the optimal conditions for inducing ZBP1 expression, we optimized the concentration of CBL0137 and the induction time ( Figure 2 f and Figure 11 a). The results showed that 10 μM CBL0137 could effectively upregulate ZBP1 expression, and the level of ZBP1 gradually increased with the prolongation of the induction time. Finally, we selected 10 μM CBL0137 induced for 2 hours as the treatment condition for subsequent experiments.

[0080] Next, we evaluated the performance of C-PROTAC and traditional PROTAC in targeting the degradation of ZBP1 by Western Blot (WB) analysis (Figure 2 g and 2i). Both C-PROTAC (100 nM) and traditional PROTAC (100 nM) were able to effectively reduce the level of ZBP1 protein. However, C-PROTAC demonstrated significantly superior degradation ability, reducing the level of ZBP1 protein by at least more than 3-fold compared to traditional PROTAC. This enhanced effect was attributed to the stable and tighter covalent interaction formed between the NASA reagent and ZBP1, while traditional PROTAC relied on non-covalent recognition properties. To further verify the covalent binding site, we conducted mutagenesis experiments on the amino acids with free amino groups on ZBP1 (such as K, R, and Q, excluding the aptamer binding site), and confirmed that these sites were crucial for the covalent interaction with the NASA reagent ( Figure 11 c and 11d). These free amino groups are nucleophilic and can undergo covalent reactions with the electrophilic NASA reagent, thus achieving stable covalent binding. In contrast, the mutation of these sites led to a significant decrease in the fluorescence of C-PROTAC, while the fluorescence change in the traditional PROTAC group was smaller, indicating that covalent interaction is crucial for the efficiency of C-PROTAC, while traditional PROTAC relies on non-covalent binding.

[0081] Compared with traditional PROTAC, C-PROTAC provides a more stable and efficient protein degradation process through covalent binding. The covalent bond enhances the interaction between the E3 ligase and ZBP1, improves the degradation efficiency, and reduces off-target effects. However, covalent binding may lead to irreversible interactions with off-target proteins, thus posing a potential risk of off-target effects. Therefore, the design of C-PROTAC must be cautious to avoid unwanted binding to off-target proteins. Nevertheless, compared with traditional PROTAC, which faces challenges of poor stability and low affinity, C-PROTAC demonstrates significant advantages in improving specificity and reducing side effects.

[0082] In addition, the cytotoxicity experiment showed that C-PROTAC had no adverse effect on cell viability in the concentration range of 0 - 400 nM ( Figure 11 e), indicating its good biocompatibility and suitability for further functional studies. These results highlight that C-PROTAC can not only effectively degrade CBL0137-induced ZBP1, but also outperform traditional PROTAC, emphasizing its unique advantages in targeted protein degradation.

[0083] Example 3. Verification of the ability of C-PROTAC to degrade ZBP1 and inhibit downstream pathways

[0084] Furthermore, by studying the effects of different modules in C-PROTAC on the degradation ability of ZBP1, we confirmed that the degradation of ZBP1 is indeed the result of the synergistic action of each module in C-PROTAC. Figure 3 a and 3e). In addition, the results of the time-dependent experiment Figure 3 b) showed that the action of C-PROTAC is time-sensitive. After the introduction of C-PROTAC, ZBP1 was rapidly degraded, showing a significant degradation effect after 12 hours, and its half-life (t1 / 2) was 17.03 hours. Figure 3 f). This phenomenon further verified the excellent performance of C-PROTAC in maintaining degradation stability and persistence. To evaluate the degradation efficacy of C-PROTAC on ZBP1, we performed dose-response experiments Figure 3 c and 3d) by Western Blot analysis to determine the DC50 values of C-PROTAC and traditional PROTAC. This method enabled us to quantitatively compare their efficacies in inducing the degradation of ZBP1. The results showed that the DC50 value of C-PROTAC was 25.69 nM, significantly lower than that of traditional PROTAC, which was 81.52 nM. Figure 3 g). This significant difference in DC50 values highlighted the excellent performance of C-PROTAC, which can achieve half-maximal degradation of ZBP1 at a lower concentration. The above results emphasized the potential of C-PROTAC as a more powerful and effective therapeutic modality to regulate ZBP1 levels, highlighting its advantages over traditional PROTAC in this regard.

[0085] To comprehensively evaluate the potential application of C-PROTAC in regulating necroptosis and inflammatory responses, we further verified whether C-PROTAC can effectively inhibit the downstream signaling pathways related to ZBP1 while degrading ZBP1. The results of Western Blot and quantitative analysis showed that after effectively inhibiting the expression of ZBP1 using C-PROTAC, the phosphorylation levels of RIPK3 and MLKL were significantly reduced, while the expression level of Caspase-8 remained unchanged. These results indicated that C-PROTAC successfully inhibited the activation of RIPK3 and MLKL by degrading ZBP1, thereby inhibiting necroptosis. At the same time, C-PROTAC did not affect the cleavage of Caspase-8, which is related to normal apoptosis, further confirming the specificity of C-PROTAC in targeting the necroptosis pathway. Overall, our research results revealed the potential of C-PROTAC as a necroptosis inhibitor, highlighting its broad application prospects in regulating cell death modes and inflammatory responses.

[0086] We also performed immunofluorescence experiments to verify whether ZBP1 degradation occurs through the proteasome system pathway ( Figure 3 j). The results showed that the expression of ZBP1 was low in normal cells, but was significantly upregulated in cells treated with CBL0137. After treatment with C-PROTAC, the level of ZBP1 was significantly reduced, indicating that C-PROTAC effectively mediated the degradation of ZBP1. In contrast, cells co-treated with MG132 (a proteasome inhibitor) did not show a significant change in ZBP1 expression, suggesting that under untreated or insufficient treatment conditions, ZBP1 could not be effectively removed, probably because the degradation mechanism of C-PROTAC was not fully activated, and the presence of MG132 further inhibited the degradation of ZBP1 by the proteasome system. These findings verified that the degradation mechanism of C-PROTAC depends on the proteasome system rather than other pathways. The results highlight the potential of C-PROTAC as a targeted protein degradation method, providing a new strategy for regulating protein levels and functions in various biological and therapeutic contexts.

[0087] Example 4. In vitro verification of the therapeutic effect of C-PROTAC

[0088] Subsequently, using the H1N1 influenza virus as a model, we studied the ability of C-PROTAC to degrade ZBP1 during virus infection. We further verified the degradation effect of C-PROTAC on ZBP1 through immunofluorescence experiments ( Figure 4 a and 4c). The results showed that the expression of ZBP1 was relatively low in uninfected cells, but after virus infection, the expression of ZBP1 increased significantly, suggesting that the virus induced the upregulation of ZBP1. Interestingly, the level of ZBP1 did not decrease significantly in cells treated with only the aptamer or the NASA-VHL ligand, indicating that these individual components were not sufficient to effectively degrade ZBP1. Significantly, only in virus-infected cells, after treatment with C-PROTAC, the expression of ZBP1 decreased significantly and returned to a level close to that of uninfected cells. This observation provides strong evidence that C-PROTAC effectively targets and degrades ZBP1 through a covalent degradation mechanism, further emphasizing the key role of the synergistic effect between the aptamer and the NASA-VHL ligand in successful degradation.

[0089] To better verify the therapeutic potential of C-PROTAC in antiviral-induced cell damage, we used cell viability and cytotoxicity assays and CCK-8 assays to evaluate cell viability. The results of the cell viability and cytotoxicity assays showed a significant difference in cell survival rate between the virus-induced inflammation model group and the C-PROTAC treatment group. In the inflammation model, the cell survival rate dropped sharply to only 34.9% ( Figure 4b and 4d), highlighting the destructive effect of viral infection on cell survival. However, after treatment with traditional PROTACs, the cell viability was significantly improved, increasing to 65.2%. More significantly, after treatment with C-PROTAC, the cell viability soared to an astonishing 95.8%. These results provide strong evidence that C-PROTAC has potent therapeutic effects, can effectively alleviate virus-induced cell death, and promote cell survival. To further investigate the effect of C-PROTAC on the functional recovery of infected cells, we employed the CCK-8 assay ( Figure 4 e). This assay is used to evaluate cell activity and proliferation, providing valuable insights into cell health and survival. The results of the CCK-8 assay were consistent with those of the live / dead staining assay, showing a significant decrease in cell activity after viral infection. However, after treatment with C-PROTAC, the proliferation of infected cells was significantly restored, indicating that C-PROTAC can not only prevent cell death but also actively promote the recovery of cell function. Overall, the live / dead staining and CCK-8 assays provide strong evidence for the therapeutic effect of C-PROTAC in alleviating virus-induced cell death.

[0090] Further quantitative real-time PCR (qRT-PCR) analysis revealed that viral infection significantly upregulated multiple inflammatory cytokines, including IL-18, IL-6, IL-1β, TNF-α, and IFN-β ( Figure 4 f), indicating that the virus triggered a strong inflammatory response. The elevation of IL-18 was closely associated with the activation of the pro-inflammatory pathway, further exacerbating the inflammatory response, and the significant elevation of IL-6 and IL-1β also confirmed the effectiveness of this mechanism. After treatment with C-PROTAC, the levels of these pro-inflammatory cytokines (IL-18, IL-6, IL-1β, TNF-α, and IFN-β) were significantly reduced, indicating that C-PROTAC effectively inhibited the inflammatory response. This suggests that C-PROTAC can efficiently target and degrade ZBP1, thereby reducing the expression of pro-inflammatory cytokines. In addition, this may reflect the dual role of C-PROTAC in regulating inflammation: on the one hand, it directly reduces the levels of pro-inflammatory cytokines and alleviates inflammation; on the other hand, it may improve the balance of the immune response by regulating other signaling pathways. Therefore, the application of C-PROTAC not only successfully degrades ZBP1 but also demonstrates its great potential in managing the inflammatory response triggered by viral infection, providing a new therapeutic strategy to address the inflammation caused by viral infection.

[0091] Example 5. In Vivo Verification of the Therapeutic Effect of C-PROTAC

[0092] To verify the anti-inflammatory effect of C-PROTAC and its ability to degrade ZBP1, we conducted experiments using an IAV-infected mouse model. As Figure 5As shown in , we first induced an inflammatory response in mice by viral infection and then administered C-PROTAC via intratracheal instillation. Due to the large molecular weight of C-PROTAC, its delivery efficiency and cellular penetrability in vivo pose challenges. To overcome these problems, we used liposomes as drug carriers, which are widely used to improve delivery efficiency and in vivo stability. We investigated the effect of different C-PROTAC loading ratios on the encapsulation efficiency of liposomes. The results showed that when the molar ratio of nanoliposomes to C-PROTAC reached 15:16, the zeta potential of the liposomes became stable ( Figure 12 a), and the particle size increased to 211.5 nm after drug loading ( Figure 12 b). Further stability evaluation showed that C-PROTAC-loaded nanoliposomes (NLP@C-PROTAC) remained stable within 72 hours ( Figure 12 c), which was beneficial for its therapeutic effect in vivo. In addition, through cell uptake experiments with fluorescently labeled aptamers, the results showed that NLP@aptamer could be successfully internalized by cells ( Figure 12 d and 12e). Meanwhile, flow cytometry was used to quantitatively analyze the delivery efficiency of DID-labeled NLP@C-PROTAC (DID is a fluorescent dye commonly used to label liposomes, and the distribution and dynamics of liposomes in cells or tissues can be traced through fluorescence signals) ( Figure 12 f), confirming the uptake efficiency of NLP@C-PROTAC. These experiments strongly supported the effective delivery of C-PROTAC through the liposome system and confirmed that the liposome carrier could improve the intracellular uptake efficiency and enhance the therapeutic effect of the drug.

[0093] Furthermore, we performed fluorescence tracking experiments with DID-dye-labeled liposomes. The results ( Figure 12 g) showed that 24 hours after intratracheal instillation, the fluorescence signal of DID-labeled NLP@C-PROTAC was stably concentrated in the lungs, confirming the advantage of this liposome system in targeted pulmonary drug delivery. Then, we evaluated the therapeutic effect of NLP@C-PROTAC on virus-infected mice. The results showed that the body weight of virus-infected mice continued to decline, while the body weight of the control group remained stable. Encouragingly, mice treated with NLP@C-PROTAC showed only a slight decrease in body weight at the initial stage of infection and began to recover on the 4th day ( Figure 5 c). Survival analysis highlighted the significant therapeutic effect of NLP@C-PROTAC. In the virus-infected group, the survival rate dropped to 20%, while NLP@C-PROTAC treatment significantly increased the survival rate to 80%. The control group maintained a 100% survival rate ( Figure 5b). These results strongly suggest that NLP@C-PROTAC has significant anti-inflammatory effects. To further evaluate the anti-inflammatory potential of NLP@C-PROTAC, we measured the wet-to-dry weight ratio of the lungs in mice ( Figure 5 d). The wet-to-dry weight ratio of the lungs in virus-infected mice was significantly increased, indicating severe inflammation and edema in the lungs. In contrast, in the group treated with NLP@C-PROTAC, this ratio was significantly decreased and close to the normal level. Additionally, the measurement of the lung index (the ratio of lung weight to body weight, used as an indicator of lung injury and inflammation) further supported these findings ( Figure 5 e), showing that the lung index in the virus-infected group was significantly increased, while that in the NLP@C-PROTAC treatment group was significantly decreased and restored to the normal range. Gross anatomical examination of the lungs showed obvious inflammatory symptoms in the lungs of the virus-infected group, such as severe edema and congestion ( Figure 5 f). In contrast, no signs of inflammation were seen in the control group. Notably, the lung inflammation in the NLP@C-PROTAC treatment group was significantly reduced and close to the normal state, further confirming the effect of NLP@C-PROTAC in alleviating lung inflammation. Therefore, NLP@C-PROTAC not only improved the body weight and survival rate of mice but also effectively alleviated lung inflammation and edema.

[0094] qRT-PCR analysis ( Figure 5 g) showed that virus infection significantly upregulated multiple pro-inflammatory cytokines including IL-18, IL-6, IL-1β, TNF-α, and IFN-β, indicating that the virus triggered a strong inflammatory response. In contrast, mice treated with NLP@C-PROTAC showed a significant decrease in the expression of these pro-inflammatory factors, resulting in a significant reduction in the intensity of the inflammatory response. This indicates that NLP@C-PROTAC can specifically degrade ZBP1, thereby inhibiting the production of pro-inflammatory cytokines and regulating the immune response to control inflammation. Additionally, hematoxylin and eosin (HE) staining confirmed the therapeutic effect of NLP@C-PROTAC in virus infection ( Figure 5 h and 5j). The lung tissue of the virus group showed a large number of inflammatory cell infiltrations and severe alveolar structure destruction. However, after treatment with NLP@C-PROTAC, the pathological changes in the lung tissue were significantly improved, the number of inflammatory cells was significantly reduced, and the structure returned to normal. This indicates that NLP@C-PROTAC effectively alleviated the lung injury caused by virus infection.

[0095] Furthermore, TUNEL staining revealed significant green fluorescence signals in the lung tissue sections of the virus-infected group, indicating the presence of a large number of apoptotic cells. In contrast, no apoptotic signals were seen in the control group and the NLP@C-PROTAC group ( Figure 5i and 5k). This indicates that NLP@C-PROTAC also has the ability to inhibit apoptosis induced by viral infection. In addition, histological staining was used to evaluate the effect of NLP@C-PROTAC on other organs ( Figure 13 ). The results showed that NLP@C-PROTAC treatment did not cause pathological changes in the heart, liver, spleen, or kidney, confirming the good safety of the drug in vivo. In summary, the in vivo experimental results provide strong evidence for the efficacy and safety of NLP@C-PROTAC targeting ZBP1 degradation in the treatment of viral pneumonia, supporting its potential in clinical applications. NLP@C-PROTAC exerts its therapeutic effects through multiple mechanisms, including inhibiting inflammatory responses and apoptosis. Overall, these experimental results provide strong evidence for the therapeutic potential of the NLP@C-PROTAC system in ZBP1 degradation and anti-inflammation, laying a solid foundation for further in-depth research and translational applications.

[0096] Materials

[0097] In the above examples, (S,R,S)-AHPC-PEGs-N3 and dibenzocyclooctene acid were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), cholesterol, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol 2000 amine (DSPE-PEG2000-NH2), and (2,3-dioleyloxy-propyl)-trimethylammonium chloride (DOTAP) were provided by Xi'an Ruixi Biotechnology Co., Ltd. (Xi'an, China). Cell Counting Kit-8 (CCK-8) and Calcein-AM / PI double staining kit were provided by Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Dulbecco's Modified Eagle Medium (DMEM) was purchased from Gibco (Grand Island, NY, USA). One-step TUNEL Apoptosis Detection Kit (green fluorescence) was provided by Abbkine Scientific Co., Ltd. Polyclonal antibodies against ZBP1, MLKL, pMLKL, RIPK3, pRIPK3, Caspase-8, and GAPDH were provided by Signalway Antibody LLC (USA). 1,1-Dioctadecyl-3,3,3,3-tetramethylindotricarbocyanine (DiD) was provided by Betta Technology (Shanghai, China). All DNA was synthesized by Beijing Qingke Biotechnology Co., Ltd. (Beijing, China). 4-Vinylbenzenesulfonamide and other reagents were of analytical grade and purchased from Shanghai Macklin Biochemical Co., Ltd. (Shanghai, China).

[0098] Experimental Conclusions

[0099] The above embodiments highlight the therapeutic potential of targeting ZBP1 in the context of inflammatory responses and viral infections. By leveraging the natural protein degradation mechanism, PROTAC technology can be designed to specifically bind ZBP1 and an E3 ubiquitin ligase, thereby enabling precise regulation of ZBP1 levels. In the present invention, we combined the targeting advantages of DNA aptamers, the covalent recognition properties of NASA, and the ability of VHL ligands to recognize E3 enzymes, and successfully achieved covalent recognition and targeted degradation of ZBP1. This targeting strategy not only improves therapeutic efficacy, but also minimizes off-target effects, reduces the risk of adverse reactions, and preserves the function of non-pathological pathways. In addition, the development of stable and highly efficient covalent PROTACs overcomes the problem of non-covalent stability in current PROTAC technology. In summary, direct inhibition of ZBP1 by PROTAC technology provides a novel and effective approach to combat inflammatory viral infections. By focusing on the degradation of ZBP1, this strategy is expected to improve therapeutic outcomes and pave the way for the development of the next generation of antiviral and anti-inflammatory therapies.

[0100] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A covalent PROTAC compound, characterized in that: The invention comprises a ligand of an E3 ubiquitin ligase, an aptamer targeting a target protein, and a linker containing an N-acyl-N-alkylsulfonamide group connecting the ligand of the E3 ubiquitin ligase and the aptamer targeting a target protein; Preferably, the ligand of the E3 ubiquitin ligase is a Von Hippel-Lindau ligand; Preferably, the aptamer targeting the target protein is a DNA aptamer; Preferably, the target protein is ZBP1.

2. A covalent PROTAC compound according to claim 1, characterized in that: The aptamer targeting ZBP1 is a Z1 aptamer, a Z2 aptamer, a Z3 aptamer, a Z4 aptamer or a Z5 aptamer, the nucleic acid sequence of the Z1 aptamer is shown in SEQ ID No.1, the nucleic acid sequence of the Z2 aptamer is shown in SEQ ID No.2, the nucleic acid sequence of the Z3 aptamer is shown in SEQ ID No.3, the nucleic acid sequence of the Z4 aptamer is shown in SEQ ID No.4, and the nucleic acid sequence of the Z5 aptamer is shown in SEQ ID No.

5.

3. A covalent PROTAC compound according to claim 2, characterized in that: The aptamer targeting ZBP1 is a Z3 aptamer.

4. A covalent PROTAC compound according to claim 3, characterized in that: The structural formula of the covalent PROTAC compound is shown in Formula I:

5. A method for preparing a covalent PROTAC compound according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1: 4-vinylbenzenesulfonamide reacts with dibenzocyclooctene to form compound 1b; S2: Compound 1b reacts with iodoacetonitrile to generate compound 1c; S3: Compound 1c reacts with (S,R,S)-AHPC-PEGs-N3 to generate compound 1e; S4: Compound 1e is coupled with the aptamer to obtain a coupled aptamer-1e product.

6. An aptamer targeting ZBP1, characterized in that: The aptamer targeting ZBP1 is a Z3 aptamer, and the nucleic acid sequence of the Z3 aptamer is shown in SEQ ID No.

3.

7. A pharmaceutical composition comprising a therapeutically effective amount of a covalent PROTAC compound according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

8. Use of the covalent PROTAC compound according to any one of claims 1 to 4, the aptamer targeting ZBP1 according to claim 6, or the pharmaceutical composition according to claim 7 in the preparation of a product for targeted degradation of ZBP1.

9. Use of the covalent PROTAC compound according to any one of claims 1 to 4, the aptamer targeting ZBP1 according to claim 6, or the pharmaceutical composition according to claim 7 in the preparation of a drug for treating infectious inflammation.

10. The use according to claim 9, characterized in that: The infectious inflammation includes respiratory tract infectious inflammation, digestive tract infectious inflammation, urogenital tract infectious inflammation or skin and soft tissue infectious inflammation; Preferably, the infectious inflammation includes acute tonsillitis, bronchitis, acute gastroenteritis, cholecystitis, urethritis, pyelonephritis, furuncle or carbuncle.

Images