Lithocarpin biosynthetic gene promoter litC of deep-sea fungus P.Lithocarpus FS508 and application of biosynthetic gene promoter litC of deep-sea fungus P.Lithocarpus FS508
By amplifying and validating the core sequence Plitc of the litC promoter of the deep-sea fungus P. lithocarpus FS508, the problem of promoter adaptability differences in yeast genetic engineering was solved, enabling efficient biosynthesis of lithocarpins and enhancing its application potential in anti-tumor drugs.
Patent Information
- Application Number
- CN202511742843.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-25
- Publication Date
- 2026-02-24
AI Technical Summary
Current yeast genetic engineering lacks research on the promoter of the biosynthetic gene of the deep-sea fungus P. lithocarpus FS508 lithocarpins, resulting in low biosynthetic efficiency and yield, which limits the application potential of lithocarpins-like compounds in anti-tumor drugs.
By sequencing the genome of the deep-sea fungus P. lithocarpus FS508, analyzing the upstream promoter sequence of the litC gene, designing specific primers to amplify the core sequence Plitc of the litC promoter, and inserting it into a yeast vector using homologous recombination, we verified its efficiency in driving the expression of the hygromycin resistance gene hph and the G418 resistance gene NeoR.
A highly efficient litC promoter was successfully constructed, which can effectively drive the expression of resistance genes, improve the transcriptional regulation efficiency and yield of lithocarpins biosynthesis, and provide a molecular biological basis for further development of anti-tumor drugs.
Smart Images

Figure CN121555504A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to the litocarpin biosynthesis gene promoter litC of the deep-sea fungus P. lithocarpus FS508 and its application. Background Technology
[0002] *Phomopsis lithocarpus* FS508 is a marine fungus isolated from deep-sea sediments in the Indian Ocean. Our research group previously isolated a series of novel tenellon-conjugated macrolide polyketide heterodimer compounds, *lithocarpins* AG, from this strain. Activity assays showed that these compounds exhibited good cytotoxic activity against human cancer cell lines HepG-2, MCF-7, and SF-268, and some *lithocarpins* compounds showed specific anti-hepatocellular carcinoma activity, demonstrating their potential as lead compounds for specific antitumor drugs.
[0003] Yeast, as an important eukaryotic model organism and industrial microorganism, plays an irreplaceable role in fields such as genetic engineering, protein expression, and metabolic engineering. In recent years, with the rapid development of synthetic biology technology, the demand for precise regulation of yeast expression systems has been increasing, especially in applications requiring multiplex gene editing and the construction of complex metabolic pathways. Traditional yeast genetic engineering mainly relies on endogenous promoters and a few heterologous promoters, but these promoters often exhibit significant differences in efficiency when driving the expression of different genes, limiting the versatility and predictability of genetic engineering tools. Hygromycin resistance genes (hph) and G418 resistance genes (NeoR) are two of the most commonly used dominant selection markers in yeast genetic engineering. Hygromycin encodes hygromycin phosphotransferase, which inactivates drugs through modification, while G418 encodes aminoglycoside phosphotransferase, which inactivates drugs through phosphorylation. The difference between these two mechanisms leads to differences in adaptability to different promoters. Heterologous recognition of filamentous fungal promoters in yeast has become a research focus of considerable interest in recent years. Studies have shown that yeast transcription mechanisms can effectively recognize promoters from different fungal species, and this cross-species promoter recognition capability provides an important opportunity for developing novel yeast expression systems. However, existing research mainly focuses on the expression validation of single genes or reporter genes, and lacks systematic comparative analysis of the adaptability differences when the same promoter drives different resistance genes.
[0004] Promoters are core elements in the transcriptional regulation of structural and functional genes, enabling precise transcription initiation by recruiting transcription factors and RNA polymerases. Numerous researchers have discovered a series of novel secondary metabolites with excellent biological activity from filamentous fungi. Utilizing strong promoters to rationally regulate the expression levels of key enzymes in their biosynthetic pathways is a crucial means of improving the efficiency of specific metabolite biosynthesis and a key strategy for activating natural product biosynthetic gene clusters. Therefore, promoters from various genera of filamentous fungi have been successfully discovered, such as PgpdA, the most commonly used promoter in filamentous fungi extracted from *Aspergillus nidulans*, cbh1 and ptcu1 promoters from *Trichoderma reesei*, and PzipA and PsltA promoters from *Aspergillus fumigatus*. In contrast, research on promoters of secondary metabolite biosynthesis genes in marine fungi remains relatively scarce. Previously, our research group discovered a novel litIP (CN202311806887.9) promoter for lithium biosynthesis in strain FS508. However, there are currently no reports on promoters of key genes involved in lithium carpins biosynthesis. Furthermore, the biosynthetic mechanism of lithium carpins-like compounds remains unclear, and their low yield limits their further applications. Therefore, research on promoters of key genes involved in lithium carpins biosynthesis would help elucidate the transcriptional regulation mechanism of lithium carpins biosynthesis and facilitate improving the biosynthetic efficiency of lithium carpins through transcriptional regulation and the expression of key genes. Summary of the Invention
[0005] The first objective of this invention is to provide a promoter litC for the lithocarpin biosynthesis gene of the deep-sea fungus P. lithocarpus FS508 and its application, wherein the nucleotide sequence of the litC promoter for polyketide synthase of the deep-sea fungus FS508 is shown in SEQ ID NO. 1.
[0006] The core sequence Plitc of the litC promoter of the deep-sea fungus FS508 polyketide synthase was obtained by the following method: Based on the previous sequencing results of the P. lithocarpus FS508 genome, the promoter core region Plitc in the upstream sequence of the litC gene was analyzed using a promoter prediction website (http: / / www.fruitfly.org / seq_tools / promoter.html). Combining the promoter functional component results predicted by the PlantCARE database, and using the P. lithocarpus FS508 genome as a template, specific primers for the Plitc promoter gene sequence were designed to amplify the predicted Plitc promoter core sequence.
[0007] This invention includes the following steps:
[0008] I. The core sequence Plitc of the litC promoter was replaced with the TEF1 promoter element in the yeast vector YEp352-TEF1-HYRB using homologous recombination. First, upstream and downstream primers targeting the amplification of the litC promoter core sequence Plitc were designed. The primer sequences were: HYRB-Plitc-F: 5'-AGCTCGGTACCCGGGGATCCGTTGCCTGCACTCTTGGGTG-3'; HYRB-Plitc-R: 5'-GTGAGTTCAGGCATTCTAGACTCAGCCGAGGGTTGGTGTG-3'. The products were obtained by PCR amplification, and the fragments were purified and recovered. The constructed YEp352-TEF1-HYRB vector was double-digested with BamHI and XbaI. Then, the fragments and the digested vector were recombined and ligated using 2×MultiF Seamless Assembly Mix (Abclonal) and transformed into competent E. coli cells. Positive clones were screened by plating on ampicillin-resistant plates. Following this round of molecular cloning, the core sequence Plitc of the target gene litC promoter (its nucleotide sequence is shown in SEQ ID NO. 1) replaced the TEF1 promoter, and the YEp352-Plitc-HYRB vector was constructed. This vector was electroporated into Saccharomyces cerevisiae BJ5464 cells, and screened and validated using YPD plates containing 50 and 100 μg / mL hygromycin resistance.
[0009] Compared with *Saccharomyces cerevisiae* BJ5464 transformed with the YEp352-TEF1-HYRB plasmid (positive control), *Saccharomyces cerevisiae* containing the recombinant vector YEp352-Plitc-HYRB showed the same growth rate and similar number of positive colonies. This demonstrates that the Plitc region of the litC promoter core can initiate the expression of the hygromycin resistance gene hph, and the initiation efficiency is similar to that of the constitutive promoter TEF1.
[0010] II. Using pHCas9M-gRNA as a template, primers were designed to amplify the sequences on the vector, excluding the promoters TEF1 and NeoR, forming the backbone. The amplified NeoR fragment was then homologously recombinated with the vector backbone, resulting in a negative control plasmid, pHCas9M-NeoR. Primers targeting the negative control plasmid were designed to amplify this plasmid, obtaining linearized pHCas9M-NeoR. Simultaneously, primers were designed to amplify the Plitc promoter fragment. After electrophoresis identification, the fragments and vector were recovered. Using a homologous recombination kit, the Plitc promoter fragment was recombinated and ligated into the linearized pHCas9M-NeoR vector. The recombination products were introduced into *E. coli* DH5α competent cells and screened using ampicillin-resistant plates. Positive clones were verified using colony PCR and bacterial sequencing. The correctly sequenced recombinant vector was extracted and transformed into yeast competent cells BJ5464. Positive clones were then verified by colony PCR amplification of the target gene fragment.
[0011] The obtained pHCas9M-NeoR empty vector (negative control), TEF1-pHCas9M-NeoR (positive control), and Plitc-pHCas9M-NeoR plasmids were electroporated into Saccharomyces cerevisiae BJ5464 cells (1500 V, 5 ms), and evenly spread on G418 antibiotic plates. Positive clones were screened by colony PCR and further sequenced for verification. The successfully verified yeast BJ5464 cells containing the above plasmids were inoculated into YPD liquid medium and cultured at 30℃ and 180 rpm for 24 h, followed by subculturing and another 24 h of culture. The bacterial culture was then serially diluted to 10⁻⁶ cells / mL. -3 The bacterial suspension was then spread on YPD plates with G418 resistance at concentrations of 0, 100, 200, and 300 μg / mL, and incubated in a 30℃ incubator for 48 h. The growth of the colonies in the culture dishes was then observed.
[0012] In 10 -3 At different dilutions, a concentration of 300 μg / mL G418 resistance inhibited the growth of *Saccharomyces cerevisiae* BJ5464 transformed with the TEF1-pHCas9M-NeoR plasmid (positive control), but could not inhibit the growth of *Saccharomyces cerevisiae* transformed with the recombinant vector Plitc-pHCas9M-NeoR. Furthermore, the growth rate of *Saccharomyces cerevisiae* transformed with the recombinant vector Plitc-pHCas9M-NeoR on the 300 μg / mL G418-resistant YPD plate was comparable to that on the YPD plate without G418 resistance, and the number of positive colonies was similar. This demonstrates that the core region of the litC promoter, Plitc, can initiate the expression of the G418 resistance gene NeoR, and the initiation efficiency is higher than that of the constitutive promoter TEF1.
[0013] A second objective of this invention is to provide an expression vector containing the litC promoter of the *Pseudomonas FS508* polyketide synthase gene.
[0014] The expression vector includes plasmids.
[0015] A third objective of this invention is to provide a host cell containing the aforementioned expression vector.
[0016] The host cell is preferably Saccharomyces cerevisiae BJ5464 or Phopsis lithocarpus FS508.
[0017] A fourth objective of this invention is to provide the application of the litC promoter of the *Pseudomonas FS508* polyketide synthase gene in initiating the expression of downstream genes in host cells.
[0018] The host cell is preferably Saccharomyces cerevisiae BJ5464 or Phopsis lithocarpus FS508.
[0019] The downstream genes are preferably the polyketide synthase gene litC, the hygromycin resistance gene hph, or the G418 resistance gene NeoR.
[0020] A fifth object of the present invention is to provide an expression cassette containing the litC promoter of the *Pseudomonas FS508* polyketide synthase gene described above.
[0021] The sixth objective of this invention is to provide a method for regulating the transcription of a target gene by introducing the above-mentioned promoter litC, or the above-mentioned expression vector, or the above-mentioned expression cassette into a host cell to enhance the transcription of the target gene in the host cell.
[0022] The *Phomopsis lithocarpus* FS508 involved in this patent was isolated from seabed sediments at a depth of 3606 m in the Indian Ocean (111°53.335'E, 16°50.508'N).
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] The *Pseudomonas lithocarpus* FS508 involved in this invention was isolated from deep-sea sediments in the Indian Ocean. Our research group previously performed whole-genome sequencing on this bacterium and annotated genes related to the biosynthesis of lithocarpins. Given that the promoter of the lithocarpins biosynthesis genes in *Pseudomonas lithocarpus* FS508 has not yet been reported, and transcriptome sequencing and previous experimental results have shown a high expression level of the litC gene encoding polyketide synthase, indicating that the promoter of this gene has high transcriptional activity, this invention uses specific primer PCR amplification to obtain the upstream promoter sequence of the litC polyketide synthase gene in *Pseudomonas lithocarpus* FS508 and performs functional verification. This lays a reliable molecular biological foundation for future efforts to improve the biosynthetic efficiency and yield of lithocarpins through biosynthetic strategies and transcriptional regulation, and to obtain novel derivatives.
[0025] The deep-sea fungus *Phomopsis lithocarpus* FS508 of this invention has the accession number GDMCCNO:60433 and is disclosed in invention patent CN201810974840.6, entitled "Compound lithocarpinol B and its preparation method and its application in the preparation of antifungal drugs". Attached Figure Description
[0026] Figure 1 Electrophoresis diagram of the Plitc amplification product of the litC core sequence of the promoter of the polyketide synthase gene of the deep-sea fungus FS508.
[0027] Figure 2 To validate the YEp352-Plitc-HYRB plasmid in Saccharomyces cerevisiae. In the image, A is the YEp352-TEF1-HYRB vector pattern; B is the YEp352-Plitc-HYRB vector pattern; and C is the electrophoresis of the Plitc fragment product amplified from Saccharomyces cerevisiae colonies containing the YEp352-Plitc-HYRB plasmid.
[0028] Figure 3 To screen Saccharomyces cerevisiae without the promoter YEp352-No pro-HYRB (No pro), YEp352-TEF1-HYRB plasmid (TEF1), and YEp352-Plitc-HYRB plasmid (Plitc) on YPD plates containing 0, 50, and 100 μg / mL hygromycin (HyrB) resistance.
[0029] Figure 4YPD plates were used to screen for G418 resistance at concentrations of 0, 100, 200, and 300 μg / mL for No pro: pHCas9M-NeoR (negative control), TEF1: TEF1-pHCas9M-NeoR (positive control), and Plitc: Plitc-pHCas9M-NeoR of Saccharomyces cerevisiae.
[0030] Figure 5 Component analysis of the core sequence Plitc for the litC promoter. Detailed Implementation
[0031] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0032] In this embodiment, restriction endonucleases XbaI and BamHI were purchased from Thermo Fisher Scientific (Thermo Fisher Scientific, USA); Phanta Max Super-Fidelity DNA Polymerase was purchased from Novizan Biosciences Co., Ltd. (Nanjing, China); 2×MultiF Seamless Assembly Mix was purchased from Ibotek Biotechnology Co., Ltd. (Wuhan, China); and Hygromycin B was purchased from Yisheng Biotechnology Co., Ltd. (Shanghai, China).
[0033] The YPD solid culture medium used in this embodiment has the following formulation: 10 g yeast extract, 20 g peptone, 20 g glucose, and 30 g agar powder, diluted to 1 L with distilled water; the LB culture medium has the following formulation: 10 g peptone, 5 g yeast extract, 10 g sodium chloride, diluted to 1 L with distilled water. Preparation method: Mix all components of the culture medium, stir to dissolve, and sterilize.
[0034] Example 1: Obtaining the core sequence of the litC promoter of the polyketide synthase gene from the deep-sea fungus *Phomopsis lithocarpus* FS508.
[0035] Amplification of the core sequence Plitc of the litC promoter of the FS508 polyketide synthase gene: Deep-sea fungus *P. lithocarpus* FS508 was inoculated onto sea salt PDA plates and cultured at 28°C for 72 h. Fresh mycelia were picked, and the FS508 genome was extracted using a fungal DNA extraction kit. Based on previous sequencing results of the *P. lithocarpus* FS508 genome, the polyketide synthase *litC* encoding the lithocarpins biosynthesis gene was obtained, and its nucleotide sequence is shown in SEQ ID NO. 2. The core sequence of the promoter Plitc in the upstream sequence of the *litC* gene was analyzed using a promoter prediction website (http: / / www.fruitfly.org / seq_tools / promoter.html). Combining the promoter functional component prediction results from the PlantCARE database, specific primers for the Plitc promoter gene sequence were designed using the *P. lithocarpus* FS508 genome as a template, amplifying the predicted core sequence of the Plitc promoter. The electrophoresis image of the amplified product is shown below. Figure 1 .
[0036] Example 2: Functional verification of the expression of the hygromycin resistance gene hph by the Plitc promoter core region of the litC promoter.
[0037] First, the hygromycin resistance gene hygromycin-B (GenBank Accession: XM_003071606) was inserted into the yeast vector YEp352-TEF1-CYC1 between the XbaI and SalI restriction sites using an enzyme digestion and ligation method. (YEp352-TEF1-CYC1 is an early constructed plasmid carrying the constitutive promoter TEF1 and terminator CYC1, a known product in the prior art. [Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, Shuang Li, MinZhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomycescerevisiae to produce (+)-valencene and its related sesquiterpenes, RSC Adv., 2019, 9, 30171, DOI: […]) (10.1039 / c9ra05558d), construct the positive control plasmid YEp352-TEF1-HYRB, its spectrum is shown in [image missing]. Figure 2 A.
[0038] Then, the core sequence of the litC promoter, Plitc (its nucleotide sequence is shown in SEQ ID NO. 1), was inserted into the yeast vector YEp352-TEF1-HYRB by replacing the TEF1 element using homologous recombination. First, upstream and downstream primers targeting the amplification of the litC promoter core sequence Plitc (SEQ ID NO. 1) were designed: HYRB-Plitc-F: 5'-AGCTCGGTACCCGGGGATCCGTTGCCTGCACTCTTGGGTG-3' and HYRB-Plitc-R: 5'-GTGAGTTCAGGCATTCTAGACTCAGCCGAGGGTTGGTGTG-3'. The products were obtained by PCR amplification. The TEF1 promoter of the vector YEp352-TEF1-HYRB was removed by double digestion with BamHI and XbaI, and the product was recovered. Then, the two products were recombinantly ligated using 2×MultiF Seamless Assembly Mix (Abclonal) and transformed into *E. coli* DH5α competent cells for screening of positive clones. Colony PCR verification was performed using primers Plitc-F: 5'- GTTGCCTGCACTCTTGGGTG-3' and Plitc-R: 5'-CTCAGCCGAGGGTTGGTGTG-3'. The results showed that Plitc was successfully inserted into the YEp352-HYRB vector, which was confirmed by sequencing, yielding the YEp352-Plitc-HYRB vector. Its chromatogram is shown below. Figure 2 B. Electroporation was performed into Saccharomyces cerevisiae BJ5464 cells, and screening and validation were conducted using YPD plates containing 50 and 100 μg / mL hygromycin resistance.
[0039] Finally, competent cells of *Saccharomyces cerevisiae* BJ5464 were prepared. The YEp352-TEF1-HYRB plasmid vector (positive control), YEp352-No pro-HYRB plasmid vector (negative control), and YEp352-Plitc-HYRB plasmid vector were electroporated into *Saccharomyces cerevisiae* BJ5464 cells (1500 V, 5 ms). 10 μL of each vector was diluted 100-fold in 900 μL of sterile water and recorded as 10 μL. -2 Then from 10 -2 Take 100 μL and add it to 900 μL of sterile water to dilute it 10 times, and record this as 10. -3 Then from 10 -3 Take 100 μL and add it to 900 μL of sterile water to dilute it 10 times, and record this as 10. -4Take 5 μL of bacterial culture from each dilution and spot it onto YPD plates containing 50 and 100 μg / mL hygromycin resistance. Incubate at 30℃ for 2 days. Screen for positive clones using colony PCR and further verify by sequencing. No colonies were generated on the negative control plates (without promoter vector), indicating that 0, 50, and 100 μg / mL hygromycin resistance concentrations can be used to screen Saccharomyces cerevisiae BJ5464. Saccharomyces cerevisiae containing the recombinant plasmid vector YEp352-Plitc-HYRB were picked for colony PCR using primers HYRB-Plitc-F and HYRB-Plitc-R. The core region Plitc of the litC promoter was amplified, positive clones were screened, and verified by sequencing. Figure 5 ).
[0040] Compared to the positive control (containing the YEp352-TEF1-HYRB plasmid vector), the Saccharomyces cerevisiae containing the YEp352-Plitc-HYRB plasmid vector showed consistent growth rates and similar colony counts. Figure 3 The results showed that the core sequence Plitc of the litC promoter can effectively initiate the expression of the hygromycin resistance gene hph, and the initiation efficiency is similar to that of the constitutive promoter TEF1, indicating that the litC promoter may be a highly efficient promoter.
[0041] Example 3: Functional verification of Plitc expression of G418 resistance gene NeoR in the core region of the litC promoter.
[0042] Using pHCas9M-gRNA as a template, primers were designed to amplify the sequences on the vector, excluding the promoters TEF1 and NeoR, forming the backbone. The amplified NeoR fragment was then homologously recombinated with the vector backbone, resulting in a negative control plasmid, pHCas9M-NeoR. Primers targeting the negative control plasmid were designed to amplify this plasmid, obtaining linearized pHCas9M-NeoR. Simultaneously, primers were designed to amplify the Plitc promoter fragment. After electrophoresis identification, the fragments and vector were recovered. Using a homologous recombination kit, the Plitc promoter fragment was recombinated and ligated into the linearized pHCas9M-NeoR vector. The recombination products were introduced into *E. coli* DH5α competent cells and screened using ampicillin-resistant plates. Positive clones were verified using colony PCR and bacterial sequencing. The correctly sequenced recombinant vector was extracted and transformed into yeast competent cells BJ5464, and the target gene fragment was amplified by colony PCR to verify positive clones.
[0043] The obtained pHCas9M-NeoR empty vector (negative control), TEF1-pHCas9M-NeoR (positive control), and Plitc-pHCas9M-NeoR plasmids were electroporated into *Saccharomyces cerevisiae* cells (1500 V, 5 ms), and evenly spread on G418 antibiotic plates. Positive clones were screened by colony PCR and further sequenced for verification. Yeast cells BJ5464 containing the above plasmids were successfully inoculated into YPD liquid medium and cultured at 30℃ and 180 rpm for 24 h, followed by subculturing and another 24 h of culture. The overnight culture was diluted to OD0.05. 600 The value is approximately 1.0. Take 100 μL and add it to 900 μL of sterile water to dilute it 100 times. Record this as 10. -1 Then from 10 -1 Take 100 μL and add it to 900 μL of sterile water to dilute it 10 times, and record this as 10. -2 Then from 10 -2 Take 100 μL and add it to 900 μL of sterile water to dilute it 10 times, and record this as 10. -3 Take 5 μL of bacterial culture from each dilution and spot it onto YPD plates resistant to 100, 200, and 300 μg / mL G418. Incubate at 30℃ for 48 h and observe the growth of colonies in the culture dishes.
[0044] In 10 -3 At the specified dilution, a concentration of 300 μg / mL G418 resistance inhibited the growth of *Saccharomyces cerevisiae* BJ5464 transformed with the TEF1-pHCas9M-NeoR plasmid (positive control), but failed to inhibit the growth of *Saccharomyces cerevisiae* transformed with the recombinant vector Plitc-pHCas9M-NeoR. Furthermore, the growth rate of *Saccharomyces cerevisiae* transformed with the recombinant vector Plitc-pHCas9M-NeoR on the 300 μg / mL G418-resistant YPD plate was comparable to that on the YPD plate without G418 resistance, and the number of positive colonies was similar. Figure 4 This demonstrates that the Plitc region of the litC promoter can initiate the expression of the G418 resistance gene NeoR, and its initiation efficiency is higher than that of the constitutive promoter TEF1. This further illustrates that the litC promoter is a highly efficient promoter with the potential to replace commonly used promoters.
[0045] SEQ ID NO:1 (litC promoter sequence)
[0046] GTTGCCTGCACTCTTGGGTGGCGGATAGCTATGTACGAAGATACCCATTTTGTTATGATGTCGGTTATTATCGGATTAATACATCACCTCGCCTGCCACTTTCCGAACTGAACCCAAATGATTTTTCCTAGTGACGGATTTTCGATATCCCGCCATTCATATTTCCTGTTGTCAAGTACTATGAAGTCTCAGAGTTTCGGAGTGCCTGGTTTGACATGTGTACGACAACGCTGTTGGGCAACACACCGAAACCGTGATGTGCGTTGCTCTTTTTTTGTTCCTTTTTTTTTCCTACTCTTGCGCATCAGTATGAACAATTAGTTTAATGGGATGAATATATGCTGATTCTTGGTGGAGGGTGTTTTGGCTTTGATTACCTAGGCACTTGATTCAATACCGTCAGACACGGGTTTTGGTAAATCCCGACAAGGAGGCTGACCGTCGGGGCAAGGCCCGAAGCAGCAGAGTAGGCACCATCCAGTTCCGATTCTTCTTGCTGACACGTTCCGATGCATATCGCTTCCTATCGGAGTGTCTGAGCTCGGACAGGCCAAACGCGACATTTCGAAAAGTGAGCCCGATATTCCGGTTCAAGCGTTTCCGGGCAGGAGCTGCAGGCATGTGAATAAACCACGTCGGCGACAAGAATTCAAAGCTCCGTATCGGAAGATACTAAACCACACCTGCTTAACGTTCGCTGTCCCCTTTTCACAGGAAATCATCTAGCCAGGAAACATTATTGCCTCTGAGAATTTCTTTATGATTCTTGACTGGAGCACACCAACCCTCGGCTGAG
[0047] SEQ ID NO: 2 (litC gene sequence)
[0048]
[0049] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A promoter litC Its characteristics are, Its nucleotide sequence is shown in SEQ ID NO.
1.
2. An expression carrier, characterized in that, Contains the promoter of claim 1 litC .
3. The expression vector according to claim 2, characterized in that, The expression vector includes plasmids.
4. A host cell, characterized in that, It contains the expression vector as described in claim 2.
5. The host cell according to claim 4, characterized in that, The host cell is *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae BJ5464 or Pseudomonas stolonifera ( Phomopsis lithocarpus FS508.
6. The promoter according to claim 1 litC The application of initiating downstream gene expression in host cells.
7. The application according to claim 6, characterized in that, The host cell is *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae BJ5464 or Pseudomonas stolonifera ( Phomopsis lithocarpus FS508.
8. The application according to claim 6, characterized in that, The downstream gene is a polyketide synthase gene. litC Hygromycin resistance gene hph or G418 resistance gene NeoR .
9. An expression box, characterized in that, Contains the promoter of claim 1 litC .
10. A method for regulating the transcription of a target gene, characterized in that, The promoter described in claim 1 litC The expression vector of claim 2 or the expression cassette of claim 9 is introduced into the host cell to enhance the transcription of the target gene in the host cell.
Citation Information
Patent Citations
Compound lithocarpinol B, its preparation method, and its application in the preparation of antifungal drugs
CN108892658B
Novel lithocarol biosynthetic gene promoter of deep-sea fungus phomopsis sp. FS508
CN117778391A