A biosynthetic gene cluster of a polyene macrolide natural product mandimycin, natural products and applications thereof
By discovering and knocking out the MandQ gene in the mandimycin biosynthesis gene cluster, an engineered strain CPU002 was constructed to prepare mandimycin B. This solved the problems of drug resistance and toxic side effects of existing polyene antifungal drugs, and achieved strong antibacterial activity and good water solubility against multidrug-resistant fungi.
Patent Information
- Application Number
- CN202410595877.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-12-20
- Filing Date
- 2024-05-14
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2044-05-14
AI Technical Summary
Existing polyene antifungal drugs, such as amphotericin B, suffer from increased drug resistance, significant toxic side effects, and low oral bioavailability, failing to meet clinical needs and proving ineffective against multidrug-resistant fungi.
The mandimycin biosynthesis gene cluster was discovered through phylogenetic-guided targeted mining. The key glycosyltransferase gene MandQ was knocked out, and an engineered strain CPU002 was constructed to biosynthesize the novel antifungal antibiotic mandimycin B. The polyene macrolide natural product mandimycin B was then prepared by fermentation using this engineered strain.
Mandimycin B exhibits potent and broad-spectrum antibacterial activity against a variety of fungal pathogens, with a particularly significant inhibitory effect against multidrug-resistant strains. It is highly water-soluble and targets fungal cell membrane phospholipid molecules, leading to fungal death, thus overcoming the problems of drug resistance and toxic side effects of existing drugs.
Smart Images

Figure CN120060293B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial natural products, and particularly relates to a biosynthetic gene cluster of a polyene macrolide natural product, mandimycin, its natural products, and applications. Background Technology
[0002] With the widespread use of antifungal drugs, the increasing number of immunodeficient and immunocompromised patients, and the limited variety of antifungal drugs, fungal infections have become a major safety concern threatening human health, thus urgently requiring the search for novel antifungal drugs. Currently, the main antifungal drugs used clinically include echinocandins (such as cabobfenac), polyene macrolides (such as amphotericin B), azoles (such as fluconazole), and 5-fluorocytosine (Nature Reviews Microbiology 2022; 20:9557-571). Among them, polyene macrolide antibiotics, represented by amphotericin B, have broad-spectrum and potent antifungal activity and low resistance. Since the 1950s, they have been first-line antifungal drugs in clinical practice and have been included in the WHO's list of essential drugs for the treatment of fungal infections (Antibiot Annu. 1955; 3:587-91; Curr Opin Microbiol. 2022; 70:102208). Currently, various polyene antibiotics with different structural types have been isolated from nature. Their main skeletons mainly include macrocyclic structures with 26, 28, 36, and 38 rings, 3 to 7 double bonds, and 1-2 deoxyglucose substituents (Mol Phylogenet Evol. 2018; 127:239-247). The known polyene antibiotics mainly kill fungal pathogens by binding with ergosterol, a steroid molecule on the fungal cell membrane, forming transmembrane channels, releasing important intracellular ions and small molecules, and thus exerting potent antifungal activity (Proc NatlAcad Sci US A. 2012; 109(7):2234-9; Proc NatlAcad Sci U SA. 2011; 108(17):6733-8).
[0003] Although marketed polyene antifungal drugs (such as amphotericin B, nystatin, and natamycin) possess significant bactericidal activity, broad spectrum, and relatively low resistance to fungal pathogens, making them potent antifungal agents, their long-term use has led to increasing fungal resistance. Their extremely low water solubility and severe toxic side effects mean that existing polyene antifungal drugs cannot meet clinical needs. Amphotericin B, in addition to its broad-spectrum and potent activity, has the outstanding advantage of low resistance. However, its disadvantages include inactivity against clinically observed multidrug-resistant bacteria, significant toxic side effects, and low oral bioavailability, thus limiting its clinical application. Summary of the Invention
[0004] Objective of the Invention: To address the problems existing in the prior art, this invention aims to provide a biosynthetic gene cluster for the polyene macrolide natural product mandimycin. The nucleotide sequence of the mandimycin biosynthetic gene cluster is shown in SEQ ID NO.1. This gene cluster can produce a novel polyene macrolide antifungal natural product. Furthermore, this invention uses genetic manipulation to knock out the key glycosyltransferase gene of the mandimycin biosynthetic gene cluster, constructing the engineered strain CPU002. The CPU002 engineered strain is used to biosynthesize a novel antifungal antibiotic natural product, mandimycin B, which lacks Atratcynose A. This solves the technical problems currently faced in clinical practice, such as the limited variety of antifungal drugs, significant toxic side effects, low oral bioavailability, and ineffectiveness against multidrug-resistant fungi, which restrict its clinical application. This invention also provides the polyene macrolide natural products mandimycin and mandimycin B, and their applications.
[0005] Technical solution: In order to achieve the above objectives, the present invention provides a biosynthetic gene cluster of mandimycin, a polyene macrolide natural product, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0006] The preparation method of mandimycin, a polyene macrocyclic lactone natural product of the present invention, includes the following steps:
[0007] The strain containing the mandimycin biosynthesis gene cluster was used to prepare seed culture, which was then fermented, extracted, separated and purified to obtain the natural product mandimycin.
[0008] The strain containing the mandimycin biosynthesis gene cluster is Streptomyces netropsis DSM40259.
[0009] The present invention relates to the application of a biosynthetic gene cluster of the polyene macrolide natural product mandimycin in the preparation of the natural product mandimycin and the natural product mandimycinB.
[0010] The preparation method of the polyene macrocyclic lactone antifungal natural product mandimycin B according to the present invention includes the following steps:
[0011] The MandQ gene in a strain containing the mandimycin biosynthesis gene cluster was knocked out to obtain engineered bacteria. The resulting seed culture was then cultured, fermented, extracted, separated, and purified to obtain the natural product mandimycinB. The nucleotide sequence of the MandQ gene is shown in SEQ ID NO.2.
[0012] In this method, the MandQ gene in the mandimycin biosynthesis gene cluster of Streptomyces netropsis DSM40259 was knocked out by indirect transfer between Streptomyces and Escherichia coli to obtain the engineered strain CPU002. The engineered strain CPU002, which lacks glycosyltransferase, was then fermented, extracted, separated, and purified to obtain mandimycin B.
[0013] The present invention relates to a polyene macrocyclic lactone natural product, mandimycin or mandimycin B, and a pharmaceutically acceptable salt thereof. The structural formula of the natural product mandimycin is shown in Formula I, and the structural formula of the natural product mandimycin B is shown in Formula II.
[0014]
[0015] Furthermore, the core parent ring of the polyene macrolide natural product mandimycin or the mandimycin B structure is a 38-membered macrolide, wherein: C20-C29 are conjugated pentaene structures, C32 is a monoene structure; C19 is connected to a carboxylic acid; C3, C7, C10, and C13 are connected to a β-hydroxyl group; C15 is connected to an α-hydroxyl group; C13 and C15 are connected by an oxygen bridge; C1 is an ester group; C5 is a ketone group; C34, C36, and C37 are connected to an α-methyl group; and C16 is connected to a formic acid group.
[0016] The use of the polyene macrolide natural product mandimycin or mandimycin B and its pharmaceutically acceptable salts in the preparation of antifungal drugs.
[0017] Furthermore, the fungus is any one of several key fungal pathogens, such as Candida, Aspergillus, Cryptococcus, Mucor, and Fusarium.
[0018] Furthermore, the Candida species is Candida albicans, Candida auris, Candida glabrata, Candida tropicalis, or Candida subglabrata.
[0019] The present invention provides a pharmaceutical composition for an antifungal drug comprising the polyene macrolide natural product mandimycin or natural product mandimycin B and a pharmaceutically acceptable carrier.
[0020] Furthermore, the pharmaceutical composition is a capsule, powder, tablet, granule, pill, injection, syrup, oral liquid, inhaler, ointment, suppository, or patch.
[0021] The application of the antifungal drug composition described in this invention in the preparation of antifungal drugs.
[0022] Furthermore, the fungus is any one of several key fungal pathogens, such as Candida, Aspergillus, Cryptococcus, Mucor, and Fusarium.
[0023] This invention discovers a biosynthetic gene cluster mandimycin-BGC expressing mandimycin from the Microbial Secondary Metabolites Database (MiSM) using a phylogenetic-guided targeted mining approach.
[0024] mandimycin-BGC contains 6 core genes (mandD, mandE, mandF, mandL, mandM, mandN) that encode 19 polyketide synthase modules.
[0025] Combinatorial biosynthesis has led to the discovery of a natural product, mandimycin, with potent and broad-spectrum activity against multidrug-resistant fungi. Mandimycin possesses a unique chemical structure with three deoxysugar substituents (including a mycosamine at C19, a dideoxysaccharide atratcynose A((α-L-oleandropyranosoyl-(1→4)-β-D-digitoxopyranoside) at C35, a pentene structural unit at C20, a monoene structural unit at C32, and a 38-membered ring with a ketone group at position 5.
[0026] The mandimycin compound of this invention is a natural product produced by fermentation of *Streptomyces netropsis* DSM40259. The screening of this *Streptomyces* utilized a targeted mining technique combining big data analysis, phylogenetic analysis, and cluster analysis: using conserved carbamoyl glycosyltransferases as sequence tags, a Hidden Markov Model was used to mine all biosynthetic gene clusters expressing carbamoyl glycosyltransferase sequence tags from the Microbial Secondary Metabolite Database (MiSM). Then, combined with phylogenetic analysis, a novel branch of the biosynthetic gene cluster *mandimycin-BGC* was identified, with its gene sequence shown in SEQ ID NO. 1. Analysis of potentially containing this gene cluster revealed this specific *Streptomyces* (DSM40259), which includes the biosynthetic gene cluster *mandimycin-BGC*. Mandimycin is unstable under acidic conditions and readily undergoes dehydration and desylase removal; therefore, neutral or weakly alkaline organic solvents can be used to dissolve mandimycin.
[0027] In investigating the mechanism of action of this compound, feeding experiments, scanning electron microscopy, ion concentration detection, and isothermal calorimetric titration were employed. The preparation of mandimycin requires exploring fermentation conditions to remove fermentation byproducts and performing extraction, separation, and purification processes on the crude product.
[0028] This invention discovers a novel antifungal drug target. Mandimycin targets fungal cell membrane phospholipid molecules (including phosphatidylinositol, phosphatidylglycerol, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and cardiolipin), particularly phosphatidylinositol, causing the formation of important intracellular ions (including K+) in fungi. + The efflux of fungi (such as spores) leads to the death of fungal cells, a mechanism that has not yet been reported in antifungal drugs.
[0029] Due to its unique multi-target mechanism of action, mandimycin does not induce drug resistance under laboratory conditions and exhibits potent activity against strains resistant to clinical antifungal drugs.
[0030] This invention discovered a novel biosynthetic gene cluster in the strain *Streptomyces netropsis* DSM 40259 through pan-genome mining. Further fermentation purification and knockout experiments confirmed that its product was mandimycin. Mandimycin is a polyene macrolide antifungal antibiotic with a novel mechanism of action. It targets phospholipid molecules on the fungal cell membrane, particularly the phosphatidylinositol structure, leading to the efflux of important intracellular ions and small molecules, resulting in fungal death. Mandimycin exhibits potent and broad-spectrum antifungal activity against various key fungal pathogens, including *Candida*, *Aspergillus*, *Cryptococcus*, *Mucor*, and *Fusarium*. Furthermore, this invention utilizes indirect gene transfer between *Streptomyces* and *Escherichia coli* to knock out the glycosyltransferase-MandQ responsible for atratcynose A synthesis in mandimycin BGC, obtaining a glycosyltransferase-deficient engineered strain CPU002. This engineered strain was then further fermented to biosynthesize a novel polyene macrolide natural product, mandimycin B. The mandimycin B of this invention is a natural product produced by fermentation of the engineered strain CPU002. Specifically, it is produced by knocking out the MandQ gene in the mandimycin biosynthesis gene cluster of Streptomyces netropsis DSM 40259 using gene knockout technology, and then fermenting the obtained CPU002 engineered strain in FS / 9 medium.
[0031] This invention discovered the key enzyme MandQ responsible for the synthesis of mandimycin B, atratcynose A, during the preparation and synthesis of the natural product mandimycin B. By knocking out 1072 genes in MandQ, the glycosyltransferase function of MandQ was disrupted, resulting in the engineered strain CPU002 lacking the MandQ enzyme. Using this strain, a novel mandimycin derivative, mandimycin B, without atratcynose A, was synthesized. Experiments showed that mandimycin B also possesses potent and broad-spectrum antifungal activity. Unlike mandimycin's mechanism of action, mandimycin B exerts its antifungal activity by binding to ergosterol on the fungal cell membrane. The novel mandimycin derivative mandimycin B provided by this invention differs from the mandimycin compound. Although mandimycin B shares the same parent nucleus as mandimycin, it lacks the disaccharide structure of the key atratcynose A and therefore does not possess the disaccharide structural unit of atratcynose A. Mandimycin B has a different mechanism of action than mandimycin. It exerts its antifungal activity by binding to ergosterol in the fungal cell membrane and has no affinity for the phospholipid molecules that mandimycin binds to.
[0032] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:
[0033] This invention is the first to propose a biosynthetic gene cluster for the polyene macrocyclic lactone natural product mandimycin. The strain containing the mandimycin biosynthetic gene cluster is prepared into a seed liquid and then cultured, fermented, extracted, separated and purified to obtain the natural product mandimycin.
[0034] The natural product mandimycin obtained in this invention exhibits potent antibacterial activity and a broad-spectrum antibacterial activity against various WHO-listed priority multidrug-resistant pathogenic microorganisms, including Candida, Aspergillus, and Cryptococcus. The minimum inhibitory concentration (MIC) of the compound against Candida, particularly against multidrug-resistant strains including Candida albicans and Candida auris, is 1-2 times that of clinically used nystatin and comparable to amphotericin B, ranging from 0.25-1 μg / mL. Its activity against multidrug-resistant Cryptococcus neoformans reaches 0.125 μg / mL, which is 32 times that of cabofenin, 64 times that of fluconazole, and 128 times that of 5-fluorocytosine. Its activity against multidrug-resistant Aspergillus fumigatus reaches 2 μg / mL, which is 32 times that of fluconazole and 16 times that of 5-fluorocytosine. It also shows good antibacterial activity against amphotericin B-resistant strains. This demonstrates that mandimycin possesses broad-spectrum antifungal activity and exhibits potent antifungal activity against clinically resistant strains of antifungal drugs. The natural product mandimycin B of this invention exhibits potent antifungal activity and a broad-spectrum antifungal spectrum against various WHO-listed priority multidrug-resistant pathogenic microorganisms, including Candida, Aspergillus, and Cryptococcus. Specifically, the minimum inhibitory concentration (MIC) against Candida, particularly against multidrug-resistant strains including Candida albicans and Candida auris, is between 1-2 μg / mL; the activity against multidrug-resistant Cryptococcus neoformans reaches 0.5 μg / mL; and the activity against multidrug-resistant Aspergillus fumigatus reaches 2 μg / mL, which is 32 times that of fluconazole and 16 times that of 5-fluorocytosine.
[0035] The natural product mandimycin of this invention targets a different site than known antifungal drugs; instead, it acts on phospholipids on the fungal cell membrane, with phosphatidylinositol on the fungal cell membrane being the most potent target. d The value was 21.9 μM; secondly, there was a phosphatidylglycerol target, K. d Value was 28.2 μM; phosphatidylserine target, K d Value 30.9 μM; phosphatidylethanolamine target, K d Value was 36.5 μM; phosphatidylcholine target, K d Value was 36.8 μM; sphingomyelin target, K d Value 50 μM; cardiolipin target, K d The concentration was 63.6 μM. Furthermore, under laboratory conditions, low concentrations of mandimycin did not induce drug-resistant bacteria. Compared to amphotericin B, the compounds of this invention exhibit significantly better water solubility, being 9700 times more water-soluble.
[0036] In vivo antifungal activity assays in mice showed that mandimycin exhibited significant antifungal activity against multidrug-resistant Candida albicans and multidrug-resistant Candida auris, demonstrating a dose-dependent effect. At a dose of 5 mg / kg, the number of Candida albicans BNCC186382 cells decreased by 3 log10, and the number of Candida auris BNCC357785 cells decreased by 2 log10; at a dose of 10 mg / kg, the number of Candida albicans BNCC186382 cells decreased by 3.6 log10. The concentration of *Candida auris* BNCC357785 fungal cells decreased by 2.5 log10; at a dose of 20 mg / kg, the concentration of *Candida albicans* BNCC186382 fungal cells decreased by 4.2 log10, and the concentration of *Candida auris* BNCC357785 fungal cells decreased by 3 log10; in a pan-drug-resistant *Candida auris* infection model resistant to amphotericin B, mandimycin still showed good in vivo activity, with a 2.3 log10 decrease in strain concentration at 10 mg / kg. No acute toxicity was observed in in vivo animal experiments at all different concentrations. The natural product mandimycin of this invention can be used to prepare antifungal drugs. Attached Figure Description
[0037] Figure 1 This refers to the process of mining the mandimycin biosynthesis gene cluster;
[0038] Figure 2 The biosynthetic gene cluster and structure of mandimycin;
[0039] Figure 3 The predicted biosynthetic process of mandimycin;
[0040] Figure 4 The ultraviolet spectrum of mandimycin;
[0041] Figure 5 HPLC and activity comparison of products from mandimycin gene knockout strains and wild-type strains;
[0042] Figure 6 High-resolution mass spectrum of mandimycin (A: positive ion, B: negative ion);
[0043] Figure 7 for mandimycin 1 H-NMR (DMSO-d6) nuclear magnetic resonance spectrum;
[0044] Figure 8 for mandimycin 13 C-NMR (DMSO-d6) nuclear magnetic resonance spectrum;
[0045] Figure 9 The image shows the HSQC-NMR (DMSO-d6) nuclear magnetic resonance image of mandimycin.
[0046] Figure 10 The image shows the HMBC-NMR (DMSO-d6) nuclear magnetic resonance spectrum of mandimycin.
[0047] Figure 11 The COSY-NMR (DMSO-d6) nuclear magnetic resonance spectrum of mandimycin;
[0048] Figure 12 The ROESY-NMR (DMSO-d6) nuclear magnetic resonance spectrum of mandimycin;
[0049] Figure 13 The structure of mandimycin and its two-dimensional NMR spectrum;
[0050] Figure 14 For the chiral bioinformatics analysis of mandimycin polyketide reductase;
[0051] Figure 15 Mandimycin is cytotoxic to HepG2 cells;
[0052] Figure 16 The hemolytic activity of mandimycin;
[0053] Figure 17 To demonstrate the in vivo antifungal activity of mandimycin, (A) infection model of multidrug-resistant Candida albicans BNCC186382; (B) infection model of multidrug-resistant Candida albicans BNCC357785; (C) infection model of pan-drug-resistant Candida auris AMR05.
[0054] Figure 18 A mouse model of disseminated candidiasis;
[0055] Figure 19 Invasive candidiasis mouse model;
[0056] Figure 20 Mouse model of fungal skin infection;
[0057] Figure 21 Mouse model of vaginal infection;
[0058] Figure 22 In vivo pharmacokinetic studies of mandimycin;
[0059] Figure 23 In vivo nephrotoxicity evaluation of mandimycin;
[0060] Figure 24 The results show the resistance to mandimycin and the fold change in activity against other polyene-resistant bacteria, including (A) amphotericin B-resistant bacteria, (B) natamycin-resistant bacteria, and (C) nystatin-resistant bacteria.
[0061] Figure 25 The bactericidal curve of mandimycin;
[0062] Figure 26 Scanning electron microscopy observation of Candida albicans after treatment with mandimycin;
[0063] Figure 27 Changes in K+ concentration after treating Candida albicans with mandimycin;
[0064] Figure 28 The inhibition curves of different components of fungal cells on mandimycin activity are shown.
[0065] Figure 29 The exothermic curve of small phospholipid molecules to mandimycin;
[0066] Figure 30 The gene knockout is a 1072bp fragment of MandQ in the mandimycin gene cluster;
[0067] Figure 31 To determine mandimycin B by HPLC;
[0068] Figure 32 For mandimycin B 1 H spectrum;
[0069] Figure 33 For mandimycin B 13 C spectrum;
[0070] Figure 34 The spectrum of mandimycin B is shown in HSQC.
[0071] Figure 35 The spectrum is for mandimycin B HMBC.
[0072] Figure 36 The COSY spectrum for mandimycin B;
[0073] Figure 37 The spectrum for mandimycin B TOCSY;
[0074] Figure 38 The correlation between the key HMBC and COSY spectra of mandimycin B;
[0075] Figure 39 Identify the mandimycin B target for UV-vis;
[0076] Figure 40 To identify the mandimycin B target for ITC. Detailed Implementation
[0077] The technical solution of the present invention will be further described below with reference to the accompanying drawings. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Experimental methods not specifically described in the embodiments are generally performed under conventional conditions or according to the manufacturer's recommendations.
[0078] Among them, strain Streptomyces netropsis DSM40259 was purchased from the DSMZ platform. Casein pancreatic digestion fluid (purchased from Guangdong Huankai Microbial Technology Co., Ltd., catalog number 024048). Soybean digestion fluid (purchased from Beijing Hongrun Baoshun Technology Co., Ltd., catalog number Y030A220816). Beef extract (purchased from Beijing Hongrun Baoshun Technology Co., Ltd., catalog number Y014C 230809).
[0079] Example 1
[0080] Discovery of the mandimycin biosynthesis gene cluster
[0081] like Figure 1 The diagram illustrates the process of mining the mandimycin biosynthetic gene cluster. Based on the known carboxylic acid transferase sequence information of polyene macrolide natural products (Table 1), conserved protein structural sequences were analyzed and obtained. A unique hidden Markov model for polyene carboxylic acid transferases was constructed. This model was then used to perform sequence similarity scanning on a microbial secondary metabolite database. For sequences with a similarity value less than 1 e^(-1 / 2), the sequence similarity was determined. -181 The protein sequence was considered a polyunsaturated natural product-associated carbonase sugar sequence, and the functional gene cluster it belongs to is a potential novel polyunsaturated natural product encoding functional gene cluster. Using this method, 280 duplicate candidate sequences were obtained. A phylogenetic tree was constructed for these sequences, and the phylogenetic relationships between different sequences were analyzed, such as... Figure 2 As shown, the results revealed a new evolutionary branch encoding a novel polyene natural product, which we named mandimycin-BGC, with the sequence shown in SEQ ID NO.1. Figure 3As shown in Table 2, the predicted biosynthesis process of mandimycin is illustrated, with functional annotations of the biosynthetic genes listed. Further screening revealed that the *Streptomyces netropsis* DSM40259 strain contains the biosynthetic gene cluster *mandimycin-BGC*, which can be used for the fermentation of the natural product mandimycin.
[0082] Table 1. Carbonase sugar sequence information of known polycyclic macrolide natural products.
[0083]
[0084] Table 2. Functional annotations of the biosynthetic gene clusters of mandimycin.
[0085]
[0086]
[0087] Example 2
[0088] bio-fermentation of mandimycin
[0089] (1) Preparation of spore suspension
[0090] Spore suspensions were prepared by spreading Streptomyces netropsis DSM40259 containing the mandimycin biosynthesis gene cluster on ISP4 solid medium (containing 10.0 g soluble starch, 1.0 g dipotassium hydrogen phosphate, 1.0 g magnesium sulfate, 1.0 g sodium chloride, 2.0 g ammonium sulfate, 2.0 g calcium sulfate, 0.001 g ferrous sulfate, 0.001 g manganese chloride, 0.001 g zinc sulfate, 15.0 g agar, pH 7.2 per liter) and culturing at 30°C for 5 days.
[0091] (2) Preparation of seed solution:
[0092] Take 1 mL of spore suspension and inoculate it into 50 mL of TSB medium (each liter of medium contains 17.0 g casein pancreatic digestion solution, 3.0 g soybean digestion solution, 5.0 g sodium chloride, 2.5 g dipotassium hydrogen phosphate, 2.5 g glucose monohydrate, pH = 7.3) and place it on a shaker (conditions: 200 rpm, temperature 30℃) for 2 days to prepare seed culture.
[0093] (3) Preparation of fermentation broth:
[0094] Transfer 0.5 mL of the seed solution prepared in step (2) of this embodiment to 50 mL of LF2 fermentation medium (each liter of medium contains: 69.0 g glucose, 25.0 g beef extract, 9.0 g CaCO3 and 0.1 g KH2PO4) and culture for 10 days (shaking speed 200 rpm, 30°C) to prepare fermentation broth.
[0095] Example 3
[0096] Extraction, separation and purification of mandimycin
[0097] After fermentation, n-butanol (fermentation broth to n-butanol volume ratio 1:1) was added to the fermentation flask and extracted overnight by stirring (100 rpm). The n-butanol extract was evaporated to dryness using a rotary evaporator and then dissolved in methanol to obtain a crude extract. The crude extract was purified using a two-step method: first, isocratic elution was performed using YMC-GEL C... 18 Column chromatography was performed using a powdered (12nm × 50μm) packed column. The column was equilibrated with 2 cv 10% methanol (H2O:CH2OH 9:1), and methanol solution was added. Elution was performed using methanol-water solutions of different concentrations (10%, 30%, 50%, 70%, 90%, 100%), one 100mL vial per bottle. Components were detected using UPLC-MS. Fractions containing mandimycin (eluent in 90% methanol-water solution) were collected and evaporated to dryness. UPLC-MS conditions were as follows: C18 column (Waters, T3-1.8μm, 2.1 × 100mm); mobile phase: A phase - pure water (0.1% formic acid), B phase - acetonitrile (0.1% formic acid); flow rate: 0.6 mL / min; gradient of mobile phase B: 30%-90%, incrementing by 10% per minute. MS detection range: 200-2000; simultaneous positive and negative modes. The semi-pure product was then further purified using semi-preparative reversed-phase high-performance liquid chromatography (RP-HPLC). The RP-HPLC conditions were as follows: C18 column (Shimadzu, ShimNet HE C18-AQ, 5μm OBD, 19×250mm column); solvent A: deionized water; solvent B: acetonitrile. The flow rate was 3 mL / min, with a solvent B gradient of 30%-90%, increasing by 1.5% per minute, and detection across the entire wavelength range (190 nm-800 nm). Figure 4 As shown, the UV spectrum of mandimycin contains characteristic UV absorption peaks (320, 335, 352 nm) of conjugated pentenes. Collecting mandimycin natural product (yellow powder) with a purity of over 95% is the purified natural product mandimycin, with a yield of 4-6 mg / L fermentation broth.
[0098] Example 4
[0099] In vivo knockout verification of mandimycin
[0100] To investigate the relationship between mandimycin-BGC and conjugated pentaene polyene natural products, genetic manipulation was performed on the *Streptomyces* strain that produces this compound. PCR amplification of the upstream and downstream 1kb homologous arms of mandL (primer sequences shown below) was performed and cloned into the pKC1139 vector to construct the pKC1139-MandL_KO knockout vector. The latter, through *Streptomyces* conjugation transfer assays, knocked out 692 key bases from position -334 to +358 of MandL (Table 2). A comprehensive comparative analysis of secondary metabolites was conducted between wild-type and knockout strains, such as... Figure 5 The results confirmed that the conjugated pentene natural product was a biosynthetic product of mandimycin-BGC, and the compound was named mandimycin.
[0101]
[0102] Example 5
[0103] Structural identification of mandimycin
[0104] Example 3: The purified mandimycin was a yellow powder, such as... Figure 6 As shown, OrbiTrap high-resolution analysis revealed its protonated ion to be m / z 1198.6344 [M+H]. + m / z 1196.6228 [MH] - This indicates that its molecular formula is C 60 H 95 NO 23 (Δppm-1.97), containing 14 double bond equivalents (DBE). For example... Figure 4 As shown, the UV-Vis spectrum of mandimycin in methanol shows maximum absorption wavelengths of 320, 335, and 352 nm, indicating the presence of a conjugated pentene structure. The mandimycin isolated and purified in Example 4 was dissolved in deuterated DMSO and analyzed using a 700M NMR instrument. Figures 7-12 As shown, H-spectrum, C-spectrum, and two-dimensional spectra such as HSQC, HMBC, and COSY were obtained to determine the structure of mandimycin. The structure of mandimycin... 1 H and 13 C10 NMR spectroscopy data revealed 12 allyl protons (δ1000- ... H 5.60-6.30, δ C 129.0-136.0), multiple oxymethylene (δ-methyl) compounds C 63.0-87.0) and three carbonyl groups (δ CThe NMR signals at 208.4, 174.8, and 170.1 nm indicate that mandimycin possesses a highly oxidized polyene macrocyclic ketone skeleton. A 38-membered macrocyclic ketone skeleton was confirmed by a series of 2D NMR techniques (HSQC, HMBC, COSY, ROSEY). Furthermore, the NMR spectrum was determined by H-3 (δ¹⁰) NMR. H 4.29), H-4 (δ) H 2.53; 2.59) and H-6 (δ H 2.42, 2.47) to C-5 (δ C The HMBC correlation of 208.4) further confirms that C5 is substituted with a ketone group, which is different from the case of hydroxyl or methylene substitution of C5 in other 38-membered macrocyclic ketone polyene antibiotics.
[0105] By corresponding to the three acetal carbons (δ) H-1′ 4.49, δ C-1′ 96.8; δ H-1″ 4.42, δ C-1″ 99.5; δ H-1″′ 4.61, δ C-1″′ The presence of three glycosyl groups in the mandimycin structure was determined by NMR signals of 100.0 g / L. COSY and HMBC spectroscopic analyses revealed the presence of one mycosamine, one digitoxose, and one 3-O-methyldigitoxose in mandimycin. Further analysis using H-1′(δ) H 4.49) to C-19 (δ) C HMBC correlation observation (74.7) confirmed the C-19 link between mycosamine and the macrocyclic ketone. This was achieved by analyzing H-1″ (δ... H 4.42) to C-35 (δ) C The HMBC correlation support of 84.1) confirmed the connection between digitoxose and C-35. Furthermore, the connection was established by analyzing H-1″′ (δ... H 4.61) to C-4″(δ C HMBC correlation confirmation (86.8) revealed a glycosidic bond between 3-O-methyldigitoxose and digitoxose between C-1″′ and C-4″. This is the first report of trisaccharide substitution in polyene macrolide antibiotics. 1 H and 13 The C-spectrum (DMSO-d6) NMR data are shown in Table 3.
[0106] Table 3 Mandimycin 1 H and 13 C-spectrum (DMSO-d6) NMR data
[0107]
[0108]
[0109] *The assignment of some carbon signals was supported by HSQC and HMBCcorrelations. # The coupling constants for proton signals were not provided asmost signals are highly overlapped orbroad.
[0110] Furthermore, based on H-spectrum, C-spectrum, and two-dimensional spectra such as HSQC, HMBC, and COSY (… Figures 7-13 ) and chiral bioinformation of mandimycin polyketide synthase ( Figure 14 Analysis revealed that the specific configurations of the natural product mandimycin of this invention are 2R, 10R, 11S, 12S, 13R, 14R, 16R, and 18R. The natural product mandimycin is shown in Formula I:
[0111]
[0112] Example 6
[0113] water solubility of mandimycin
[0114] Methanol stock solutions of amphotericin B (1.2 mg / mL) and mandimycin (12 mg / mL) purified in Example 3 were prepared. 100 μL fractions of each stock solution were freeze-dried under vacuum for 24 hours. 50 μL (amphotericin B) or 2 μL (mandimycin) of 10 mmol Tris-HCl buffer (pH 7.0) was added to the freeze-dried samples, and the solutions were saturated by vortexing for 15 minutes. The solutions were centrifuged at 12000 rpm for 3 minutes, and the resulting supernatants were diluted in Tris-HCl buffer (10-fold for amphotericin B; 1000-fold for mandimycin). 10 μL of each solution was injected, and the concentration of the compounds in the solution was determined by measuring the UV absorption spectrum using a Shimadzu PDA detector spectrophotometer. Specifically, amphotericin B and mandimycin were accurately weighed and dissolved in DMSO to prepare a 2 mg / mL stock solution. Amphotericin B was quantified using the peak area of the characteristic heptaene UV peak at its maximum absorbance of 384 nm; mandimycin was quantified using the peak area of the characteristic pentaene UV peak at its maximum absorbance of 334 nm. Standard curves showing the relationship between the UV absorption peak area and mass for mandimycin and amphotericin B were plotted, and the solubility of mandimycin and amphotericin B in aqueous solution was calculated. As shown in Table 4, the solubility of mandimycin was 8.07 mg / mL, which is 9700 times that of amphotericin B.
[0115] Table 4. Solubility test of mandimycin
[0116]
[0117] Example 7
[0118] Bioactivity analysis of mandimycin
[0119] (1) In vitro detection of anti-multidrug-resistant bacteria activity
[0120] Using the CLSI standard, the antimicrobial activity of mandimycin against priority fungal pathogens published by the WHO was determined. The results are shown in Table 5 below. Mandimycin has potent and broad-spectrum activity against multidrug-resistant fungi.
[0121] Table 5 Antifungal activity of mandimycin
[0122]
[0123] Note: CPF R Caspofungin resistance; FCA RFluconazole resistance; TBF R ,Terbinafine resistance; 5-FU R ,5-Fluorocytosine resistance; Amp R ,Amphotericin Bresistance.All MIC values were measured in duplicate and repeated three independent times with consistent results.
[0124] Meanwhile, under the same experimental conditions, the minimum inhibitory concentration (MIC) of the natural product mandimycin against multidrug-resistant bacteria, including Candida albicans and Candida auris, was 1-2 times that of clinically used nystatin A1, and its activity was comparable to that of amphotericin B, ranging from 0.25-1 μg / mL. Its activity against multidrug-resistant Cryptococcus neoformans reached 0.125 μg / mL, which is 32 times that of cabofenin, 64 times that of fluconazole, and 128 times that of 5-fluorocytosine. Its activity against multidrug-resistant Aspergillus fumigatus reached 2 μg / mL, which is 32 times that of fluconazole and 16 times that of 5-fluorocytosine. It also showed good antibacterial activity against amphotericin B-resistant strains.
[0125] (2) Cytotoxicity of mandimycin
[0126] The cytotoxicity of mandimycin was determined using the MTT assay (2-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide). HepG2 cells cultured in DMEM (containing 10% fetal bovine serum) were seeded into 96-well flat-bottom microplates (2,500 cells per well) and cultured at 37°C and 5% CO2. After 24 hours, the medium was removed, and 100 μl of fresh medium containing serial concentrations of mandimycin (maximum DMSO concentration less than 0.25%) was added. After incubation at 37°C for 48 hours, the medium was removed, and 110 μl of MTT solution (10 μl of 5 mg / ml MTT premixed with 100 μl of DMEM in mandimycin) was added to each well. After culturing at 37°C and 5% CO2 for 3 hours, 100 μl of dissolving buffer (40% DMF, 16% SDS, and 2% acetic acid aqueous solution) was added to dissolve the precipitate. The absorbance of each well was then measured at OD570 nm using a microplate reader (Epoch microplate spectrophotometer, BioTek). Amphotericin B was used as a positive control. The IC50 value (Prism 7.0) is the concentration required for each compound to inhibit cell growth by 50% relative to the no-compound control. The IC50 of mandimycin against Hepg2 cells was 57.56 μM, against HK2 cells was 88.67 μM, against PANC-1 cells was 48.28 μM, and against SK-Hep-1 cells was 76.70 μM. Figure 15 As shown, mandimycin has low toxicity.
[0127] (3) Hemolytic activity of mandimycin
[0128] Mandimycin was detected for hemolytic activity according to a previously reported method (Kelvin JYWu et al., 2024, Science, 383(6684), 721-726). Fresh, sterile, deproteinized sheep blood was centrifuged at 3,000 rpm for 10 minutes at 4°C to separate the precipitated blood cells, which were then resuspended in PBS solution (pH 7.4) to prepare a concentration of 1×10⁻⁶. 9 Cells / mL suspension. Test compounds were prepared at concentrations from 0.39 μM to 100 μM and mixed with blood cells to a final volume of 500 μL. 0.5% DMSO and 1% Triton X100 served as negative (0% hemolysis) and positive (100% hemolysis) controls, respectively. After incubation at 37°C for 3 hours, the supernatant was collected by centrifugation at 3,000 rpm for 20 minutes and transferred to a 96-well polypropylene plate. The OD value of the supernatant was measured using an enzyme-linked immunosorbent assay (ELISA) reader. 540The absorbance at nm is used to determine the degree of hemolysis, such as Figure 16 As shown, the results indicate that mandimycin did not exhibit hemolytic activity at a high concentration of 100 mM, while amphotericin B showed severe hemolysis at 12.5 μM, suggesting that mandimycin has better safety.
[0129] Example 8
[0130] In vivo antibacterial activity assessment of mandimycin
[0131] (1) Mouse thigh muscle infection model with neutrophil deficiency
[0132] Six-week-old, specific pathogen-free female ICR mice weighing 23-27 grams were used. Mice were intraperitoneally injected with cyclophosphamide (Sigma-Aldrich) four days (150 mg / kg) and one day (100 mg / kg) before pathogen infection. On day one of infection, 0.05 ml of the inoculum (2 x 10⁻⁶ mg / kg) was injected intramuscularly into the thigh of each mouse. 7 Mice were infected with multidrug-resistant Candida albicans BNCC186382, multidrug-resistant Candida auris BNCC357785, and amphotericin B-resistant pan-drug-resistant Candida auris AMR05 (CFU / mL). Two hours after infection, mice were treated subcutaneously with different concentrations of mandimycin (20 mg / kg, 10 mg / kg, and 5 mg / kg) prepared in Example 3, injected every 8 hours for a 24-hour treatment period. Mice were sacrificed by cervical dislocation, and the number of colonies in the thigh muscle tissue was counted. Figure 17 As shown, the mandimycin treatment groups all exhibited significant therapeutic effects. At a dose of 20 mg / kg, the number of *Candida albicans* BNCC186382 fungal cells decreased by 4.2 log10, and the number of *Candida auris* BNCC357785 fungal cells decreased by 3 log10. At the lowest dose of 5 mg / kg, the number of *Candida albicans* BNCC186382 fungal cells also decreased by 3 log10, and the number of *Candida auris* BNCC357785 fungal cells decreased by 2 log10. This effect was superior to that of amphotericin B in the same group. Against amphotericin B-resistant, pan-drug-resistant *Candida auris*, mandimycin demonstrated good in vivo activity, reducing the number of *Candida auris* AMR05 fungal cells by 2.4 log10 at 10 mg / kg. Meanwhile, neither group of mice showed acute toxicity at a dose of 20 mg / kg.
[0133] (2) Mouse model of disseminated candidiasis
[0134] Female, pathogen-free ICR mice (Hangzhou Medical College, China), 6 weeks old and weighing 23-27 grams, were used. Mice were randomly assigned to cages of four and underwent three days of acclimatization training before the experiment. One colony of *Candida albicans* BNCC 186382 was inoculated into 5 ml of LYPD liquid medium and incubated overnight at 30°C and 220 rpm with shaking. The overnight fungal culture was washed three times with 0.9% sterile physiological saline and then diluted to 2 × 10⁻⁶. 7 The final concentration was determined using CFU / mL. Subsequently, approximately 1 × 10⁻⁶ CFU / mL was inoculated into the bloodstream via subcutaneous injection of 50 μL of the diluted fungal suspension through the tail vein. 7 CFU. Six hours after infection, mice were subcutaneously injected with single doses of mandimycin (prepared with 10% DMSO and 10% Tween 80) at doses of 1 mg / kg, 3 mg / kg, 5 mg / kg, and 10 mg / kg, respectively. Mice in the oral administration group were orally administered 10 mg / kg mandimycin, prepared with 5% DMSO and 10% Tween 80. Twenty-four hours post-infection, mice were euthanized, and kidney and lung tissues were aseptically removed, weighed, homogenized, and then cultured on YPD agar at 30°C for fungal load counting by CFU. All data in the graphs are presented as a single data point for each group, and the results are as follows. Figure 18 At doses of 1, 3, 5, and 10 mg / kg mandimycin, the number of MDR Beauveria bassiana cells in kidney sections decreased by 0.93, 2.34, 2.52, and 3.43 log10, respectively, within 24 hours. Statistical analysis was performed using GraphPad Prism 9.
[0135] (3) Invasive candidiasis mouse model
[0136] Female, pathogen-free ICR mice (Hangzhou Medical College, China), 6 weeks old and weighing 23-27 grams, were used. Mice were randomly assigned to cages of 6 and underwent acclimatization training for 3 days prior to the experiment. To induce immunosuppression, mice were intraperitoneally injected with cyclophosphamide (200 mg / kg) on day -2 and subcutaneously injected with cortisone acetate (500 mg / kg) on day +3. To prevent cross-infection, mice were orally administered enrofloxacin at a concentration of 50 μg / mL in their drinking water from day 1 to day 3, followed by subcutaneous injection of ceftazidime (5 μg / dose) from day 0 to day 9. 1×10 6Invasive candidiasis was induced by CFU-containing Candida albicans BNCC 186382. Treatment began 16 hours post-infection and included subcutaneous injection of cefazolin, followed by single daily injections of mandimycin (prepared with 10% DMSO and 10% Tween 80) at doses of 1 mg / kg, 5 mg / kg, 10 mg / kg, and 20 mg / kg for four consecutive days, and amphotericin B at 10 mg / kg. Mice were monitored for 20 days, and survival rates were plotted using GraphPad Prism 9. Results are shown below. Figure 19 When the mandimycin dose was 10 mg / kg, the survival rate of mice reached 100%. In contrast, the survival rate of the amphotericin B group was only 80%, indicating that mandimycin has a superior efficacy in improving survival.
[0137] (4) Mouse model of fungal skin infection
[0138] A mouse model of skin infection was established to evaluate the efficacy of mandimycin in treating fungal dermatophyte infection. BALB / c mice (Hangzhou Medical College, China) weighing 20-22 grams were used. Mice were randomly housed in cages of four, and underwent three days of acclimatization training before the experiment. Neutropenia was induced by intraperitoneal injection of 50 mg / kg cyclophosphamide on day 3 and day 1 before infection. Subsequently, mice were anesthetized by intraperitoneal injection of 50 mg / kg sodium pentobarbital, and full-thickness skin perforations were made on the dorsal side using a 0.8 cm diameter biopsy punch. Candida albicans BNCC 186382 suspension (1×10⁻⁶) was then used. 8 CFU / ml (50 μL per mouse) was inoculated into a circular wound, and then gently blown in until the skin was moist but without excess fluid. One day post-infection, the wound was locally treated with mandimycin (2.5 mg / kg or 7.5 mg / kg), amphotericin B (2.5 mg / kg or 7.5 mg / kg), or a carrier (PBS containing 10% dimethyl sulfoxide and 10% Tween 80). Mice with wounds created but not infected with fungi served as a negative control group and received only drug treatment. All compounds were administered once daily for 5 consecutive days. The wounds were photographed and their size measured on days 1, 5, 9, and 11 post-infection. On day 11, the fungal count of the wound specimens was recorded, and wound specimens were collected, as shown in the figure. Figure 20 Mandimycin showed significant activity in a skin infection model, reducing the fungal burden by more than 2 log10 at a dose of 2.5 mg / kg, and also significantly reducing wound size and inflammation.
[0139] (5) Mouse model of vaginal infection
[0140] Female BALB / c mice, weighing 19-21 grams, were acclimatized for three days prior to the experiment. Mice were randomly assigned to cages of four per cage and acclimatized for three days before the experiment. On day 1, mice were subcutaneously injected with 10 mg / kg estradiol benzoate once daily for 5 consecutive days to induce estrus (40, 41). On day 6, 50 μL of Candida albicans BNCC 186382 suspension (1×10⁻⁶) was inoculated intravaginally into the vagina of the mice using a pipette. 10 CFU / ml), inverted for 5 minutes after vaginal inoculation. After 3 consecutive days of infection, mice were fed normally for 1 day, then subcutaneously injected with mandimycin (10 mg / kg), amphotericin B (10 mg / kg), rasafungin (10 mg / kg), or isovoteconazole (10 mg / kg) once daily for 5 consecutive days. Mice infected with Beauveria bassiana but not treated with the compounds served as the control group and were injected with PBS containing 10% DMSO and 10% Tween 80. The day after the last administration, the vagina was repeatedly flushed with sterile PBS (20 μL), the vaginal flushing fluid was aspirated with a pipette, and the samples were cultured on MRS agar plates to count Beauveria bassiana colonies. Finally, all animals were anesthetized with ether and euthanized, and vaginal tissue was collected. The results are as follows. Figure 21 In the treatment of vaginal candidiasis, mandimycin also showed significant efficacy, reducing the vaginal fungal burden by 2.51 log10 after 5 days of treatment (10 mg / kg, intravenous injection, once daily). This efficacy is comparable to other well-known antifungal antibiotics, including amphotericin B, rasafungin, and isovoteconazole. Furthermore, mice treated with mandimycin showed significant reduction in inflammation, with almost complete recovery of the vaginal mucosa.
[0141] As can be seen from Examples 7-8, the natural product mandimycin of the present invention not only exhibits excellent in vitro and in vivo antifungal activity, but also has no hemolytic activity and does not cause acute toxicity, and can be used to prepare antifungal drugs.
[0142] Example 9
[0143] In vivo pharmacokinetic studies of mandimycin
[0144] The study used pathogen-free male Sprague-Dawley rats (180-220 g, 7-8 weeks old, n=3 per group). Mice were randomly assigned to cages of three and allowed to acclimate for three days before the experiment. Rats were subcutaneously injected with 25 mg / kg of mandimycin. Blood samples (approximately 0.15 mL) were collected from the jugular vein catheter at 5, 10, 20, and 30 minutes before administration, and at 1, 2, 4, 6, 8, 12, and 24 hours after administration into test tubes containing heparin sodium. After blood sample collection, the samples were placed on ice and then centrifuged (8000 × g, 5 min) to separate the plasma. The plasma was then transferred and immediately frozen (-70°C or below) until analysis. Mandimycin in rat plasma was analyzed by liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS / MS), consisting of an ABSCIEX Triple Quad 6500 system and an HPLC system equipped with a Quaternary Solvent Manager-R solvent dispensing device and a Sample Manager FTN-R autosampler. Diazepam was used as an internal standard (IS). Mass quantification of mandimycin (m / z 1198.30 to m / z 725.20) and diazepam (m / z 285.00 to m / z 193.00) was performed using multiple reaction monitoring (MRM) in positive ion mode. Mandimycin and IS were separated by high-performance liquid chromatography (Waters ACQUITY C18 column, 1.9 μm, 100 × 2.1 mm). The isocratic mobile phase consisted of 80% acetonitrile and 20% (v / v) 5 mM ammonium acetate, passed through the mass spectrometry electrospray ionization chamber at a rate of 0.4 mL / min for 3 minutes. The plasma concentration versus time relationship was fitted using a GraphPad Prism 9. Maximum plasma concentration (Cmax), time to reach Cmax (tmax), apparent elimination half-life (t1 / 2), mean residual time (MRT), area under the plasma concentration-time curve (AUC), clearance (CL), and volume of distribution (V) were estimated using Phoenix WinNonlin 8.3 non-compartmental analysis. Bioavailability was calculated as (AUCs.c. / AUCi.v.) × (Dosei.v. / Doses.c.) × 100%. Results are as follows: Figure 22 Mandimycin exhibits favorable kinetics, with a half-life of 3.84 hours, a maximum concentration (Cmax) of 55,168.20 ng / mL, and an area under the curve (AUC0-∞) of 541,692.11 h⁻¹ ng / mL. These in vitro and in vivo experiments collectively demonstrate that mandimycin possesses a broad therapeutic window.
[0145] Example 10
[0146] Evaluation of mandimycin nephrotoxicity in vivo
[0147] Female ICR mice free of pathogens, 6 weeks old and weighing 23-27 grams (Hangzhou Medical College, China), were used. Mice were randomly assigned to cages and divided into 12 groups of 4 mice each. Mice underwent three days of acclimatization training before the experiment. Amphotericin B or a solvent without any antibiotics served as the positive control and placebo, respectively. The compound mandimycin was prepared in a solution containing 10% DMSO and 10% Tween 80. Subsequently, each group of mice was subcutaneously injected with 1 mg / kg, 5 mg / kg, 10 mg / kg, and 20 mg / kg of the compound or placebo, once daily. The concentrations of toxicity-related biomarkers, including kidney injury molecule-1 (KIM-1), tissue inhibitor of metalloproteinases-1 (TIMP-1), neutrophil gelatinase-associated lipofuscin (NGAL), and bone growth factor (OPN), were then determined using a commercially available kit (Yunkron, China) according to the protocol provided. Finally, all animals were euthanized, and kidney tissue was collected, fixed, dissected, and stained with H&E. Pathological changes such as renal tubular degeneration, necrosis, cellular casts, dilation, congestion, and protein casts are assessed and scored by clinicopathologists in a double-blind manner. For example... Figure 23 As shown, after mandimycin administration, the in vivo nephrotoxicity-related indicators were not significantly different from those in the placebo group, while the nephrotoxicity indicators in the amphotericin B group increased significantly. The slide scoring analysis also concluded that mandimycin caused almost no kidney damage. All animal research procedures were approved by the Animal Ethics Committee of China Pharmaceutical University.
[0148] Example 11
[0149] Study on the mechanism of action of mandimycin
[0150] (1) Mandimycin resistance test
[0151] Different Candida species and other fungi were cultured overnight in YPD broth with shaking (200 rpm, 30°C) for 16 hours. The formulation was approximately 10... 10 The bacterial suspension was prepared at a concentration of CFU / mL, and 0.1 mL of the suspension was plated onto YPD agar plates containing 8 MIC of mandimycin, amphotericin B, nystatin, and natamycin, respectively. These inoculated plates were incubated at 30°C for 2 days to identify resistant colonies. The number of colonies grown in the presence of the drugs was counted. Figure 24As shown, mandimycin did not produce resistant strains, while amphotericin B produced an average of 6 resistant *Candida auris*, 5 resistant *Candida albicans*, 12 resistant *Cryptococcus neoformans*, 560 resistant *Candida tropicalis*, and 5 resistant *Trichoderma glaucoma* per agar plate; nystatin produced an average of 2 resistant *Candida auris*, 24 resistant *Candida albicans*, 3 resistant *Cryptococcus neoformans*, 55 resistant *Candida tropicalis*, 2 resistant *Trichoderma glaucoma*, and 23 resistant *Candida glaucoma* per agar plate; natamycin produced an average of 13 resistant *Candida auris*, 4 resistant *Candida albicans*, 34 resistant *Cryptococcus neoformans*, 40 resistant *Candida tropicalis*, 8 resistant *Trichoderma glaucoma*, and 5 resistant *Candida glaucoma* per agar plate. The results show that, unlike polydicarboxylic antifungal drugs used in clinical practice, mandimycin did not induce drug resistance even under high bacterial concentrations, suggesting that it is unlikely to induce drug-resistant bacteria in further clinical applications.
[0152] (2) Bactericidal curve of mandimycin
[0153] Fresh Candida albicans BNCC186382 colonies grown at 30℃ and 220 rpm for 16 hours were adjusted for turbidity with physiological saline to OD600 = 1, i.e., bacterial concentration (6.6 × 10⁻⁶). 7 (CFU / mL), then diluted 66 times to obtain a standard suspension (1×10⁻⁶ CFU / mL). 6 (CFU / mL). Dilute the suspension with YPD liquid medium and standard compound stock solution to obtain approximately 10. 5 The initial inoculum concentration was set at CFU / mL. Mandimycin at concentrations of 0.5 μg / mL, 1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL, and 16 μg / mL was added to 4 mL of culture (initial bacterial culture was 10...). 5 The samples were incubated in test tubes containing CFU / ml, then continuously shaken at 30°C and 220 rpm. At 0, 2, 4, 6, 8, 24, and 48 hours, 0.1 mL of the appropriately diluted sample was taken and spread onto three YPD agar plates. After 24 hours of incubation, the number of single colonies was determined by viability counting. Growth controls for each organism were prepared simultaneously in the absence of antifungal agents. Figure 25 Mandimycin is shown to be a potent bactericide. At a high concentration (8 μg / mL), the number of bacteria began to decrease after 2 hours, and Candida albicans could be completely killed after 8 hours.
[0154] (3) Scanning electron microscopy observation of the cell morphology of Candida albicans after treatment with mandimycin
[0155] Cell samples of Candida albicans BNCC18638 were treated with 8×MIC for 20 hours, 4 hours, and 8 hours. The morphology of the cells at different treatment times was observed using scanning electron microscopy. The results are as follows: Figure 26 As shown, under the action of mandimycin, the cell membrane of Candida albicans ruptured at 2 hours and completely collapsed at 8 hours.
[0156] (4) Determine the changes in in vivo and in vitro ion concentrations after mandimycin treatment of bacterial cells.
[0157] Candida albicans BNCC186382 was cultured overnight on a shaker (200 rpm, 30°C) using 50 mL of YPD liquid medium. The culture was washed three times with 10 mM Tris acetate buffer (pH 7.4, 100 mM NaCl). The washed Candida albicans (6.6 × 10⁻⁶) 8 CFU / ml (OD600 = 1.0) was resuspended in this buffer to prepare 20 mL of bacterial suspension. Mandimycin at concentrations of 1×MIC (0.5 μg / mL), 4×MIC (2 μg / mL), and 10×MIC (5 μg / mL) were added to the bacterial suspension, respectively. K+ was measured using an Orion SensorLink PCM-700 pH / ISE instrument (electrode calibrated with standard solutions containing 0.01, 0.1, or 1.0 mM KCl in 100 mM NaCl). + Concentration changes. The change in K ion concentration in the bacterial culture treated with the same volume of mandimycin-free solvent served as a control group. For example... Figure 27 As shown, Candida albicans treated with mandimycin began to shed large quantities of K+. + The control group showed no change, and the dosage concentration was dose-dependent on the ion efflux concentration.
[0158] (5) Determination of the binding target of mandimycin to fungal cell membrane
[0159] The effects of adding eukaryotic cell membrane phospholipids (phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, phosphatidylglycerol, lecithin, sphingomyelin, cardiolipin), ergosterol, and β-1,3-glucan and mannan from the cell wall on the antibacterial activity of mandimycin were assessed using Candida albicans BNCC186382 and the broth dilution method. All membrane components were dissolved in 10% DMSO to prepare different concentrations required for the experiment and added to the mandimycin MIC assay medium to observe the effect of fungal cell membrane components on the mandimycin MIC. Figure 28As shown, the ergosterol target of polyene macrolide antifungal antibiotics does not inhibit the antibacterial activity of mandimycin. Similarly, the β-1,3-glucan target of another class of antifungal drugs, echinocandins, also does not inhibit the antibacterial activity of mandimycin, indicating that mandimycin may have different mechanisms of action. Further research revealed that small phospholipid molecules in fungal cell membranes (including lecithin, cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, sphingomyelin, and phosphatidylglycerol) exhibit potent inhibitory effects on mandimycin activity, with the inhibitory activity showing a dose-response relationship. Specifically, the inhibitory activity of lecithin on mandimycin increased from 1 to 128 fold with increasing lecithin concentration; the inhibitory activity of cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, and sphingomyelin on mandimycin increased from 1 to 64 fold with increasing concentration; and the inhibitory activity of phosphatidylglycerol on mandimycin increased from 1 to 32 fold with increasing phosphatidylglycerol concentration. This experiment demonstrates that, unlike known polyols that target ergosterol, mandimycin acts on small phospholipid molecules on fungal cell membranes.
[0160] (6) Determining the target site of mandimycin by isothermal calorimetric titration
[0161] 20 mM mandimycin and amphotericin B were diluted to 1 mM with 5.0 mM HEPES (pH = 7.4) containing 5% DMSO. Different fungal cell membrane phospholipid components (lecithin, cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, sphingomyelin, phosphatidylglycerol) and ergosterol were dissolved in 5.0 mM HEPES (pH = 7.4) containing 5% DMSO to prepare a 600 μM mixture. Then, DOPC phospholipids (Avanti Polar Lipids, 610014-1Ea) were hydrated with 5.0 mM HEPES (pH = 7.4), and 100 nm liposomes were prepared using an Avanti Mini extruder.
[0162] The exothermic relationship between mandimycin and phospholipid binding was determined using a PEAQ-ITC isothermal titration calorimeter. At 25°C, a 1 mM (40 μl) mandimycin solution was placed in an automated syringe, and a 600 μM liposome (250 μl) suspension was placed in the sample cell. The initial injection volume was 0.23 μl. Subsequently, 18 injections of 2 μl each were performed, with an interval of 80 seconds between each injection, and the stirring speed was 500 rpm. Figure 29 Table 6 shows that the small phospholipid molecules exhibited good exothermic binding curves for mandimycin. Phosphatidylinositol showed the strongest binding ability, with a Kd value of 21.9 μM; followed by phosphatidylglycerol (28.2 μM), phosphatidylserine (30.9 μM), phosphatidylethanolamine (36.5 μM), phosphatidylcholine (36.8 μM), sphingomyelin (50 μM), and cardiolipin (63.6 μM). Amphotericin B and nystatin did not bind to the phospholipid components. ITC experiments further confirmed that mandimycin does not bind to the traditional ergosterol, but rather binds strongly to seven new target phospholipid molecules, particularly phosphatidylinositol.
[0163] Table 6. Affinity values of mandimycin with phospholipids
[0164]
[0165]
[0166] As can be seen from Example 8, the natural product mandimycin of this invention has a different target than known polyoxin antifungal drugs. Instead, it specifically binds to seven phospholipid molecules on the fungal cell membrane, particularly phosphatidylinositol, leading to the efflux of important intracellular ions and the death of the fungal pathogen. This multi-target binding mode not only gives the natural product mandimycin of this invention potent and broad-spectrum activity against multidrug-resistant fungi, but also the excellent characteristic of not inducing drug resistance. Based on the novel trisaccharide polyoxin backbone, potent and broad-spectrum activity against drug-resistant bacteria, novel mechanism of action, and excellent characteristic of not inducing drug resistance, mandimycin holds promise for development into a new generation of antifungal drugs.
[0167] Example 12
[0168] Constructing the MandQ knockout engineered strain CPU002
[0169] To obtain atratcynose A-deficient mandimycin derivatives, bioinformatics analysis was performed on the mandimycin biosynthesis gene cluster in Streptomyces netropsis DSM 40259, identifying MandQ (SEQ ID NO.2) as playing a crucial role in the formation of atratcynose A. To knock out MandQ, using genomic DNA from Streptomyces netropsis DSM40259 as a template, upstream and downstream fragments of MandQ were amplified by PCR using primers MandQ_KOUF / R and MandQ_KODF / R, respectively, and cloned into the Xba I-digested pKC1139 vector to obtain the plasmid pKC1139-MandQ_KO. The vector was further introduced into Streptomyces netropsis DSM40259 via indirect syngeneic transfer from *Streptomyces* to knock out MandQ. The knockout strain was validated using MandQ_TestF / R, and the results showed that... Figure 30 As shown, a 1072-base fragment was successfully knocked out of MandQ, resulting in the MandQ-knockout engineered strain CPU002. A comprehensive comparative analysis of the secondary metabolites of the wild-type and knockout strains was performed, as shown in the following figures. Figure 31 As shown, the knockout of mandimycin was confirmed, and a new conjugated pentene glycosyl knockout natural product was generated. This compound was named mandimycinB.
[0170] Primer sequences;
[0171] MandQ_KOUF: gggctgcaggtcgactcacacccgaatcgaccact;
[0172] MandQ_KOUR:atggcttcgacggggctcgggatcatcag;
[0173] MandQ_KODF: gccccgtcgaagccatgcgggagatg;
[0174] MandQ_KODR: cgcggccgcggatcctcgggcagtcatcacaccatc;
[0175] MandQ_TestF:cgacgagtccatggtccg;
[0176] MandQ_TestR:cgccgatgtccaggatcac.
[0177] Example 13
[0178] Bio-fermentation of modified strains
[0179] (1) Preparation of seed solution:
[0180] Add 50 mL of TSB medium (containing 17.0 g casein pancreatic digest, 3.0 g soybean digest, 5.0 g sodium chloride, 2.5 g dipotassium hydrogen phosphate, 2.5 g glucose monohydrate, pH 7.3 per liter of ddH2O) to a 250 mL Erlenmeyer flask. Inoculate the CPU002 strain, which has been cultured on ISP4 agar plates (containing 10.0 g soluble starch, 1.0 g dipotassium hydrogen phosphate, 1.0 g magnesium sulfate, 1.0 g sodium chloride, 2.0 g ammonium sulfate, 2.0 g calcium sulfate, 0.001 g ferrous sulfate, 0.001 g manganese chloride, 0.001 g zinc sulfate, 15.0 g agar, pH 7.2 per liter of ddH2O), onto the TSB medium and incubate for 2 days on a shaker (conditions: 200 rpm, 30 °C) to prepare the seed culture.
[0181] (2) Preparation of fermentation broth:
[0182] 0.5 mL of seed solution was transferred to a 50 mL (250 mL Erlenmeyer flask) FS / 9 fermentation medium (40.0 g glucose, 30.0 g soybean flour, and 10.0 g CaCO3 per liter of ddH2O) and cultured for 5 days (shaking speed 200 rpm, 30 °C). After fermentation, 1:1 n-butanol was added to the fermentation flask and stirred overnight (100 rpm) for extraction. The n-butanol extract was evaporated to dryness using a rotary evaporator and then dissolved in methanol to obtain a crude extract.
[0183] Example 14
[0184] Isolation and purification of mandimycin B
[0185] Purification was performed using a two-step method. First, isocratic elution was used. The crude extract obtained in Example 10 was separated by column chromatography using a YMC-GEL C18 powder (12nm × 50μm) packed column: equilibration was performed with 2 cv 10% methanol (H2O:CH2OH 9:1), methanol solution was added, and elution was performed using methanol aqueous solutions of different concentrations (10%, 30%, 50%, 70%, 90%, 100%), one 100mL bottle per flask. The components were detected by UPLC-MS, and the fraction containing mandimycin B (eluent of 90% methanol aqueous solution) was collected and evaporated to dryness. The UPLC-MS conditions were as follows: C18 column (Waters, T3-1.8μm, 2.1×100mm); mobile phase: phase A - pure water (0.1% formic acid), phase B - acetonitrile (0.1% formic acid); flow rate: 0.6 mL / min; gradient of mobile phase B: 30%-90%, incrementing by 10% per minute. MS detection range: 200-2000 nm; simultaneous positive and negative modes. The semi-pure product was then further purified using semi-preparative reversed-phase high-performance liquid chromatography (RP-HPLC). The RP-HPLC conditions were as follows: solvent A: deionized water; solvent B: acetonitrile; flow rate: 3 mL / min; gradient of solvent B: 30%-90%, incrementing by 1.5% per minute; full wavelength detection (190 nm-800 nm). UV analysis yielded mandimycin B with a purity exceeding 95%, with a yield of 3-4 mg / L fermentation broth.
[0186] Example 15
[0187] Structural identification of mandimycin B
[0188] Mandimycin B is an amorphous yellow powder. High-resolution HR-ESI-MS analysis showed that its protonated ions were m / z 924.4957 [M+H]+ and m / z 922.4792 [MH]-, indicating that its molecular formula is C. 47 H 73 NO 17 The UV-Vis spectrum of mandimycin B in methanol showed maximum absorption wavelengths of 320, 335, and 352 nm, indicating the presence of a conjugated pentene structure. Mandimycin B was dissolved in deuterated DMSO, and H1, C2, and two-dimensional spectra (HSQC, HMBC, COSY, and TOCSY) were obtained using a 700M NMR instrument, as shown below. Figure 32-37As shown. Comparison of the one-dimensional and two-dimensional NMR data of mandimycin B with those of mandimycin revealed that the main difference lies in the absence of resonances for dimethoxy sugars and 3-O-methyldimethoxy sugars, consistent with the fact that mandimycin B is produced by the glycosyltransferase gene knockout strain CPU002. The significant upward shifts at C-35 (ΔδC-7.3) and C-37 (ΔδC-5.6) further validate this conclusion. Furthermore, comparison of the 1H and 13C NMR data of carbamoyl sugar molecules in PAC-G10 and mandimycin B showed almost identical chemical shifts, indicating that carbamoyl sugar molecules are retained in mandimycin B. Key HMBC and COSY NMR correlations of mandimycin B are shown in... Figure 38 As shown, the structure of mandimycin B was determined. The 1H NMR (700MHz, DMSO-d6), 13C NMR (700MHz, DMSO-d6), HMBC, HSQC, and COSY NMR spectra are shown in Table 8.
[0189] Table 8. 1H and 13C spectra (DMSO-d6) of mandimycin B
[0190]
[0191]
[0192] Based on H-spectrum, C-spectrum, and two-dimensional spectra such as HSQC, HMBC, and COSY, as well as chiral bioinformatics analysis of mandimycin B polyketide synthase, the specific configurations of the natural product mandimycin B of this invention are 2R, 10R, 11S, 12S, 13R, 14R, 16R, and 18R. The natural product mandimycin B is shown in Formula II:
[0193]
[0194] Example 16
[0195] In vitro anti-multidrug-resistant bacteria activity assay of mandimycin B
[0196] The antimicrobial activity of mandimycin B against WHO-listed priority fungal pathogens was determined using the CLSI standard and the method described in Example 7. The results are shown in Table 9 below.
[0197] Table 9. Antifungal activity of mandimycin B.
[0198]
[0199] As shown in Table 9, mandimycin B has potent and broad-spectrum activity against multidrug-resistant fungi. The minimum inhibitory concentration (MIC) against Candida, especially multidrug-resistant Candida albicans and Candida auris, is between 1 and 2 μg / mL. The activity against multidrug-resistant Cryptococcus neoformans reaches 0.5 μg / mL. The activity against multidrug-resistant Aspergillus fumigatus reaches 2 μg / mL, which is 32 times that of fluconazole and 16 times that of 5-fluorocytosine.
[0200] Example 17
[0201] Mechanism of action of mandimycin B
[0202] (1) Binding curves of mandimycin B with sterol or phospholipid molecules
[0203] This embodiment uses the UV-Vis method to study the binding of mandimycin B with sterol or phospholipid molecules (Maji, A. Nature 2023, 623, 1079–1085). Mandimycin B was dissolved in DMSO. 1 mM mandimycin B was mixed with different proportions of sterol solutions (cholesterol, ergosterol) or phospholipid solutions (lecithin, cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, sphingomyelin, phosphatidylglycerol) to a final volume of 1 mL. The mixture was allowed to stand at room temperature for 30 min, and then the mixture was scanned using a FlexA-200 microplate reader (310-400 nm) with UV-Vis. The readings were plotted using Origin software. The results are attached. Figure 39 Different concentrations of phospholipids mixed with mandimycin B did not affect the UV absorption value of mandimycin B, indicating that different phospholipid molecules do not bind to mandimycin B; however, different concentrations of sterols (including cholesterol or ergosterol) mixed with mandimycin B caused a significant change in the UV absorption value of mandimycin B, indicating that mandimycin B can bind to sterol molecules (cholesterol or ergosterol).
[0204] (2) Determination of the binding force between mandimycin B and sterol or phospholipid molecules by isothermal titration
[0205] In this embodiment, 20 mM mandimycin B (DMSO as solvent) was diluted to 1 mM with 5.0 mM HEPES (pH=7.4) containing 5% DMSO using isothermal titration. Different phospholipid components (lecithin, cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, sphingomyelin, phosphatidylglycerol) and ergosterol, cholesterol were dissolved in 5.0 mM HEPES (pH=7.4) containing 5% DMSO to prepare a 600 μM composition. Then, the purchased liposome membrane was hydrated with 5.0 mM HEPES (pH=7.4), and the different 600 μM phospholipid components and ergosterol suspensions were passed through a 100 nm polycarbonate filter six times using an Avanti Mini extruder to prepare LUV. The exothermic relationship between mandimycin B and the binding of phospholipids or sterols was detected using a PEAQ-ITC isothermal titration calorimeter. At 25°C, a 1 mM (40 μl) solution of mandimycin B was placed in the autopilot, and a 250 μl (600 μM) LUV suspension was placed in the sample cell. The initial injection volume was 0.23 μl, followed by 18 injections of 2 μl each. Each injection was spaced 80 seconds apart to ensure the instrument returned to a stable baseline before the next injection. The stirring speed was 500 rpm for each experiment. Results are attached. Figure 40 The results showed that phospholipid molecules did not exhibit binding curves for mandimycin B, while sterols showed clear binding curves for mandimycin B. Specifically, mandimycin B had a Kd value of 25.9 μM for ergosterol and 28.6 μM for cholesterol, demonstrating that mandimycin B has a different mechanism of action than mandimycin and exhibits a strong binding ability to sterol molecules.
[0206] This invention splits the nucleotide sequence SEQ ID NO.1 of the mandimycin biosynthesis gene cluster in the claims and specification into 9 sequences in the nucleotide and amino acid sequence listing, which correspond to the sequences formed by combining SEQ ID NO.1-9 in the sequence listing. Simultaneously, the nucleotide sequence SEQ ID NO.2 of the key gene MandQ in the claims and specification corresponds to SEQ ID NO.10 in the sequence listing.
[0207]
[0208] The nucleotide sequence of the key genes MandQ, SEQ ID NO.2, is shown below (1072bp):
[0209] gtcacccacctcatgcccttggtccccctggcatgggcactgcgctccgcgggccacgagctcctcgtcgtcggacagccggacctg
[0210] atgggcgtggcccggcaggccgggctgaacgccgtgagcatcggcgaccggttcggcatggaggaggtcttccacggaatgctgg
[0211] aaccgggcaagcgccccatcgagctgtggggccggctccaccccgatcacctgaagcacttccccccggtctggaaggaccacgg
[0212] cgagcgcgtactgcccgcctacctggagctcgcccgcgcgtaccgccccgacctgatcgtggccgatccgatggagttcaacaccct
[0213] cgtggtgggcgggctgctgggcgtcccggtcctgcaccaccggttcggtgtcgacgcggtgtccgagccggtgcgcgcggccgcg
[0214] cggggcgcgatgcgggattcctgctgggccctgggcctcgacgagctgcccgatcccgacattcagctcgacccctgccccccgag
[0215] cctgcaactgcccagcctcgatgaggcccttcccatccgctacgtgcccttcaacggcagtggcgaggtgcccgcctggctccgcga
[0216] ggagcgaccgtcggccacggggaagcggcgcgtcgtggtctcgctggggacccgtacgctcgcgctcaacggagtgcccttcgtg
[0217] cgcggcctgttgcgggccttcgacggtctgcgggacgtcgaggccgtcgccaccgtcccggaggcgttccggggcgagatcggag
[0218] ccgtgccgggcaacgtgcgcatgaccgacccggtgccgctccacctgctcgtggagacctgcgacgcggtcgtccaccacggagg
[0219] gtcgggcacggtgctgaccgccgtgtccgccgggctcccgcacctggtactgccgcagatggccgaccagttcgggcacgccgac
[0220] cagctggtcgcggcgggggcgggcctcgcgatcgacgacgccgcggggcaggacgacacggtgcgactgcggtgcgcgctgga
[0221] ggaactgctgtcggagcccggctacgccaaggcggcgtgggaactgc
Claims
1. A polyene macrocyclic lactone natural product, mandimycin or mandimycin B, or a pharmaceutically acceptable salt thereof, characterized in that, The natural product mandimycin compound has the structural formula shown in Formula I, and the natural product mandimycin B compound has the structural formula shown in Formula II. 。 2. A biosynthetic gene cluster for mandimycin, a polyene macrolide natural product as described in claim 1, characterized in that, The nucleotide sequence of the biosynthetic gene cluster of mandimycin is shown in SEQ ID NO.
1.
3. A method for preparing mandimycin, a polyene macrocyclic lactone natural product according to claim 1, characterized in that, Includes the following steps: The strain containing the mandimycin biosynthesis gene cluster described in claim 2 was prepared into a seed culture, then cultured, fermented, extracted, separated, and purified to obtain the natural product mandimycin; the strain containing the mandimycin biosynthesis gene cluster is... Streptomyces netropsis DSM 40259 。 4. A method for preparing mandimycin B, a polyene macrocyclic lactone antifungal natural product according to claim 1, characterized in that, Includes the following steps: Knock out the gene shown in SEQ ID NO. 2 from a strain containing the mandimycin biosynthesis gene cluster as described in claim 2, obtain engineered bacteria, prepare seed culture, and then culture, ferment, extract, separate, and purify to obtain the natural product mandimycin B. The strain containing the mandimycin biosynthesis gene cluster is... Streptomyces netropsis DSM 40259.
5. The preparation method according to claim 4, characterized in that, Indirect co-transfer of Streptomyces and Escherichia coli was used, and knockout was performed. Streptomyces netropsis The gene shown in SEQ ID NO.2 of the mandimycin biosynthesis gene cluster in DSM 40259 was used to obtain mandimycinB by fermentation, extraction, separation and purification of engineered bacteria lacking glycosyltransferase.
6. The use of mandimycin, a polyene macrolide natural product of claim 1, or mandimycin B or a pharmaceutically acceptable salt thereof, in the preparation of an antifungal drug, wherein the fungus is any one of Candida, Aspergillus, Cryptococcus, Mucor, and Fusarium.
7. A pharmaceutical composition of an antifungal drug, characterized in that, It includes the polyene macrolide natural product mandimycin or natural product mandimycin B as described in claim 1, and a pharmaceutically acceptable carrier.
8. The pharmaceutical composition according to claim 7, characterized in that, The pharmaceutical composition is a capsule, powder, tablet, granule, pill, injection, syrup, oral liquid, inhaler, ointment, suppository or patch.
9. The use of a pharmaceutical composition of the antifungal drug according to claim 7 in the preparation of an antifungal drug, wherein the fungus is any one of Candida, Aspergillus, Cryptococcus, Mucor, and Fusarium.
Citation Information
Patent Citations
Polyene macrolide compound as well as preparation method and application thereof
CN113773355A
Streptomyces fusiformis LS159 and application thereof
CN115678811A