Fusarium saccharum pathogenicity related gene FsyptA as well as application and knockout method thereof

Abstract

The invention relates to the technical field of agricultural product quality safety and genetic engineering, in particular to a sugarcane fusarium pathogenicity related gene FsyptA as well as application and a knockout method thereof. The invention provides a sugarcane fusarium pathogenicity related gene FsyptA, and the nucleotide sequence of the sugarcane fusarium pathogenicity related gene FsyptA is as shown in SEQ ID No.1. The invention also provides a preparation method of the sugarcane fusarium pathogenicity related gene FsyptA. The invention provides a brand-new pathogenicity-related gene FsyptA of fusarium causing sugarcane pokkah boeng rot, which can be used for disease control. The invention provides a regulation target related to pathopoiesia of the sugarcane pokkah boeng, and the FsyptA gene can be used as a knockout target to be applied to inhibition of fungal diseases of the sugarcane.

Description

Technical Field

[0001] The present invention relates to the technical fields of agricultural product quality safety and genetic engineering, and particularly relates to a gene FsyptA related to the pathogenicity of Fusarium sacchari, its application and knockout method. Background Art

[0002] As an important cash crop, sugarcane is the main raw material source for the global sugar industry and bioenergy industry. The high yield, high sugar content, and stress resistance of sugarcane directly determine its economic value. In recent years, with the rapid development of gene editing technologies, scientists have begun to explore the application of these technologies in the genetic improvement of sugarcane, aiming to improve the yield, sugar content, and stress resistance of sugarcane through precise gene manipulation. However, the field of sugarcane gene editing still faces many technical challenges. First, sugarcane is a perennial crop with a complex and large genome, which makes it particularly difficult to accurately locate target genes and perform effective editing. Second, the genetic transformation efficiency of sugarcane is relatively low, and the growth cycle of regenerated plants is long, which limits the wide application of gene editing technologies in sugarcane.

[0003] In addition, when performing gene knockout, how to ensure the specificity of knockout and avoid off-target effects, and how to evaluate the impact of gene knockout on the growth, development, and yield traits of sugarcane are all problems that need to be solved urgently. The present invention uses advanced gene editing tools such as homologous recombination to precisely knockout specific genes in sugarcane. By optimizing the design of gene editing vectors, improving the genetic transformation efficiency, and establishing an efficient gene editing screening system, the present invention aims to achieve efficient and specific knockout of target genes in sugarcane and evaluate the impact of gene knockout on the growth, development, and pathogenicity of sugarcane. Summary of the Invention

[0004] To solve the above problems, the present invention provides a gene FsyptA related to the pathogenicity of Fusarium sacchari, its application and knockout method. The present invention knocked out the FsyptA gene in the genome of Fusarium sacchari and obtained a genetically engineered knockout strain △FsyptA with the FsyptA gene knocked out. Compared with the wild-type strain, the growth rate and the yield of microconidia of the genetically engineered strain decreased, and the pathogenicity was reduced.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a gene FsyptA related to the pathogenicity of Fusarium sacchari, and the nucleotide sequence of the gene FsyptA related to the pathogenicity of Fusarium sacchari is shown in SEQ ID No.1.

[0007] The present invention also provides the application of knocking out or silencing the gene FsyptA related to the pathogenicity of Fusarium sacchari described in the above technical solution in reducing the pathogenicity of Fusarium sacchari.

[0008] The present invention also provides the application of knocking out or silencing the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution in reducing the hyphal growth rate of Fusarium sacchari.

[0009] The present invention also provides the application of knocking out or silencing the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution in reducing the sporulation amount of Fusarium sacchari.

[0010] The present invention also provides the application of the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution as an inhibition target or a knockout target in preventing and treating sugarcane top rot caused by Fusarium sacchari.

[0011] The present invention also provides a method for knocking out the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution in Fusarium sacchari, comprising the following steps:

[0012] 1) Fusing the left homologous arm sequence, the right homologous arm sequence and the hygromycin resistance gene sequence of the Fusarium sacchari pathogenicity-related gene FsyptA to obtain a fusion fragment;

[0013] The nucleotide sequence of the left homologous arm sequence of the Fusarium sacchari pathogenicity-related gene FsyptA is shown in SEQ ID No.2, and the nucleotide sequence of the right homologous arm sequence is shown in SEQ ID No.3;

[0014] The nucleotide sequence of the hygromycin resistance gene sequence is shown in SEQ ID No.4;

[0015] The nucleotide sequence of the fusion fragment is shown in SEQ ID No.5;

[0016] 2) Transforming the fusion fragment obtained in the step 1) into the protoplasts of Fusarium sacchari by the protoplast transformation method to knock out the Fusarium sacchari pathogenicity-related gene FsyptA in Fusarium sacchari.

[0017] Preferably, the molar ratio of the left homologous arm sequence, the right homologous arm sequence and the hygromycin resistance gene sequence of the Fusarium sacchari pathogenicity-related gene FsyptA in the step 1) is 1:3:1.

[0018] Preferably, the total concentration of the left homologous arm sequence, the right homologous arm sequence and the hygromycin resistance gene sequence in the fusion system in the step 1) is 1000 ng / μL.

[0019] Preferably, the fusion method in the step 1) includes PEG-mediated protoplast fusion.

[0020] Preferably, in the transformation method of step 2), the mass of the fusion fragment and the volume of the protoplast solution are in a ratio of 2 μg: 125 μL.

[0021] Advantages of the present invention:

[0022] 1. The present invention provides a novel pathogenicity-related gene FsyptA of Fusarium causing sugarcane top rot disease, which can be used for disease control.

[0023] 2. The present invention provides a regulatory target related to the pathogenesis of sugarcane top rot disease, and the FsyptA gene can be used as a knockout target for application in suppressing sugarcane fungal diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.

[0025] Figure 1 It is a schematic diagram of homologous recombination and a schematic diagram of primer positions;

[0026] Figure 2 It is an electrophoresis diagram for identifying the FsyptA knockout mutant strain: A is for identifying the presence of the target gene with yptA / OF and yptA / OR primers, and B is for identifying whether homologous recombination has occurred with yptA / AF, p816 / R and yptA / BR, p625 / F;

[0027] Figure 3 It is an electrophoresis diagram for RT-PCR identification;

[0028] Figure 4 For A, it is the colony morphology of the wild strain CNO-1 of Fusarium sacchari and ΔFsyptA on PDA, MEA, and Czapek's media; B is the change in the colony diameter of the wild strain CNO-1 and ΔFsyptA growing on PDA for 5 days.

[0029] Figure 5 It is the observation status of aerial hyphae of the wild type CNO-1 (A) and ΔFsyptA (B) under the microscope;

[0030] Figure 6 It is the hydrophobicity test of the wild strain CNO-1 and ΔFsyptA;

[0031] Figure 7 It is the sugarcane in vivo inoculation test. A is the front side of the leaf, B is the back side of the leaf, and from left to right are WT, ΔFsyptA, and CK. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0032] The present invention provides a gene FsyptA related to the pathogenicity of Fusarium sacchari, and the nucleotide sequence of the gene FsyptA related to the pathogenicity of Fusarium sacchari is shown in SEQ ID No.1, specifically as follows:

[0033] ATGTCGTCGCTCGAAGCCAAGATCGTCGTCCTCGGCGCCCAGGGCGTTGGGAAGACGTCTCTGGTTATGAGATACTGCAAGGGCGCATTCAACCCGGCTCAGATCACTTCTACCGTCGGTGCCAGCTTTCTCACAAAGCGCGTCGTTGACTCTGACTCCGATACCGTTGTGCGCCTTCAGATATGGGATACAGGTCGGTTTTGATAAGGAGCCAAACAAGTTTATATTCGCTTATGTACTGACGCCAACTCGCAGCCGGCCAAGAACGCTTTCGTTCCATCTCACGCCTGTACTACCGTGGTGCAAACGCCTGCATTCTCTGCTACAGCATCACAGACGCACAGTCATTCGCCGACATGGGTGTATGGCTCATGGAACTTCGACGAAACCTCCCTCACGATGTCGTTCTTCACGTAGTCGGTACAAAAGCCGACATTGTCGCCCGCGATCCCTCAGCCCGCCAGGTCCCATTCGAACGTTGTATCGCATACGTCGCTGAGAACCTCGCCCCAGGCATGGGCAGCACGCCGCCTCCAACCGCAACCCCTTACCACATACCGACGCCTATGTCAGGTGGCCAGGCAATGTCCCCTCCATCTATGGAGCCTCGGAGCCCCAGCTCGAAGCGAAGCTCTGGTTTCTGGGCACAGGAAGTTGGCTGGGATGCTTGTCATGAAATCAGCGCCGAAACAGGAGAGGGTGTCGAGGAAGTCTTTCGTGTTGTCACACGGAAGCTTGTTGAGCAGAACCGCAAGATGCAGCAGGCCCTTCTAATGGCCACAGCCATACCTGGTACGCCAGGTTACGAAGCCGGCATGGACGGAGGCTATTTTGCAGGTGCAGACGCACGAGGGAGTT TCCGAGTAGGCCGCGATCGTCGAAGTTGGCTCTTCTCGCCAGGTTTCTCGCCCGCCGTCACGGTCGAGCAGGCGGGAACCCAGGAGCAGACACAAGCAGACGGTTGGGATCGAAAAGAGCGCAAGAAGTGCTGTTGA。

[0034] The present invention also provides the application of knocking out or silencing the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution in reducing the pathogenicity of Fusarium sacchari.

[0035] The present invention also provides the application of knocking out or silencing the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution in reducing the hyphal growth rate of Fusarium sacchari.

[0036] The present invention also provides the application of knocking out or silencing the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution in reducing the sporulation amount of Fusarium sacchari.

[0037] The present invention also provides the application of the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution as an inhibitory target or knockout target in preventing and treating sugarcane top rot caused by Fusarium sacchari.

[0038] The present invention also provides a method for knocking out the Fusarium sacchari pathogenicity-related gene FsyptA described in the above technical solution in Fusarium sacchari, comprising the following steps:

[0039] 1) Fusing the left homologous arm sequence, right homologous arm sequence and hygromycin resistance gene sequence of the Fusarium sacchari pathogenicity-related gene FsyptA to obtain a fusion fragment;

[0040] The nucleotide sequence of the left homologous arm sequence of the Fusarium sacchari pathogenicity-related gene FsyptA is shown in SEQ ID No. 2, and the nucleotide sequence of the right homologous arm sequence is shown in SEQ ID No. 3;

[0041] The nucleotide sequence of the hygromycin resistance gene sequence is shown in SEQ ID No. 4;

[0042] The nucleotide sequence of the fusion fragment is shown in SEQ ID No. 5;

[0043] 2) Transforming the fusion fragment obtained in the step 1) into the protoplast of Fusarium sacchari by the protoplast transformation method to knock out the Fusarium sacchari pathogenicity-related gene FsyptA in Fusarium sacchari.

[0044] In the present invention, the left homologous arm sequence, right homologous arm sequence, and hygromycin resistance gene sequence of the Fusarium sacchari pathogenicity-related gene FsyptA are fused to obtain a fusion fragment; the nucleotide sequence of the left homologous arm sequence of the Fusarium sacchari pathogenicity-related gene FsyptA is shown in SEQ ID No. 2, and the nucleotide sequence of the right homologous arm sequence is shown in SEQ ID No. 3; the nucleotide sequence of the hygromycin resistance gene sequence is shown in SEQ ID No. 4; the nucleotide sequence of the fusion fragment is shown in SEQ ID No. 5.

[0045] SEQ ID No.2:

[0046] GATGGAAATGACGTAGAGGATGTCTTTCTAGAGGATCCCCGGGTACGATTATTGGTGATGGTCGCGTC;

[0047] SEQ ID No.3:

[0048] ATATCATCTTCTGTCGACCTGCAGGTTTTCTTGATTGCCGATACGAAACTAGCGTAGTCGAATGAAGGCGTA;

[0049] SEQ ID No.4:

[0050] CGGTACCCGGGGATCCTCTAGCCTGCAGGTCGACAGAAGA;

[0051] SEQ ID No.5:

[0052] GATGGAAATGACGTAGAGGATGTCTTTCTAGAGGATCCCCGGGTACGATTATTGGTGATGGTCGCGTCCGGTACCCGGGGATCCTCTAGCCTGCAGGTCGACAGAAGAATATCATCTTCTGTCGACCTGCAGGTTTTCTTGATTGCCGATACGAAACTAGCGTAGTCGAATGAAGGCGTA。

[0053] In the present invention, the molar ratio of the left homologous arm sequence, right homologous arm sequence, and hygromycin resistance gene sequence of the Fusarium sacchari pathogenicity-related gene FsyptA is preferably 1:3:1. In the present invention, the total concentration of the left homologous arm sequence, right homologous arm sequence, and hygromycin resistance gene sequence in the fusion system is preferably 1000 ng / μL. In the present invention, the fusion method preferably includes PEG-mediated protoplast fusion.

[0054] The obtained fusion fragment was transformed into the protoplasts of Fusarium sacchari by the protoplast transformation method to knockout the Fusarium sacchari pathogenicity-related gene FsyptA in Fusarium sacchari. In the present invention, the mass-to-volume ratio of the fusion fragment to the protoplast solution in the protoplast transformation method is preferably 2 μg:125 μL. The present invention has no special limitation on other conditions of the protoplast transformation method, and conventional methods can be used. In the present invention, the concentration of protoplasts in the protoplast solution is preferably 1×10 7 cells / ml. The present invention has no special limitation on the method for preparing the protoplasts of Fusarium sacchari, and those skilled in the art can use conventional methods.

[0055] To further illustrate the present invention, the following examples are used to describe the present invention in detail, but they should not be construed as limiting the protection scope of the present invention.

[0056] Example 1

[0057] Construction of the yptA knockout mutant strain (ΔFsyptA):

[0058] 1. Homologous recombination

[0059] (1) Extraction of genomic DNA of wild-type Fusarium sacchari CNO-1: The wild-type strain CNO-1 was cultured in PDW for two days, and then the mycelia were collected. The genomic DNA was extracted using the SDS method.

[0060] Using the total DNA of the wild-type strain CNO-1 as a template, primers were designed according to the position of the target gene (FsyptA gene, SEQ ID No.1) on the chromosome. The target gene fragment was knocked out and the knockout mutant ΔFsyptA was obtained by the polyethylene glycol (PEG)-mediated protoplast transformation method ( Figure 1 ).

[0061] (2) First-round PCR: The full-length sequence of the target gene and 1000 bp of the upstream and downstream sequences were cloned using the primers yptA / AF and yptA / BR, and then the 1000 bp sequences of the left and right arms were cloned using yptA / AF, yptA / AR and yptA / BF, yptA / BR. The vector containing the hygromycin gene fragment was transformed into Escherichia coli. After extracting the plasmid using the Tiangen plasmid mini-prep kit, the hygromycin resistance gene HYG (SEQ ID No.4) (Hyg / F and Hyg / R) was cloned. The PCR products were recovered and purified using the Tiangen universal DNA purification and recovery kit.

[0062] The nucleotide sequence of the upstream sequence of the FsyptA gene is shown in SEQ ID No.6:

[0063] GATGGAAATGACGTAGAGGATGTCTTTCTAGAGGATCCCCGGGTACGATTATTGGTGATGGTCGCGTC;

[0064] The nucleotide sequence of the downstream sequence of the FsyptA gene is shown in SEQ ID No.7:

[0065] ATATCATCTTCTGTCGACCTGCAGGTTTTCTTGATTGCCGATACGAAACTAGCGTAGTCGAATGAAGGCGTA。

[0066] (3) Second round of PCR: Calculate the added volume according to the ratio of molar mass left arm: hygromycin fragment: right arm = 1:3:1, where the final concentration of DNA in the fusion system is 1000 ng·μL -1 , and the fusion conditions are: 95°C for 3 min; 95°C for 15 s, 56°C for 2 min, 72°C for 1 min 10 s, 72°C for 5 min, cycle 15 times to obtain a fusion fragment with a full length of about 4145 bp (SEQ ID No.5).

[0067] Dilute the fusion PCR product 2-fold and use it as the nested PCR template. After the amplification is completed, perform 1% agarose gel electrophoresis on the PCR product, cut and recover the gel at the position of the molecular weight of the fusion fragment, concentrate it to 10 μL, and the concentration of this fusion fragment is not less than 2 μg, which is used for protoplast transformation.

[0068] Primers used for cloning homologous recombination fragments

[0069] Primer name Sequence(5’-3’) yptA / AF SEQ ID No.8:GATGGAAATGACGTAGAGGATG yptA / AR SEQ ID No.:9:TCTTTCTAGAGGATCCCCGGGTACGATTATTGGTGATGGTCGCGTC yptA / BF SEQ ID No.10:ATATCATCTTCTGTCGACCTGCAGGTTTTCTTGATTGCCGATACGAAACTA yptA / BR SEQ ID No.11:GCGTAGTCGAATGAAGGCGTA yptA / OF SEQ ID No.12:TCCATCTCACGCCTGTACTACCG yptA / OR SEQ ID No.13:TGACAAGCATCCCAGCCAACTTC Hyg / F SEQ ID No.14:CGGTACCCGGGGATCCTCTA Hyg / R SEQ ID No.15:GCCTGCAGGTCGACAGAAGA P816 / R SEQ ID No.16:ATGGCTGTGTAGAAGTACTCGCC P625 / F SEQ ID No.17:CTGAATTCCCCAATGTCAAGCACT

[0070] 2. Preparation of protoplasts:

[0071] (1) Cultivate the wild-type strain in PDW at 28°C for two days. After collecting the bacterial cells, rinse them with 1.2 mol·L -1 KCl solution until transparent. Put the obtained mycelium into an enzyme digestion solution prepared with 0.5 g (0.05 g / mol) lysing enzyme and 0.1 g (0.01 g / mol) lytic enzyme, and perform enzyme digestion at 28°C and 60 rpm for 3 h. Filter the incompletely lysed mycelium with 6 layers of lens paper, and then rinse it completely with KCl solution. Centrifuge at 4°C and 4000 rpm for 10 minutes, discard the supernatant, rinse again, centrifuge at 4°C and 4000 rpm for 5 minutes, discard the supernatant, resuspend the precipitated protoplasts with 500 μL of STC buffer, and add 250 μL of PTC solution.

[0072] 3. Transformation of protoplasts

[0073] Add 2 μg of the fusion fragment to 125 μL of a concentration of 1×107 In the protoplast solution at a concentration of -1 cells / mL, perform cold shock on ice for 30 minutes. Gently add 1 mL of PTC solution, pipette and mix well, then place it statically in an incubator at 28°C. After centrifuging at 8000 rpm for 5 minutes at 4°C, discard the supernatant. Add 500 μL of STC to resuspend the precipitate, centrifuge for 1 minute, and discard the supernatant. Add 510 μL of STC, gently pipette and mix well, then quickly add 15 mL of TB3 regeneration medium incubated at 48°C for 3 h and culture for 16 - 18 h. Mix the cultured TB3 with PDA medium containing hygromycin B at a concentration of 100 μg·mL

[0074] 4. Identification of positive transformants

[0075] Transfer the transformants to a PDA plate containing hygromycin B at a concentration of 50 μg·mL -1 for resistance screening. Extract the DNA of wild-type Fusarium sacchari CNO-1 and the screened transformants using the SDS method. Use three pairs of specific primers to identify positive transformants. Among them, the two pairs of primers yptA / AF, P816 / R and yptA / BR, P625 / F are used to detect whether the target gene has been knocked out and homologous recombination has occurred; yptA / OF, yptA / OR are used to identify whether the target gene exists. The electrophoresis pattern of the finally determined positive transformants is as Figure 2 shown. A is the verification with primers yptA / OF, yptA / OR. There is no band in the △FsyptA lane. The fragment size of the wild-type CNO-1 strain is about 377 bp, which is consistent with the gene deletion result, indicating that the construction of the FsyptA gene deletion mutant is successful.

[0076] Transfer the strain with successful homologous recombination verification to a PDA plate for continuous subculture.

[0077] Table 2 Primers used for identification of positive transformants

[0078] Primer name Sequence(5’-3’) yptA / AF GATGGAAATGACGTAGAGGATG yptA / BR GCGTAGTCGAATGAAGGCGTA yptA / OF TCCATCTCACGCCTGTACTACCG yptA / OR TGACAAGCATCCCAGCCAACTTC P816 / R ATGGCTGTGTAGAAGTACTCGCC P625 / F CTGAATTCCCCAATGTCAAGCACT

[0079] 5. Verification of the FsyptA gene knockout strain by RT-PCR

[0080] Further verify the gene deletion mutant by RT-PCR. Use 18sF / R as the internal reference gene to detect whether △FsVps54 and wild-type RNA are feasible.

[0081] RT-PCR reaction system: Dilute the cDNA 5-fold and take 1 μL, 7 μL of 2×Rapid Taq Master Mix, yptA / OF (2 μmol·L -1 ) and yptA / OR (2 μmol·L -1Add 1 μL each and supplement to a 20 μL system with sterile and enzyme-free water. The reaction conditions are set as follows: 95°C for 3 min; 95°C for 15 s, 60°C for 15 s; 72°C for 30 s, 72°C for 5 min, with 35 cycles.

[0082] The results of RT-PCR are as Figure 3 shown. It is feasible to detect the RNA of wild-type and mutant strains using 18sF / R. When using the yptA / OF and yptA / OR primers, the fragment size detected in the wild-type CNO-1 strain is 398 bp, and there is no band in the ΔFsyptA lane. Therefore, the ΔFsyptA strain is negative, and the FsyptA gene is not expressed at the transcriptional level in ΔFsyptA.

[0083] Example 2

[0084] Determination of mycelial growth and conidia of the gene engineering-related strain ΔFsyptA of Fusarium sacchari:

[0085] (1) Observation of colony growth rate and growth morphology

[0086] Observation of strain morphology and determination of growth rate: Incubate the mutant strain and wild-type on PDA plates at 28°C for 4 days. Use a 7-mm punch to punch holes at the edge of the colony, and invert the agar plugs and inoculate them on PDA, MEA, and Czapek's media. Incubate at 28°C in the dark for 5 days, and record the colony diameter daily using the cross method and take pictures. Set three replicates for each strain. The results are as Figure 4 seen, Figure 4 as shown in. On PDA medium, the colony area of the mutant strain after knocking out the target gene is significantly smaller than that of the wild-type, and the spreading growth range of its mycelia on the medium surface is smaller, indicating that the mycelial growth is severely inhibited.

[0087] (2) Statistical analysis of spore production and observation of conidiophore morphology: Scrape the 5-day-old wild-type strain and gene knockout mutant PDA plates with 10 mL of sterile water, filter and collect the spores, and count them using a hemocytometer to calculate the spore yield. The spore concentration of the wild-type was counted to be 1.34×10 7 CFU / mL, while the concentration of ΔFsyptA was only 8.6×10 6 CFU / mL. Take the carnation leaves on the CLA medium after 4 days of culture and observe the morphology of conidiophores under a 40× optical microscope. The results are shown in Figure 5 , under the optical microscope, after 4 days of culture, the conidiophores on the aerial hyphae branches of the wild-type are mature and dense ( Figure 5 A in), while almost no spores are produced on the conidiophores of ΔFsyptA. (See Figure 5 B in).

[0088] Example 3

[0089] Hydrophobicity experiment:

[0090] To determine whether the FsyptA gene affects the hydrophobicity of cells, the test strains cultured on MM medium for 5 days were taken, and 30 μL of ddH 2 O, 0.2% gelatin, and 10% Tween 20 were separately dropped on the colony surface, and the colony was observed after standing for 1 minute. It can Figure 6 be clearly seen that there were no obvious changes when ddH 2 O, 0.2% gelatin, and 10% Tween 20 were dropped on the wild type and ΔFsyptA. This may be because the deletion of the FsyptA gene has no significant effect on the integrity of the cell wall.

[0091] Example 4

[0092] Observation on the effect of FsyptA gene knockout mutant strain and wild type on sugarcane disease

[0093] The wild type and mutant strains cultured in PDA for three days were made into conidial suspensions with a concentration of 1×10 6 / ml, and inoculated into 1-month-old sugarcane by the method of spray inoculation. The in vivo inoculation experiment of sugarcane showed that the wild type had severe disease, with chlorotic and twisted leaves, while the disease index of △FsyptA was significantly lower than that of the wild type strain, and the disease symptoms were mild and almost invisible. This indicates that the pathogenicity of the FsyptA gene knockout mutant strain on sugarcane is sharply weakened.

[0094] In summary, the FsyptA gene is an important pathogenic factor for Fusarium sacchari to infect sugarcane. It may severely reduce the pathogenicity of Fusarium by inhibiting the growth of hyphae and spores. By regulating the FsyptA gene directionally, it can provide theoretical and technical support for controlling Fusarium diseases in sugarcane production practice.

[0095] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments according to these embodiments without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A sugarcane Fusarium virulence-related gene FsyptA, characterized in that: The nucleotide sequence of the sugarcane Fusarium virulence-related gene FsyptA is shown in SEQ ID No.

1.

2. Use of knocking out or silencing the sugarcane Fusarium virulence-related gene FsyptA according to claim 1 in reducing the virulence of sugarcane Fusarium virulence.

3. Use of knocking out or silencing the sugarcane Fusarium virulence-related gene FsyptA according to claim 1 in reducing the mycelial growth rate of sugarcane Fusarium virulence.

4. Use of knocking out or silencing the sugarcane Fusarium virulence-related gene FsyptA according to claim 1 in reducing the spore production of sugarcane Fusarium.

5. Use of the sugarcane Fusarium virulence-related gene FsyptA according to claim 1 as an inhibition target or a knockout target in preventing and controlling sugarcane tip rot caused by sugarcane Fusarium serrata.

6. A method for knocking out the sugarcane Fusarium virulence-related gene FsyptA of claim 1 in sugarcane Fusarium virulence, characterized in that: The following steps are involved: 1) fusing the left homology arm sequence, the right homology arm sequence and the hygromycin resistance gene sequence of the sugarcane Fusarium virulence-related gene FsyptA to obtain a fusion fragment; The nucleotide sequence of the left homology arm sequence of the sugarcane Fusarium virulence-related gene FsyptA is shown in SEQ ID No. 2, and the nucleotide sequence of the right homology arm sequence is shown in SEQ ID No. 3; The nucleotide sequence of the hygromycin resistance gene sequence is shown in SEQ ID No.4; The nucleotide sequence of the fusion fragment is shown in SEQ ID No.5; 2) The fusion fragment obtained in step 1) is transformed into the protoplasts of Fusarium saccharum by a protoplast transformation method, and the Fusarium saccharum pathogenicity-related gene FsyptA in Fusarium saccharum is knocked out.

7. The knockout method according to claim 6, characterized in that: In the step 1), the molar ratio of the left homology arm sequence, the right homology arm sequence and the hygromycin resistance gene sequence of the sugarcane Fusarium virulence-related gene FsyptA is 1:3:

1.

8. The knockout method according to claim 6, characterized in that The total concentration of the left homology arm sequence, the right homology arm sequence and the hygromycin resistance gene sequence in the fusion system of step 1) is 1000 ng / μL.

9. The knockout method according to claim 6, characterized in that: The fusion method in step 1) includes PEG-mediated protoplast fusion.

10. The knockout method according to claim 6, characterized in that: In the step 2) of the protoplast transformation method, the volume ratio of the fusion fragment mass to the protoplast solution is 2 μg:125 μL.

Images