Application of laodelphax striatellus saliva gene LsSP and dsRNA thereof in prevention and treatment of rice stripe virus RSV transmission

Abstract

The invention discloses application of a laodelphax striatellus saliva gene LsSP and dsRNA thereof in prevention and treatment of transmission of laodelphax striatellus to rice stripe virus RSV. The dsRNA of the target laodelphax striatellus saliva gene LsSP is synthesized by utilizing an in-vitro transcription method, and is introduced into the laodelphax striatellus body, so that the expression of the laodelphax striatellus saliva gene LsSP can be effectively interfered, the capability of spreading the rice stripe virus RSV of the laodelphax striatellus is reduced, and the virus is prevented from harming rice production. The method specifically aims at the link of transmitting the rice stripe virus RSV by the laodelphax striatellus, is harmless to mammals, fishes and shrimps, natural enemy insects and pollination insects, has the advantages of quick response, environment friendliness and the like, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of the salivary gland gene LsSP of Laodelphax striatellus and its dsRNA in preventing and controlling the transmission of Rice stripe virus (RSV) by Laodelphax striatellus to rice. Background Art

[0002] Rice stripe disease caused by Rice stripe virus (RSV) is an important disease in rice production, seriously endangering China's food security. In the natural state, the virus cannot be transmitted through soil and the sap of infected plants, and can only be transmitted by insect vectors mainly Laodelphax striatellus. At present, the prevention and control of rice stripe disease mainly rely on the chemical control of Laodelphax striatellus. However, the large-scale use of traditional pesticides not only causes serious environmental problems, but also makes Laodelphax striatellus develop drug resistance, which is not conducive to the sustainable development of agriculture. Therefore, developing a new technology for preventing and controlling rice stripe disease is a good way to solve the current abuse of chemical pesticides.

[0003] RNA interference technology has been a research hotspot in life science in recent years. It specifically degrades or inhibits the expression of target gene mRNA through small interfering double-stranded RNA, and then inhibits or shuts down specific genes. RNA interference technology has the advantages of high specificity, high efficiency and easy operation. At present, this technology has been widely applied to the prevention and control of various agricultural pests, that is, by introducing specific dsRNA into insects, so as to control the pest population or reduce the virus transmission ability of pests.

[0004] Rice stripe virus RSV is transmitted in Laodelphax striatellus in a circulative-propagative manner. Once Laodelphax striatellus is infected, it can transmit the virus persistently, and the virus-infected female insects can also transmit the virus to the next generation through eggs, which poses a major challenge to virus prevention and control. At present, the research on blocking the transmission of rice stripe virus RSV by Laodelphax striatellus mainly focuses on how to inhibit the virus from breaking through the midgut barrier. However, due to the property of transovarial transmission of rice stripe virus RSV, the virus can complete vertical transgenerational transmission without passing through the midgut. Therefore, how to inhibit rice stripe virus RSV from breaking through the salivary gland barrier and avoid the release of the virus into plant tissues is the key to prevention and control. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to target and affect the key salivary gland gene (Laodelphax striatellus salivary protein, LsSP) that affects virus transmission by Laodelphax striatellus, so as to reduce the efficiency of Laodelphax striatellus transmitting rice stripe virus RSV and reduce the harm of rice stripe virus RSV to rice, providing a sequence and data basis for the prevention and control of rice viruses.

[0006] To achieve the above object, the present invention cloned the coding protein sequence of the salivary gland gene LsSP of Laodelphax striatellus, obtained dsRNA of the LsSP gene by in vitro synthesis method, and introduced it into Laodelphax striatellus. Silencing the LsSP gene did not affect the survival rate of Laodelphax striatellus, but significantly reduced the efficiency of Laodelphax striatellus transmitting RSV. Moreover, even if some Laodelphax striatellus could still transmit the virus, the virus content of the virus-infected rice was significantly decreased and the symptoms were weakened, ultimately achieving the purpose of controlling rice stripe disease.

[0007] The present invention mainly adopts the following technical solutions:

[0008] In the first aspect of the present invention, there is provided the use of the salivary gland gene LsSP of Laodelphax striatellus as a target gene in preventing and controlling the transmission of rice stripe virus RSV by Laodelphax striatellus.

[0009] In the second aspect of the present invention, there is provided dsRNA targeting the salivary gland gene LsSP of Laodelphax striatellus, which is synthesized by in vitro transcription after amplification using SEQ ID NO.6 and SEQ ID NO.7 as primers and a nucleotide sequence shown in SEQ ID NO.1 or having at least 90% homology with the nucleotide sequence shown in SEQ ID NO.1 and encoding amino acids as shown in SEQ ID NO.2 as a template.

[0010] Preferably, the dsRNA is composed of the nucleotide sequence shown in SEQ ID NO.14 and a nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO.14.

[0011] In the third aspect of the present invention, there is provided the use of the above dsRNA in interfering with the expression of the salivary gland gene LsSP of Laodelphax striatellus.

[0012] In the fourth aspect of the present invention, there is provided the use of the above dsRNA in preventing and controlling the transmission of rice stripe virus RSV by Laodelphax striatellus.

[0013] Preferably, the prevention and control of the transmission of rice stripe virus RSV by Laodelphax striatellus includes reducing the virus infection rate and / or virus content of healthy rice fed on by Laodelphax striatellus.

[0014] In the fifth aspect of the present invention, there is provided a biological drug for preventing and controlling the transmission of rice stripe virus RSV by Laodelphax striatellus, and the active ingredient of the biological drug contains the above dsRNA.

[0015] In the sixth aspect of the present invention, there is provided a method for preventing and controlling the transmission of rice stripe virus RSV by Laodelphax striatellus, and a solution containing the above dsRNA or the above biological drug is introduced into Laodelphax striatellus by injection and / or feeding.

[0016] The beneficial effects of the present invention are as follows:

[0017] (1) The present invention discloses the Laodelphax striatellus saliva gene LsSP. By introducing the dsRNA of the obtained LsSP gene into Laodelphax striatellus and silencing the LsSP gene, the ability of Laodelphax striatellus to transmit Rice stripe virus (RSV) can be significantly reduced, and the virus infection rate and virus-carrying amount of rice can be decreased. This indicates that the Laodelphax striatellus saliva gene LsSP plays a key role in the process of Laodelphax striatellus transmitting the virus, and meanwhile has important value in the biological control of Laodelphax striatellus and Rice stripe virus (RSV).

[0018] (2) The present invention specifically targets the link of Laodelphax striatellus transmitting Rice stripe virus (RSV), is harmless to mammals, fish and shrimps, natural enemy insects and pollinating insects, has advantages such as quick effect and environmental friendliness, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] To make the objectives, technical solutions and beneficial effects of the present invention clearer, the present invention provides the following drawings for description:

[0020] Figure 1 It is the PCR amplification result diagram of the Laodelphax striatellus saliva gene LsSP in Example 1 of the present invention;

[0021] Figure 2 It is the experimental result diagram of the dsRNA synthesis of the Laodelphax striatellus saliva gene LsSP in Example 2 of the present invention;

[0022] Figure 3 It is the diagram of the change in the expression level of the target gene after introducing the dsRNA of the Laodelphax striatellus saliva gene LsSP into Laodelphax striatellus in Example 4 of the present invention (dsGFP represents the dsRNA introduction group of the GFP gene, and dsLsSP represents the dsRNA introduction group of the LsSP gene);

[0023] Figure 4 It is the efficiency diagram of Laodelphax striatellus transmitting Rice stripe virus (RSV) after introducing the dsRNA of the Laodelphax striatellus saliva gene LsSP into Laodelphax striatellus in Example 5 of the present invention (dsGFP represents the dsRNA introduction group of the GFP gene, and dsLsSP represents the dsRNA introduction group of the LsSP gene);

[0024] Figure 5 It is the comparison diagram of the virus-carrying amount and symptoms after rice is infected with Rice stripe virus (RSV) in Example 5 of the present invention (A: Rice leaf not infected with RSV; B: Rice leaf infected with RSV by Laodelphax striatellus injected with dsRNA of the GFP gene; C: Rice leaf infected with RSV by Laodelphax striatellus injected with dsRNA of the LsSP gene). DETAILED DESCRIPTION OF THE INVENTION

[0025] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited do not limit the present invention.

[0026] Example 1: Cloning of the saliva gene LsSP of Laodelphax striatellus

[0027] 1. Amplification of the LsSP gene fragment of Laodelphax striatellus

[0028] (1) Take Laodelphax striatellus nymphs and place them on ice for anesthesia; add pre-cooled 1×PBS (37 mM NaCl, 2.68 mM KCl, 8.1 mM Na 2 HPO 4 , 1.47 mM KH 2 PO 4 , pH 7.4) on a glass slide, and immediately dissect the salivary glands of the planthoppers under a stereomicroscope;

[0029] (2) Add the dissected salivary glands to 1 ml of Trizol (Takara) and grind thoroughly; add 400 μl of chloroform, mix vigorously, and centrifuge at 12,000 rpm at 4°C for 15 minutes. Carefully aspirate the uppermost aqueous phase liquid and transfer it to a new centrifuge tube; add an equal volume of isopropanol, mix well, and let it stand at room temperature; after 10 minutes, centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, add 1 ml of 75% ethanol to the precipitate; centrifuge at 9,600 rpm for 5 minutes, discard the supernatant, and add an appropriate amount of RNase-free water to the precipitate; measure the RNA concentration with NanoDrop;

[0030] (3) Use the ReverTra Ace qPCR RT Master with gDNAremover kit to reverse-transcribe the total RNA extracted from the salivary glands of Laodelphax striatellus: First, denature the total RNA at 65°C for 5 min; take 1 μg of total RNA, add 2 μl of 4×DNMaster Mix, and make up to 8 μl with RNase-free water; mix well and incubate at 37°C for 5 min to remove contaminating genomic DNA; then, add 2 μl of 5×RT Master Mix to the system; mix well and incubate at 37°C for 1 h. Finally, denature at 98°C for 5 min to inactivate the reverse transcriptase and finally obtain the cDNA of the salivary glands of Laodelphax striatellus;

[0031] (4) Design primers according to the full-length LsSP gene sequence as shown in Table 1, and the primers are synthesized by Hangzhou Youkang Biotechnology Co., Ltd.

[0032] Table 1 Primers for amplifying the LsSP gene

[0033]

[0034] (5) Using the cDNA of the salivary gland of Laodelphax striatellus as a template, and using the primers shown in Table 1, perform PCR amplification on the target gene. The specific amplification system is as follows: Max Buffer 25 μl, dNTP Mix (10 mM each) 1 μl, MaxSuper-Fidelity DNA Polymerase 1 μl, 1 μl each of the upstream and downstream primers, 1 μl of the cDNA template of the salivary gland of Laodelphax striatellus, and finally make up to 50 μl with ddH 2 O. The PCR amplification conditions are: 95 °C for 3 minutes; 95 °C for 15 seconds, 60 °C for 1 minute, 35 cycles; 72 °C for 10 minutes.

[0035] 2. Obtaining monoclonal strains of the LsSP gene of Laodelphax striatellus

[0036] (1) Use 1% agarose gel electrophoresis to separate the PCR products ( Figure 1 ), and cut out the target fragment with a blade;

[0037] (2) Use a DNA agarose gel recovery kit (Sangon Biotech, Shanghai, SK8131) to recover the target DNA: Cut out the agarose containing the target fragment from the agarose gel and put it into a centrifuge tube; Add 5 times the volume of gel dissolution solution Buffer B2 and incubate in a water bath at 70 °C for 10 minutes; Add the dissolved gel solution to the adsorption column and centrifuge at 8,000 g for 30 seconds, discard the waste liquid; Add 500 μl of wash solution and centrifuge at 9,000 g for 30 seconds, discard the waste liquid; Centrifuge the empty adsorption column at 9,000 g for 1 minute; Put the adsorption column into a new centrifuge tube, add 30 μl of ddH 2 O in the center of the adsorption column; Centrifuge at 10,000 g for 2 minutes to finally obtain the purified DNA fragment of the LsSP gene of Laodelphax striatellus;

[0038] (3) Use a blunt-end cloning kit (Beijing Tsingke Biotechnology Co., Ltd.) to ligate the DNA fragment of the LsSP gene of Laodelphax striatellus to the pClone007 vector: Add 1 μl of the DNA fragment of the LsSP gene of Laodelphax striatellus, 1 μl of the pClone007 Blunt simple vector, and 1 μl of 10× buffer in a 0.2 ml centrifuge tube in sequence, and finally make up to 10 μl with ddH 2 O. Mix the samples and react at 25 °C for 5 minutes;

[0039] (4) Add the ligation product into the competent cells, flick the tube wall gently by hand, and incubate on ice for 30 minutes; transfer the centrifuge tube to a 42 °C water bath for 90 seconds, quickly take it out and let it stand on ice for 2 minutes; add 500 μl of antibiotic-free LB medium into the centrifuge tube, and shake at 180 rpm for 1 hour; take 100 - 200 μl of the bacterial solution and spread it on an LB plate containing ampicillin resistance.

[0040] (5) Pick a single colony into 1 ml of LB liquid medium containing ampicillin resistance, shake at 180 rpm for 6 hours, and perform colony PCR on the bacterial solution. The reaction system is as follows: Max Buffer 12.5 μl, dNTP Mix (10 mM each) 0.5 μl, Max Super-Fidelity DNA Polymerase 0.5 μl, 0.5 μl each of the upstream and downstream primers (shown in Table 1), 1 μl of the bacterial solution, and finally make up to 25 μl with ddH 2 O. The PCR amplification conditions are: 95 °C for 3 minutes; 95 °C for 15 seconds, 60 °C for 1 minute, for 35 cycles; 72 °C for 10 minutes;

[0041] (6) Use 1% agarose gel electrophoresis to separate the PCR products, pick the recombinant clones, send them to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing, obtain the 771 bp sequence of the small brown planthopper LsSP gene, and the obtained sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0042] ATGAAGGGTTTGGTATTGTGTGCGGTTTTCCTAGTTTTGGGCGGAAATCAATCATTCGGTGTTAATGTCAACTTGGACTTCTTAAAAGATCCTGATTTCCCAGGAAACGCAGGTTGGAATGCAAAATTGAACCAGCAAATCGCAGATACGGTAAATAATCCTGATTTCCCAGGAAATGCAGGTTGGAATGCAAAATTGGACCAGCAAATCAAAGATACGATGAATTCAGCTATGAACTCAGCTAATACGGGCAGCAGTGGATCAAATGTTGTGTCAAATAGCATGCAGAACATGGAGAACATAAATGTTGGAAATGATTATGTGACCAGTACTGCACCAACTTTGAATAGGCCTACACCTGTACCTGCCGTGCCAATGAAACCGAGTTTCAATATTCAAGGACCAAATCTGCAAAACATGAGGCTCCCACATGCCCCTCCAAACTTCCCCTTCCCCCCTGATTGTTCAGAGGTTGCAGATCCCGGCTACAAATTCCGTGATCCCTTGCAAATCAATTACGGAGATCAGAAACCAGAGATTCGACACCGTTCTTTCCTGTGCACTGATCCTGAATATGGTCAGGACAGTTTCTACATGCAGATGACAGAGGCTCGTAATCCCAATGGTTCTGGTAGTAGCCGAATAGCTGCCTATTACGACAAGACTGGCAATAGTATCGATTATTCTAGAAAGATGATATTCTTACCTCTAGGAGAGAAACTACCAGATATGCCGAGAAATGACTATTTGAAAATGGACGTTACGTTTTAA(SEQ ID NO.1)

[0043] MKGLVLCAVFLVLGGNQSFGVNVNLDFLKDPDFPGNAGWNAKLNQQIADTVNNPDFPGNAGWNAKLDQQIKDTMNSAMNSANTGSSGSNVVSNSMQNMENINVGNDYVTSTAPTLNRPTPVPAVPMKPSFNIQGPNLQNMRLPHAPPNFPFPPDCSEVADPGYKFRDPLQINYGDQKPEIRHRSFLCTDPEYGQDSFYMQMTEARNPNGSGSSRIAAYYDKTGNSIDYSRKMIFLPLGEKLPDMPRNDYLKMDVTF(SEQ ID NO.2)

[0044] Example 2: Synthesis of dsRNA of the LsSP gene of Laodelphax striatellus

[0045] 1. T7 primer PCR amplification and purification

[0046] (1) Using the recombinant plasmid or bacterial solution containing the LsSP gene of Laodelphax striatellus as a template, amplify the target gene using primers with T7 promoter sequences (shown in Table 2). The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd. The amplification system is Max Buffer 100 μl, dNTP Mix (10 mM each) 4 μl, Max Super-Fidelity DNA Polymerase 4 μl, upstream and downstream primers (SEQ ID NO.6 and SEQ ID NO.7) 4 μl each, recombinant plasmid or bacterial solution 4 μl, and finally supplemented with ddH 2 O to 200 μl. The PCR amplification conditions are: 95°C for 3 minutes; 95°C for 15 seconds, 60°C for 1 minute, 35 cycles; 72°C for 10 minutes.

[0047] Table 2 Primers with T7 promoter sequences

[0048]

[0049] (2) Separate the amplification products by agarose gel electrophoresis and recover them using a DNA agarose gel recovery kit to finally obtain a large amount of single LsSP gene fragments containing the T7 promoter. The obtained sequence is as shown in SEQ ID NO.5.

[0050] TAATACGACTCACTATAGGGGTTAATGTCAACTTGGACTTCTTAAAAGATCCTGATTTCCCAGGAAACGCAGGTTGGAATGCAAAATTGAACCAGCAAATCGCAGATACGGTAAATAATCCTGATTTCCCAGGAAATGCAGGTTGGAATGCAAAATTGGACCAGCAAATCAAAGATACGATGAATTCAGCTATGAACTCAGCTAATACGGGCAGCAGTGGATCAAATGTTGTGTCAAATAGCATGCAGAACATGGAGAACATAAATGTTGGAAATGATTATGTGACCAGTACTGCACCAACTTTGAATAGGCCTACACCTGTACCTGCCGTGCCAATGAAACCGAGTTTCAATATTCAAGGACCAAATCTGCAAAACATGAGGCTCCCACATGCCCCTCCAAACTTCCCCTTCCCCCCTGATTGTTCAGAGGTTGCAGATCCCGGCTACAAATTCCGTGATCCCTTGCAAATCAATTACGGAGATCAGAAACCAGAGATTCGACACCGTTCTTTCCTGTGCACTGATCCTGAATATGGTCAGGACAGTTTCTACATGCAGATGACAGAGGCTCGTAATCCCAATGGTTCTGGTAGTAGCCGAATAGCTGCCTATTACGACAAGACTGGCAATAGTATCGATTATTCTAGAAAGATGATATTCTTACCTCTAGGAGAGAAACTACCAGATATGCCGAGAAATGACTATTTGAAAATGGACGTTACGCCCTATAGTGAGTCGTATTA(SEQ ID NO.5)

[0051] 2. Synthesis and purification of dsRNA

[0052] The dsRNA of the LsSP gene was synthesized and purified using the T7 High Yield RNA Transcription Kit from Novoprotein Scientific Inc. The specific method is as follows:

[0053] (1) Using the LsSP gene fragment obtained by PCR amplification as the DNA template to synthesize dsRNA. The reaction system is as follows: 2 μl of 10×Reaction Buffer, 2 μl of ATP solution, 2 μl of UTP solution, 2 μl of CTP solution, 2 μl of GTP solution, 2 μl of enzyme mix, 1 μg of DNA template, and make up to 20 μl with RNase-free water. After preparing the reaction system, mix well and react overnight at 37°C;

[0054] (2) Add 1 μl of TURBO DNase to the reaction system to eliminate the DNA in the reaction system and react at 37°C for 15 min;

[0055] (3) Denature the reacted sample at 65°C for 5 min;

[0056] (4) Measure the concentration of dsRNA using Nanodrop and determine the quality of dsRNA by 1% agarose gel electrophoresis ( Figure 2 );

[0057] (5) Store the dsRNA of the LsSP gene at 80°C for future use; One of the nucleotide sequences of the dsRNA of the LsSP gene is shown in SEQ ID NO.14.

[0058] GUUAAUGUCAACUUGGACUUCUUAAAAGAUCCUGAUUUCCCAGGAAACGCAGGUUGGAAUGCAAAAUUGAACCAGCAAAUCGCAGAUACGGUAAAUAAUCCUGAUUUCCCAGGAAAUGCAGGUUGGAAUGCAAAAUUGGACCAGCAAAUCAAAGAUACGAUGAAUUCAGCUAUGAACUCAGCUAAUACGGGCAGCAGUGGAUCAAAUGUUGUGUCAAAUAGCAUGCAGAACAUGGAGAACAUAAAUGUUGGAAAUGAUUAUGUGACCAGUACUGCACCAACUUUGAAUAGGCCUACACCUGUACCUGCCGUGCCAAUGAAACCGAGUUUCAAUAUUCAAGGACCAAAUCUGCAAAACAUGAGGCUCCCACAUGCCCCUCCAAACUUCCCCUUCCCCCCUGAUUGUUCAGAGGUUGCAGAUCCCGGCUACAAAUUCCGUGAUCCCUUGCAAAUCAAUUACGGAGAUCAGAAACCAGAGAUUCGACACCGUUCUUUCCUGUGCACUGAUCCUGAAUAUGGUCAGGACAGUUUCUACAUGCAGAUGACAGAGGCUCGUAAUCCCAAUGGUUCUGGUAGUAGCCGAAUAGCUGCCUAUUACGACAAGACUGGCAAUAGUAUCGAUUAUUCUAGAAAGAUGAUAUUCUUACCUCUAGGAGAGAAACUACCAGAUAUGCCGAGAAAUGACUAUUUGAAAAUGGACGUUACG(SEQ ID NO.14)

[0059] Example 3: Introduction of dsRNA of LsSP gene into Laodelphax striatellus

[0060] The dsRNA of LsSP gene was introduced into Laodelphax striatellus by microinjection. The specific method is as follows:

[0061] (1) Select the 3rd instar nymphs from the Laodelphax striatellus population carrying Rice stripe virus RSV and anesthetize them with CO 2 for 10 s;

[0062] (2) Use a capillary puller (P97, Sutter Instrument) to pull the glass capillary (Wuhan Weitan Scientific Instruments Co., Ltd.) to an appropriate size. The set program parameters are: heat = 800, pull = 150, vel = 150, time = 80;

[0063] (3) Use a micropipette tip (Eppendorf) to inject dsRNA of GFP and LsSP genes into the glass capillary respectively;

[0064] (4) Install the glass capillary with the added sample onto a microinjector (Eppendorf), and under a stereomicroscope, introduce the dsRNA into the body of the small brown planthopper. The parameters of the microinjector are set as follows: injection pressure 800 pah, injection time 0.3 s, compensation pressure 10 pah;

[0065] (5) Using the same method, introduce dsRNA of the green fluorescent protein gene of Aequorea victoria (GFP) into the body of the small brown planthopper as a negative control;

[0066] (6) After the small brown planthopper into which dsRNA has been introduced wakes up, move it to a healthy rice plant and continue to raise it for 6 days.

[0067] Example 4: Detection of dsRNA silencing efficiency of LsSP gene

[0068] On the 6th day after introducing dsRNA of the LsSP gene into the small brown planthopper, collect the small brown planthopper and measure the expression level of the LsSP gene. The specific method is as follows:

[0069] (1) Grind the collected small brown planthopper, extract total RNA by the Trizol method, and reverse transcribe it using the ReverTra Ace qPCR RT Master with gDNA remover kit to obtain the cDNA of the small brown planthopper;

[0070] (2) Using Primer Primer 6.0 software, design quantitative primers for the LsSP gene (SEQ ID NO.8 and SEQ ID NO.9) and the actin Lsactin gene (SEQ ID NO.10 and SEQ ID NO.11) of the small brown planthopper, as shown in Table 3. The primers are synthesized by Nanjing Genscript Biotech Co., Ltd.;

[0071] Table 3 Quantitative PCR primers for LsSP gene and Lsactin gene

[0072]

[0073] (3) Using the cDNA of Laodelphax striatellus as a template, the iTaq TM Universal SYBR Green Supermix (Yeasen Biotech Co., Ltd., Shanghai) fluorescence quantitative detection reagent was used to determine the expression levels of the LsSP gene and the actin Lsactin gene in Laodelphax striatellus. The reaction system was configured as follows: 6.8 μl H 2 O, 10 μl 2×SYBR Green Supermix, 0.6 μl forward primer, 0.6 μl reverse primer, and 2 μl cDNA template. The following program was run on a Roche Light 480 Real-Time PCR System: pre-denaturation at 95 °C for 30 s, denaturation at 95 °C for 5 s, extension at 60 °C for 30 s, with a total of 40 cycles of denaturation and extension; a negative control without RNase water was set for each pair of primers;

[0074] (4) The 2 -ΔΔCt -method was used to calculate the expression level of the LsSP gene in Laodelphax striatellus, and Student's t-test was used to test the significance of differences between different treatment groups;

[0075] (5) The experimental results were as Figure 3 shown. The expression level of the LsSP gene in Laodelphax striatellus transfected with dsRNA of the LsSP gene was significantly lower than that of the control group, indicating that the dsRNA of the LsSP gene had a high silencing efficiency on the LsSP gene in Laodelphax striatellus.

[0076] Example 5: Determination of the virus transmission ability of Laodelphax striatellus transfected with dsRNA

[0077] The ability of Laodelphax striatellus injected with dsRNA and carrying Rice stripe virus RSV to transmit the virus to rice was determined. The specific method was as follows:

[0078] (1) Healthy rice at the 1-2 leaf stage was planted in plastic cups (10 cm in diameter and 30 cm in height), and 1 rice plant was planted in each cup;

[0079] (2) Laodelphax striatellus injected with dsRNA (for 6 days) and carrying Rice stripe virus RSV were introduced into the plastic cups, and 6 Laodelphax striatellus were introduced into each plastic cup;

[0080] (3) Laodelphax striatellus injected with dsRNA (for 6 days) and carrying Rice stripe virus RSV were reared on healthy rice for 48 hours, and then the Laodelphax striatellus were removed;

[0081] (4) The rice fed on by the Laodelphax striatellus was continuously cultured for 21 days;

[0082] (5) After 21 days, total RNA was extracted from rice stems by the Trizol method, and the first strand of cDNA was synthesized. Then, using the cDNA as a template, the rice stripe virus RSV coat protein CP gene was amplified. The primers SEQ ID NO.12 and SEQ ID NO.13 used are shown in Table 4, and the primers were synthesized by Nanjing Genscript Biotechnology Co., Ltd.;

[0083] Table 4 Primers for amplifying the rice stripe virus RSV coat protein CP gene

[0084]

[0085] (6) Calculate the efficiency of Laodelphax striatellus transmitting rice stripe virus: v = the number of virus-infected rice plants / the number of rice plants fed on by Laodelphax striatellus. The experimental results are as Figure 4 shown. The proportion of healthy rice plants infected with RSV that were fed on by virus-infected Laodelphax striatellus transfected with LsSP gene dsRNA was significantly lower than that of the control group, indicating that introducing LsSP gene dsRNA into Laodelphax striatellus can effectively reduce the efficiency of Laodelphax striatellus transmitting rice stripe virus;

[0086] (7) Observe the phenotypes of virus-infected rice plants. The results are as Figure 5 shown. Compared with the leaves of healthy rice plants not infected with RSV ( Figure 5 A in), the symptoms of the leaves of rice plants infected with RSV that were fed on by Laodelphax striatellus transfected with GFP gene dsRNA were obvious ( Figure 5 B in), while the symptoms of the leaves of rice plants infected with RSV that were fed on by Laodelphax striatellus transfected with LsSP gene dsRNA were not obvious ( Figure 5 C in). This indicates that although Laodelphax striatellus with partial inhibition of the LsSP gene can still transmit the virus to rice plants, the virus content in the virus-infected rice plants decreases and the symptoms weaken.

[0087] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of the saliva gene LsSP of the small brown planthopper as a target gene in controlling the transmission of rice stripe virus RSV by the small brown planthopper.

2. The dsRNA targeting the saliva gene LsSP of the Laodelphax striatellus according to claim 1, characterized in that: The dsRNA is synthesized by in vitro transcription using SEQ ID NO.6 and SEQ ID NO.7 as primers and amplifying the nucleotide sequence shown in SEQ ID NO.1 or a nucleotide sequence having at least 90% homology with SEQ ID NO.1 and encoding amino acids as shown in SEQ ID NO.2 as a template.

3. The dsRNA according to claim 2, characterized in that The dsRNA consists of the nucleotide sequence shown in SEQ ID NO.14 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.

14.

4. Use of the dsRNA according to claim 2 or 3 in interfering with the expression of the saliva gene LsSP of Laodelphax striatellus.

5. Use of the dsRNA according to claim 2 or 3 in preventing and controlling the spread of rice stripe virus RSV by small brown planthopper.

6. The use according to claim 5, characterized in that: The method for preventing and controlling the transmission of rice stripe virus RSV by gray planthoppers includes reducing the susceptibility rate and / or the amount of virus carried by healthy rice fed by gray planthoppers to rice stripe virus RSV.

7. A biological drug for controlling the transmission of rice stripe virus RSV by small brown planthopper, characterized in that: The active ingredient of the biopharmaceutical comprises the dsRNA according to claim 2 or 3.

8. A method for preventing and controlling the spread of rice stripe virus RSV by small brown planthopper, characterized in that: The solution containing the dsRNA according to claim 2 or 3 or the biopharmaceutical according to claim 7 is introduced into the body of the Laodelphax striatellus by injection and / or feeding.

Images