Cadmium hyperaccumulation key element of sedum plumbizincicola and application thereof

Abstract

The invention discloses a sedum plumbizincicola key element for hyperaccumulating cadmium and application of the sedum plumbizincicola key element. The key elements for hyperaccumulating cadmium sequentially comprise an SPHMA2 gene transcription regulation element and an SPHMA2 gene. The SPHMA2 gene transcriptional regulation element is as shown in the 1st-2384th sites of a sequence 1; the SpHMA2 gene is a DNA molecule as shown in the 2385 -6942 site of a sequence 1 or a DNA molecule as shown in a sequence 2 in a sequence table. It is found for the first time that the promoter of SpHMA2 drives the SpHMA2 gene to serve as a hyperaccumulation key element to play an important role in promoting heavy metal rhizome transport and overground part stem and leaf distribution, and the sequence is a key element for sedum plumbizincicola cadmium hyperaccumulation and plays an important role in the hyperaccumulation characteristic of sedum plumbizincicola. The key element is expected to be assembled on an engineering plant as a key element to realize hyperaccumulation of cadmium on the overground part of the plant, so that the assembly and application of the hyperaccumulation engineering plant are realized.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a key component of a sedum ore-associated cadmium hyperaccumulator and an application thereof. Background Art

[0002] Sedum truncatum is a typical perennial herbaceous Cd / Zn hyperaccumulator with robust rhizome transport and aerial detoxification capabilities, capable of storing approximately 7,000 mg / kg Cd and 18,000 mg / kg Zn in its aerial parts. As one of the strongest hyperaccumulators of zinc and cadmium, Sedum truncatum harbors key genes for cadmium hyperaccumulation. Heavy metal ATPases (HMAs) are a typical class of heavy metal transporters in plants. Among them, HMA2 is involved in cadmium transport in Arabidopsis thaliana, but as a non-hyperaccumulator, Arabidopsis thaliana exhibits very low cadmium transport efficiency. HMA4 has been shown to be a key protein for transporting Zn and Cd in Arabidopsis thaliana. However, the Zn transport efficiency of AhHMA4 in Arabidopsis thaliana is only 1.16 times that of the wild type. The heavy metal transport efficiency of these genes falls far short of the transport requirements required for phytoremediation plants.

[0003] Cadmium (Cd) is a non-essential heavy metal element with a half-life of 25-30 years. It is highly toxic to animals and almost all plants. After entering the human body through the food chain, heavy metal cadmium can accumulate in the human body for a long time, posing a serious threat to human health. Therefore, the control of heavy metal pollution is in urgent need of advancement, among which phytoremediation is considered to be an economical, environmentally friendly and easily accepted technology by the public. Hyperaccumulators are naturally occurring remediation plants and are good materials for heavy metal phytoremediation. However, there is currently insufficient understanding of the key components of hyperaccumulators that hyperaccumulate cadmium, which affects the assembly and promotion of phytoremediation engineering plants and limits the development and application of phytoremediation engineering plants. Therefore, a deep understanding of the key components of hyperaccumulation in the hyperaccumulator Sedum serrata is important for assembling phytoremediation engineering plants with higher transport efficiency and higher resistance to soil pollution, promoting the remediation of contaminated soil, and ensuring the safety of agricultural production. Summary of the Invention

[0004] An object of the present invention is to provide a DNA fragment or a related biological material.

[0005] The DNA fragment provided by the present invention is the key element for hyperaccumulation of cadmium in the present invention, and the DNA fragment sequentially includes the SpHMA2 gene transcription regulatory element and the SpHMA2 gene;

[0006] The nucleotide sequence of the SpHMA2 gene transcription regulatory element is shown in sequence 1, positions 1 to 2384 in the sequence listing;

[0007] The nucleotide sequence of the SpHMA2 gene is the DNA molecule shown in sequence 1 at positions 2385-6942 in the sequence list or the DNA molecule shown in sequence 2 in the sequence list;

[0008] The related biological material is a recombinant vector or recombinant microorganism containing the DNA fragment.

[0009] Another object of the present invention is to provide new uses of the above-mentioned DNA fragments or related biological materials.

[0010] The present invention provides the use of the above-mentioned DNA fragment or its related biological material in any of the following 1)-4):

[0011] 1) Regulate the heavy metal accumulation capacity of plants;

[0012] 2) regulating heavy metal transport and / or distribution in plants;

[0013] 3) Cultivate heavy metal hyperaccumulator plants;

[0014] 4) Control and / or remediate soil heavy metal pollution.

[0015] Another object of the present invention is to provide new uses of SpHMA2 protein or related biological materials.

[0016] The present invention provides the use of SpHMA2 protein or related biomaterials in any of the following 1)-4):

[0017] 1) Regulate the heavy metal accumulation capacity of plants;

[0018] 2) regulating heavy metal transport and / or distribution in plants;

[0019] 3) Cultivate heavy metal hyperaccumulator plants;

[0020] 4) Control and / or remediate heavy metal pollution in soil;

[0021] The SpHMA2 protein is any one of the following proteins (a1) to (a4):

[0022] (a1) the protein shown in Sequence 3 in the Sequence Listing;

[0023] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0024] (a3) a protein related to plant heavy metal transport and / or distribution obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1);

[0025] (a4) a protein with greater than 98% identity to (a1) and associated with heavy metal transport and / or distribution in plants;

[0026] The relevant biological material is a nucleic acid molecule encoding the SpHMA2 protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

[0027] In the protein described in (a2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0028] In the protein described in (a3) ​​above, the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues, or a substitution and / or deletion and / or addition of no more than 9 amino acid residues, or a substitution and / or deletion and / or addition of no more than 8 amino acid residues, or a substitution and / or deletion and / or addition of no more than 7 amino acid residues, or a substitution and / or deletion and / or addition of no more than 6 amino acid residues, or a substitution and / or deletion and / or addition of no more than 5 amino acid residues, or a substitution and / or deletion and / or addition of no more than 4 amino acid residues, or a substitution and / or deletion and / or addition of no more than 3 amino acid residues, or a substitution and / or deletion and / or addition of no more than 2 amino acid residues, or a substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0029] In the case of the protein described in (a4) above, the identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, the identity of a pair of amino acid sequences can be calculated by searching in Advanced BLAST 2.1 using blastp as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be obtained.

[0030] The expression cassette refers to DNA capable of expressing the SpHMA2 protein in a host cell. The DNA may include not only a promoter for initiating SpHMA2 transcription, but also a terminator for terminating SpHMA2 transcription, and may also include an enhancer sequence. Preferably, the expression cassette includes, in sequence, a SpHMA2 gene transcription regulatory element (SpHMA2 gene promoter) and a nucleic acid molecule encoding the SpHMA2 protein (SpHMA2 gene).

[0031] The vector may be a plasmid, cosmid, phage or viral vector.

[0032] The microorganism may be yeast, bacteria, algae or fungi; the bacteria may be Agrobacterium.

[0033] Furthermore, the nucleic acid molecule encoding the SpHMA2 protein is a DNA molecule described in any one of the following (A1)-(A3):

[0034] (A1) the DNA molecule shown in SEQ ID NO: 2385-6942 in SEQ ID NO: 1 in the sequence listing;

[0035] (A2) the DNA molecule shown in Sequence 2 in the Sequence Listing;

[0036] (A3) A DNA molecule that has 75% or greater identity with (A1) or (A2) and encodes the SpHMA2 protein.

[0037] Those skilled in the art can readily mutate the nucleotide sequence encoding the Sphma2 protein of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 75% or greater identity with the isolated Sphma2 nucleotide sequence of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the Sphma2 protein and have the same function.

[0038] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or greater, or 80% or greater, or 85% or greater, or 90% or greater, or 95% or greater identity to the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 3 of the present invention. Identity can be evaluated visually or with computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0039] In the above application, the regulation of plant heavy metal accumulation capacity can be to increase the plant heavy metal accumulation capacity, specifically to increase the accumulation capacity of heavy metals in the aboveground parts of plants, such as increasing the accumulation capacity of heavy metals in plant stems, young leaves and / or mature leaves.

[0040] The regulation of plant heavy metal transport and / or distribution can be to promote plant heavy metal transport and / or distribution, specifically to increase the ability of plants to transport heavy metals from underground parts (such as roots) to aboveground parts (such as stems, mature leaves, young leaves) and to distribute heavy metals in aboveground parts (such as stems, mature leaves, young leaves), such as promoting the transport of heavy metals in plant roots and / or the distribution in stems and leaves.

[0041] Another object of the present invention is to provide a novel use of a substance that inhibits the above-mentioned SpHMA2 protein.

[0042] The present invention provides use of a substance that inhibits the above-mentioned SpHMA2 protein in any one of the following (d1)-(d3):

[0043] (d1) reduce the ability of plants to accumulate heavy metals;

[0044] (d2) inhibiting heavy metal transport and / or distribution;

[0045] (d3) Cultivating heavy metal non-hyperaccumulator plants.

[0046] Furthermore, the substance that inhibits the SpHMA2 protein may be a substance that inhibits the activity of the SpHMA2 protein, or a substance that inhibits the expression of a gene encoding the SpHMA2 protein, or a substance that knocks out a gene encoding the SpHMA2 protein.

[0047] The substance that inhibits the activity of the above-mentioned SpHMA2 protein can be any substance that can cause the loss of the activity of the above-mentioned SpHMA2 protein in plants, such as a protein, polypeptide or small molecule compound (such as a protein activity inhibitor) that inhibits the synthesis of the above-mentioned SpHMA2 protein, promotes the degradation of the above-mentioned SpHMA2 protein, or inhibits the function of the above-mentioned SpHMA2 protein.

[0048] The substance that inhibits the expression of the gene encoding the above-mentioned SpHMA2 protein can be any substance that can prevent the expression of the gene encoding the above-mentioned SpHMA2 protein in plants, such as a substance that silences the gene encoding the above-mentioned SpHMA2 protein in plants (such as miRNA, siRNA, dsRNA, shRNA, etc.).

[0049] The substance that knocks out the gene encoding the SpHMA2 protein is a substance that causes the host cell to not produce the functional protein product of the gene by any means, such as removing all or part of the coding gene sequence, introducing mutations that prevent the production of functional protein, removing or changing regulatory components (e.g., promoter editing) so that the coding gene sequence is not transcribed, or preventing translation by binding to mRNA. Typically, the knockout is performed at the genomic DNA level, so that the progeny of the cell also permanently carry the knockout.

[0050] Furthermore, the substance that knocks out the gene encoding the above-mentioned Sphma2 protein can be any substance that can cause the gene encoding the above-mentioned Sphma2 protein in the plant to mutate (the mutation form can be a deletion mutation and / or an insertion mutation and / or a base substitution) and thereby lose its activity, such as the zinc finger protein ZFN gene editing system or the TALENs gene editing system or the CRISPR / Cas9 gene editing system.

[0051] In the above application, reducing the heavy metal accumulation capacity of plants may be reducing the accumulation capacity of heavy metals in the aerial parts of plants, such as reducing the accumulation capacity of heavy metals in plant stems, young leaves and / or mature leaves.

[0052] The inhibition of plant heavy metal transport and / or distribution can be to reduce the ability of the plant to transport heavy metals from underground parts (such as roots) to aboveground parts (such as stems, mature leaves, young leaves) and the ability to distribute heavy metals in aboveground parts (such as stems, mature leaves, young leaves), such as inhibiting the transport of heavy metals in plant roots and / or the distribution in stems and leaves.

[0053] Another object of the present invention is to provide a method for cultivating heavy metal hyperaccumulator plants.

[0054] The method for cultivating heavy metal hyperaccumulator plants provided by the present invention is as follows (1) or (2):

[0055] The method (1) comprises the steps of introducing the DNA fragment into a recipient plant to obtain a transgenic plant; the transgenic plant has a higher heavy metal accumulation capacity than the recipient plant;

[0056] The method (2) includes the step of increasing the activity and / or content of the SpHMA2 protein in the recipient plant to obtain a transgenic plant; the transgenic plant has a higher heavy metal accumulation capacity than the recipient plant.

[0057] Furthermore, in (2), the method for increasing the activity and / or content of the SpHMA2 protein in the recipient plant is to overexpress the SpHMA2 protein in the recipient plant.

[0058] Furthermore, the heavy metal accumulation capacity of the transgenic plant is higher than that of the recipient plant, which is specifically reflected in at least one of the following x1) to x4):

[0059] x1) the heavy metal content in the roots of the transgenic plants is lower than that in the recipient plants;

[0060] x2) The heavy metal content in the stems of the transgenic plants is higher than that of the recipient plants;

[0061] x3) ​​The heavy metal content of young leaves of the transgenic plants is higher than that of the recipient plants;

[0062] x4) The heavy metal content in mature leaves of transgenic plants was higher than that of the recipient plants.

[0063] Furthermore, the overexpression method is to introduce the DNA molecule shown in Sequence 1 into the recipient plant.

[0064] The last object of the present invention is to provide a method for cultivating heavy metal non-hyperaccumulator plants.

[0065] The method for cultivating heavy metal non-hyperaccumulator plants provided by the present invention comprises the steps of reducing the activity and / or content of the SpHMA2 protein in a recipient plant to obtain a transgenic plant; the heavy metal accumulation capacity of the transgenic plant is lower than that of the recipient plant.

[0066] Furthermore, the method for reducing the activity and / or content of the SpHMA2 protein in the recipient plant is to introduce the substance that inhibits the SpHMA2 protein into the recipient plant.

[0067] Furthermore, the heavy metal accumulation capacity of the transgenic plant is higher than that of the recipient plant, which is specifically reflected in at least one of the following y1) to y4):

[0068] y1) the heavy metal content in the roots of the transgenic plants is higher than that in the recipient plants;

[0069] y2) the heavy metal content in the stems of the transgenic plants is lower than that in the recipient plants;

[0070] y3) the heavy metal content of young leaves of the transgenic plants is lower than that of the recipient plants;

[0071] y4) The heavy metal content in mature leaves of the transgenic plants is lower than that of the recipient plants.

[0072] Furthermore, the substance that inhibits SpHMA2 protein is a CRISPR / Cas9 gene editing system for knocking out SpHMA2.

[0073] In any of the above uses or methods, the heavy metal is cadmium.

[0074] In any of the above applications or methods, the plant may be a dicot or a monocot. The dicot may be Sedum serrata or Sedum alfredii.

[0075] The present invention first cloned the promoter of the Sphma2 gene of Sedum serrata and its full-length genomic sequence, and then achieved the knockout of the Sphma2 gene of Sedum serrata for the first time, and found that knocking out the Sphma2 gene significantly reduced the transport of cadmium to the aboveground parts. It was also applied in other plants such as the non-hyperaccumulator plant Sedum alfredii. By heterologously expressing Sphma2 driven by the Sphma2 or 35S promoter, it was possible to achieve the characteristic of transgenic plants to obtain heavy metal cadmium enrichment in the aboveground parts, further proving that Sphma2 is closely related to the rhizome transport efficiency of cadmium and the distribution of cadmium in the aboveground stems and leaves. It was also explained that the promoter of Sphma2 drives the Sphma2 gene as a key element for hyperaccumulation in promoting heavy metal rhizome transport and distribution in the aboveground stems and leaves. It also explains that the promoter of Sphma2 drives the Sphma2 gene as a key element for hyperaccumulation of cadmium in Sedum serrata and plays an important role in the hyperaccumulation characteristics of Sedum serrata. The promoter of Sphma2 drives the Sphma2 gene sequence, which is expected to be assembled into engineering plants as a key element to achieve hyperaccumulation of cadmium in the aboveground parts of plants, thereby realizing the assembly and application of hyperaccumulation engineering plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] Figure 1 Figure 2 shows the expression of HMA2 in hyperaccumulator Sedum serrata and non-hyperaccumulator Sedum alfredii. Transcript expression levels are expressed as the average FPKM. Sa: Sedum alfredii, Sp: Sedum serrata, R: roots, YS: young leaves, 50:50 μM CdCl2 treatment.

[0077] Figure 2 The following are the analysis of the SpHMA2 gene structure and the prediction of its transmembrane domain. (a) shows the SpHMA2 gene structure, and (b) shows the prediction of its transmembrane domain.

[0078] Figure 3 The CRISPR / Cas9 target and gene sequence of the Sphma2 gene in the first-generation transgenic plants. Note: In the wild-type Sphma2 gene, the sgRNA target and protospacer adjacent motif (PAM) sequence are indicated in light blue and dark blue, respectively. The deleted nucleotides are replaced by red dashed lines, and the sequence gap length is indicated in brackets.

[0079] Figure 4 Protein sequences of wild-type and SpHMA2 knockout transgenic plants.

[0080] Figure 5Comparison of cadmium accumulation between the SpHMA2 knockout mutant and the wild type. (a) Comparison of cadmium accumulation in roots of the SpHMA2 knockout mutant and the wild type. (b) Comparison of cadmium accumulation in stems of the SpHMA2 knockout mutant and the wild type. (c) Comparison of cadmium accumulation in mature leaves of the SpHMA2 knockout mutant and the wild type. (d) Comparison of cadmium accumulation in young leaves of the SpHMA2 knockout mutant and the wild type. The bar graph is the mean ± standard error (SE) of four replicates. Different letters indicate significant differences between groups at the 0.05 level (Ducan test).

[0081] Figure 6 Figure 1 shows the pSN1301 and SpHMA2pro::SpHMA2-GFP expression vector maps. (a) shows the pSN1301 expression vector map. (b) shows the pSN1301-SpHMA2pro::SpHMA2-GFP expression vector map.

[0082] Figure 7 GUS staining of plants expressing the SpHMA2 gene in the non-hyperaccumulator Sedum alfredii.

[0083] Figure 8 Comparison of cadmium accumulation between transgenic lines expressing 35S-driven Sphma2 and wild-type Sedum alfredii. (a) Comparison of cadmium accumulation in roots of transgenic lines and wild-type Sedum alfredii. (b) Comparison of cadmium accumulation in stems of transgenic lines and wild-type Sedum alfredii. (c) Comparison of cadmium accumulation in mature leaves of transgenic lines and wild-type Sedum alfredii; (d) Comparison of cadmium accumulation in young leaves of transgenic lines and wild-type Sedum alfredii. Plants were cultured in a 1 / 4 MS solution containing 100 μM CdCl₂ for 10 days. Bars are the mean ± standard error (SE) of four replicates. * indicates significant difference at the 0.05 level (T-test).

[0084] Figure 9 Comparison of cadmium accumulation between transgenic lines expressing Sphma2pro and the wild type in Sedum alfredii. (a) Comparison of cadmium accumulation in roots of transgenic lines and wild type Sedum alfredii. (b) Comparison of cadmium accumulation in stems of transgenic lines and wild type Sedum alfredii. (c) Comparison of cadmium accumulation in mature leaves of transgenic lines and wild type Sedum alfredii; (d) Comparison of cadmium accumulation in young leaves of transgenic lines and wild type Sedum alfredii. Plants were cultured in a 1 / 4 MS solution containing 100 μM CdCl₂ for 10 days. Bars are the mean ± standard error (SE) of four replicates. Different letters indicate significant differences between groups at the 0.05 level (Ducan test). DETAILED DESCRIPTION

[0085] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0086] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0087] The hyperaccumulator plant Sedum plumbizincicola in the following examples was from Chun'an County, Hangzhou City, Zhejiang Province, and the non-hyperaccumulator plant Sedum alfredii was from Fuyang District, Hangzhou City, Zhejiang Province. They were cultured in the greenhouse of the Institute of Botany, Chinese Academy of Sciences under the following culture conditions: light: 16h / dark: 8h; temperature: 23°C.

[0088] The pSN1301 vector in the following examples is described in the document “Liu, Huan, Zhao, et al. Heavy metal ATPase 3 (HMA3) confers cadmium hypertolerance on the cadmium / zinchyperaccumulator Sedum plumbizincicola [J]. New Phytologist, 2017.”

[0089] The pCBC-DT1T2 vector and pHSE401 vector in the following examples are both described in the document “Xing H, Dong L, Wang Z, et al. A CRISPR / Cas9 toolkit for multiplex genome editing in plants [J]. BMC Plant Biology, 2014, 14: 327.”

[0090] The LBA4404 / pRiA4-VIR1 Agrobacterium in the following examples is described in the document “Zhang Y, Zhang Q, Chen QJ. Agrobacterium-mediated delivery of CRISPR / Cas reagents for genome editing in plants enters an era of ternary vector systems. Sci China Life Sci. 2020 Oct; 63(10): 1491-1498.”

[0091] The data analysis method in the following examples is as follows: the sample data were subjected to one-way analysis of variance (ANOVA) using the Duncan test, and the differences were considered significant at the 0.05 level. Alternatively, the independent sample T test was used for analysis, and the differences were considered significant at the 0.05 level. The analysis was performed using IBM SPSS STATISTICS 21.

[0092] The formula of the 1 / 4 MS solution in the following examples is as follows: MS macroelement mixture powder (Beijing Coolaibo Technology Co., Ltd., product number PM1910) is dissolved in distilled water to a final concentration of 1.058 g / L, and the pH is adjusted to 5.85.

[0093] The primer sequences involved in the following Example 1 are shown in Table 1.

[0094] Table 1. Primers for amplifying the SpHMA2 gene and its promoter sequence

[0095] Primers Sequence (5'→3') SpHMA2-FW1 aATGGCCTTAGGCGACGAAAA SpHMA2-RV1 AGCGGAGGAAAGAGGAACTGG SpHMA2-FW2 TTCCCTTTTCCAGTTCCTCTT SpHMA2-RV2 TTTCGATCTGCCGTAGTCCAC SpHMA2-FW3 GTTTCGAGCATTGAGAGTAAG SpHMA2-RV3 ACCTCTCAAAAGCAACATACT SpHMA2-FW4 TTGGGCGGCTGTGTTGGCTGA SpHMA2-RV4 ACAAACCGACTTGGAATACTT SpHMA2-C-FW TTTTCCATCTTCTCTTCAAACTCA SpHMA2-C-RV GTATCTACTCCACAACAATCTCGG SpHMA2-pro-FW5 TCGAACATGGAGAGAAAGGAG SpHMA2-pro-RV4 CTTGGATTTTTGCTTCTTGGT

[0096] Example 1: Cloning and analysis of the SpHMA2 gene and promoter sequence

[0097] 1. Cloning of the SpHMA2 gene and promoter sequence

[0098] 1. Using Sedum serrata genomic DNA as a template, PCR amplification was performed using primers SpHMA2-FW1 / SpHMA2-RV1, SpHMA2-FW2 / SpHMA2-RV2, SpHMA2-FW3 / SpHMA2-RV3, and SpHMA2-FW4 / SpHMA2-RV4, respectively. The full-length SpHMA2 gene was cloned from the genome in segments. The nucleotide sequence of the full-length SpHMA2 gene is shown in SEQ ID NO: 2385-6942 in SEQ ID NO: 1 in the sequence listing.

[0099] 2. Using Sedum serrata genomic DNA as a template, primers SpHMA2-pro-FW5 / SpHMA2-pro-RV4 were used for PCR amplification to obtain a SpHMA2 gene promoter sequence of approximately 2300 bp. The SpHMA2 gene promoter sequence is shown in sequence 1, positions 1-2384 in the sequence listing.

[0100] 3. Using the cDNA of Sedum serrata as a template, PCR amplification was performed with primers SpHMA2-C-FW / SpHMA2-C-RV, and the CDS sequence of the SpHMA2 gene was cloned from the cDNA. The CDS sequence is shown as Sequence 2 in the sequence listing, and the encoded amino acid sequence is shown as Sequence 3 in the sequence listing.

[0101] 2. Expression of the SpHMA2 gene in the hyperaccumulator Sedum serrata and the non-hyperaccumulator Sedum alfredii

[0102] The hyperaccumulator Sedum serrata and the non-hyperaccumulator Sedum alfredii were treated with 0 μM and 50 μM CdCl2 solutions for 10 days, respectively. The roots and young leaves were collected to analyze the expression of the SpHMA2 gene in the hyperaccumulator Sedum serrata and the non-hyperaccumulator Sedum alfredii.

[0103] From the transcriptome data, it was found that the SpHMA2 gene was highly abundantly expressed in the hyperaccumulator Sedum serrata and was the most abundant heavy metal transporter gene in the roots of Sedum serrata. Figure 1 ), and speculated that it may play a key role in the root-to-shoot transport of cadmium.

[0104] 3. Sphma2 gene sequence analysis

[0105] SpHMA2 is a key candidate gene for cadmium transport in the rhizomes of Sedum serrata. It is constitutively expressed at high abundance in Sedum serrata and is closely related to cadmium hyperaccumulation. Analysis of the full-length genomic sequence and promoter sequence of SpHMA2 revealed that SpHMA2 has eight exons, encoding a membrane protein consisting of 969 amino acids with six transmembrane helices ( Figure 2 ).

[0106] Example 2: Obtaining Sphma2 gene knockout mutants and phenotypic analysis

[0107] 1. Obtaining Sphma2 gene knockout mutants

[0108] 1. Construction of Sphma2 knockout vector

[0109] 1) Design of Sphma2 knockout targets

[0110] Targets were designed based on the SpHMA2 gene sequence, and the following two SpHMA2 gene knockout targets were finally screened: Target 1 (Target1) and Target 2 (Target2). Both Target 1 and Target 2 are located in the sixth exon of the SpHMA2 gene, and the specific sequences are as follows:

[0111] Target 1: 5'-GTCGAGCCAAAGCCTGATG-3'.

[0112] Target 2: 5'-CAACAAAAGAATGGCCACT-3'.

[0113] 2) Construction of Sphma2 knockout vector

[0114] Using the pCBC-DT1T2 vector as a template, primers HMA2-DT1-F0 and HMA2-DT2-R0 were used for PCR amplification to obtain an intermediate fragment. This intermediate fragment was then used as a template for PCR amplification using primers HMA2-DT1-BsF and HMA2-DT2-BsR to obtain a PCR fragment. The PCR fragment was then inserted between the two Bsa I sites of the pHSE401 vector using Golden Gate cloning. The SpHMA2 knockout vector was obtained by sequencing and verification. The primer sequences are as follows: HMA2-DT1-BsF: ATATATGGTCTCGATTGGTCGAGCCAAAGCCTGATGGTT;

[0115] HMA2-DT1-F0: TGGTCGAGCCAAAGCCTGATGGTTTTAGAGCTAGAAATAGC; HMA2-DT2-R0: AACAGTGGCCATTCTTTTGTTGCAATCTCTTAGTCGACTCTAC;

[0116] HMA2-DT2-BsR:ATTATTGGTCTCGAAACAGTGGCCATTCTTTTGTTGCAA.

[0117] 2. Acquisition and identification of Sphma2 knockout materials

[0118] The correctly sequenced Sphma2 knockout vector was introduced into LBA4404 / pRiA4-VIR1 Agrobacterium to obtain recombinant bacteria; wild-type Sedum serrata clustered shoots were transformed using Agrobacterium-mediated genetic transformation to obtain T0 generation transgenic plants.

[0119] The primers 5'-GTTTCGAGCATTGAGAGTAAGT-3' and 5'-ATCCCAGCTAAGGTTGTTCCAG-3' were used to detect DNA in the T0 generation transgenic plants to determine the editing mode of the transgenic plants, and two SpHMA2 knockout mutant lines were selected and named sphma2-ko line1 and sphma2-ko line2, respectively.

[0120] In SpHMA2-ko line1, one homologous chromosome (SpHMA2-ko line1 allele1) contains a 10-base deletion of SpHMA2 at Target1 and a 3-base deletion at Target2. The other homologous chromosome (SpHMA2-ko line1 allele2) contains a 1-base deletion of SpHMA2 at Target1 and a 2-base deletion at Target2. These deletions result in premature stop codons and protein translation. Consequently, SpHMA2-ko line1 allele1 and SpHMA2-ko line1 allele2 encode proteins of 462 and 466 amino acids, respectively.

[0121] The SpHMA2 on one homologous chromosome (SpHMA2-ko line1 allele1) in SpHMA2-ko line2 deleted 10 bases at Target1 and 3 bases at Target2, resulting in a premature stop codon and encoding a protein of 462 amino acids; the SpHMA2 on the other homologous chromosome (SpHMA2-ko line1 allele2) only had a 3-base deletion at Target2, resulting in a protein sequence missing one amino acid.

[0122] Schematic diagram of target site and gene sequence alignment in wild-type Sedum serrata and SpHMA2 knockout mutant lines is shown in the figure. Figure 3 As shown in the figure, the protein amino acid sequence alignment diagram of wild-type Sedum serrata and SpHMA2 knockout mutant strains is shown in the figure. Figure 4 shown.

[0123] 2. Phenotypic Analysis of Sphma2 Knockout Mutants

[0124] In order to analyze the function of the Sphma2 gene in Sedum sphaerocarpa, the cadmium content of Sphma2 knockout mutant strains (sphma2-koline1 and sphma2-ko line2) and wild-type Sedum sphaerocarpa was detected. The specific method is as follows: After the mature plants were treated with a 1 / 4MS solution containing 100μM CdCl2 for 10 days, the roots, stems, young leaves and mature leaves were collected and the cadmium content was measured. Among them, the roots were soaked in phosphate buffered saline (PBS) with 10mM EDTA for 20 minutes to remove cadmium ions adsorbed on the root surface. The washing was repeated three times, and the cadmium content of the remaining plant materials, stems, young leaves and mature leaves, was directly measured. The method for determining the cadmium content is as follows:

[0125] (1) Weighing: Weigh the dry weight of the plant material sample to be used for determination using an analytical balance and record the data.

[0126] (2) Nitration: Place the dry material to be tested in a 50 mL long test tube, add 1 mL of concentrated nitric acid and nitrate for 4-12 hours, and place a funnel on the test tube to prevent acid volatilization.

[0127] (3) Cooking: The cold nitrated material is cooked in a temperature-controlled far-infrared cooking furnace (LWY-84B) at 180°C for 2-4 hours. The cooking process is completed in a fume hood.

[0128] (4) Volume filtration: After the sample has cooled, dilute to 10 mL with ultrapure water, filter using a disposable syringe and a needle filter (13 mm, 0.22 μM, water filter membrane), and store at 4°C until testing.

[0129] (5) Standard sample configuration: Standard cadmium curve concentration: 0ppm, 0.1ppm, 0.2ppm, 0.5ppm, 1ppm, 2ppm, 5ppm.

[0130] (6) Content determination: The cadmium content was determined using an inductively coupled plasma optical emission spectrometer iCAP6300 ICP-OES (Thermoelectron Corporation, USA), and the cadmium content in the sample was calculated based on the mass and dilution factor.

[0131] The results showed that the cadmium contents in the roots of wild-type Sedum truncatum, SpHMA2 mutant lines sphma2-ko line1 and sphma2-koline2 were 255.90 mg / kg, 691.93 mg / kg and 873.70 mg / kg, respectively. The cadmium contents in the roots of the two mutant lines sphma2-ko line1 and sphma2-ko line2 showed an increasing trend, among which sphma2-koline2 showed significant differences from the wild-type Sedum truncatum. In the aboveground parts, namely stems, mature leaves and young leaves, the cadmium contents of sphma2-koline1 and sphma2-ko line2 were significantly lower than those of the wild-type Sedum truncatum. The cadmium contents of the wild-type Sedum truncatum, Sphma2 mutant lines sphma2-ko line1 and sphma2-ko line2 in stems were 2731.91 mg / kg, 1564.01 mg / kg and 1436.26 mg / kg, respectively; the cadmium contents of the wild-type Sedum truncatum, Sphma2 mutant lines sphma2-ko line1 and sphma2-ko line2 in mature leaves were 1086.87 mg / kg, 160.72 mg / kg and 154.60 mg / kg, respectively; the cadmium contents of the wild-type Sedum truncatum, Sphma2 mutant lines sphma2-ko line1 and sphma2-ko The cadmium contents in the young leaves of line2 were 7324.78 mg / kg, 1246.96 mg / kg, and 692.32 mg / kg, respectively. These results indicate that knocking out the SpHMA2 gene significantly reduced the transport of cadmium to the aboveground parts. The cadmium content of the SpHMA2 knockout mutant increased in the underground part and decreased in the aboveground part ( Figure 5 ).

[0132] Example 3: Obtaining transgenic plants heterologously expressing SpHMA2 in Sedum alfredii and phenotypic analysis

[0133] 1. Obtaining transgenic plants expressing SpHMA2 in Sedum alfredii

[0134] 1. Construction of overexpression vector

[0135] The DNA molecule shown in positions 2391-6015 of SEQ ID NO: 4 (SpHMA2 gene CDS sequence and GFP gene sequence) was ligated into the pSN1301 vector between the Xba I and Kpn I sites to construct the pSN1301-35S::SpHMA2-GFP expression vector in which 35S drives the expression of the SpHMA2 gene.

[0136] The DNA molecule shown in SEQ ID NO: 4 (SEQ ID NO: 1-2384 represents the SpHMA2 promoter, SEQ ID NO: 2391-5297 represents the SpHMA2 gene CDS sequence, and SEQ ID NO: 5298-6015 represents the GFP gene sequence) was ligated into the pSN1301 vector between the Hind III and BamH I sites to construct the pSN1301-SpHMA2pro::SpHMA2-GFP expression vector in which SpHMA2pro drives the expression of the SpHMA2 gene.

[0137] The schematic diagram of the structures of pSN1301 vector, pSN1301-35S::SpHMA2-GFP expression vector and pSN1301-SpHMA2pro::SpHMA2-GFP expression vector is shown in the figure. Figure 6 shown.

[0138] 2. Obtaining transgenic plants

[0139] The pSN1301-SpHMA2pro::SpHMA2-GFP expression vector and the pSN1301-35S::SpHMA2-GFP expression vector were respectively introduced into Agrobacterium LBA4404 / pRiA4-VIR1 to obtain recombinant bacteria; the wild type Sedum alfredii clustered shoots were transformed using Agrobacterium-mediated genetic transformation to obtain T0 generation transgenic plants.

[0140] 3. Identification of transgenic plants

[0141] Since the overexpression vector carries the GUS gene, the GUS method can be used to identify the transgenic strains of Sedum alfredii expressing the SpHMA2 gene. The transgenic strains that can be dyed blue by the GUS dye are the transgenic strains of Sedum alfredii expressing the SpHMA2 gene.

[0142] The staining results are as follows Figure 7 As shown, after identification, the T0 generation 35S promoter-driven Sphma2 transgenic Sedum alfredii line pSN1301-35S::SpHMA2-GFP and the T0 generation Sphma2 promoter-driven Sphma2 transgenic Sedum alfredii lines Sphma2pro::SpHMA2-GFP line1 and Sphma2pro::SpHMA2-GFP line2 were obtained.

[0143] 2. Phenotypic analysis of transgenic plants heterologously expressing SpHMA2 in Sedum alfredii

[0144] Cadmium content was measured in the T0 generation 35S promoter-driven Sphma2 transgenic Sedum alfredii line pSN1301-35S::SpHMA2-GFP, the T0 generation Sphma2 promoter-driven Sphma2 transgenic Sedum alfredii lines Sphma2pro::SpHMA2-GFP line 1 and Sphma2pro::SpHMA2-GFP line 2, and the wild-type Sedum alfredii. The specific steps were the same as in Example 2.

[0145] The cadmium content of the 35S promoter-driven Sphma2 transgenic Sedum alfredii line pSN1301-35S::SpHMA2-GFP and the wild type Sedum alfredii was tested. Figure 8 The results showed that the cadmium content in the roots of the 35S promoter-driven Sphma2 transgenic Sedum alfredii line pSN1301-35S::SpHMA2-GFP was reduced, while the cadmium content in the stems, mature leaves, and young leaves was higher than that of the wild-type Sedum alfredii. In particular, the cadmium content in the young leaves was significantly higher than that of the wild-type Sedum alfredii. Among them, the cadmium contents in the roots of the wild-type Sedum alfredii and the 35S promoter-driven SphMA2 transgenic Sedum alfredii line pSN1301-35S::SpHMA2-GFP were 1409.00 mg / kg and 1043.80 mg / kg, respectively; the cadmium contents in the stems of the wild-type Sedum alfredii and the 35S promoter-driven SphMA2 transgenic Sedum alfredii line pSN1301-35S::SpHMA2-GFP were 583.45 mg / kg and 910.56 mg / kg, respectively; the cadmium contents in the mature leaves were 65.19 mg / kg and 91.14 mg / kg, respectively; the cadmium contents in the young leaves of the wild-type Sedum alfredii and the 35S promoter-driven SphMA2 transgenic Sedum alfredii line pSN1301-35S::SpHMA2-GFP were 21.97 mg / kg and 89.33 mg / kg, respectively. These results indicate that driving the expression of SpHMA2 gene via 35S promoter in Sedum alfredii promoted the transport of cadmium to the aboveground parts, and SpHMA2 restored the aboveground cadmium accumulation ability of the non-hyperaccumulator Sedum alfredii, indicating that SpHMA2 plays a role in the root-stem transport of cadmium and the distribution of cadmium to the stems and leaves.

[0146] The SpHMA2 promoter drives the SpHMA2 transgenic Sedum alfredii lines SpHMA2pro::SpHMA2-GFP line1 and SpHMA2pro::SpHMA2-GFP line2, and the wild type Sedum alfredii were tested for cadmium content. Figure 9The results showed that the cadmium content in the roots of the two SpHMA2-overexpressing lines, Sphma2pro::SpHMA2-GFP line1 and Sphma2pro::SpHMA2-GFP line2, was not significantly different from that of the wild-type Sedum alfredii. However, the cadmium content in the aboveground parts, namely the stems, mature leaves, and young leaves, was higher than that of the wild-type Sedum alfredii. In particular, the cadmium content in the stems of Sphma2pro::SpHMA2-GFP line1 and Sphma2pro::SpHMA2-GFP line2 was significantly higher than that of the wild-type Sedum alfredii. The cadmium contents in stems of wild-type S. alfredii, Sphma2 promoter-driven Sphma2 transgenic S. alfredii lines Sphma2pro::SpHMA2-GFP line1 and Sphma2pro::SpHMA2-GFP line2 were 232.23 mg / kg, 1170.50 mg / kg and 1225.29 mg / kg, respectively. The cadmium contents in mature leaves of wild-type S. alfredii, Sphma2 promoter-driven Sphma2 transgenic S. alfredii lines Sphma2pro::SpHMA2-GFP line1 and Sphma2pro::SpHMA2-GFP line2 were 27.05 mg / kg, 101.57 mg / kg and 76.56 mg / kg, respectively. The cadmium concentrations in young leaves of line 2 were 1.73 mg / kg, 98.71 mg / kg, and 104.90 mg / kg, respectively. These results indicate that driving the expression of the SpHMA2 gene using the SpHMA2 promoter significantly promoted the translocation of cadmium to the aboveground parts of S. alfredii. SpHMA2 restored the aboveground cadmium accumulation capacity of the non-hyperaccumulator S. alfredii., suggesting that SpHMA2 plays a role in cadmium translocation from roots to stems and cadmium distribution from stems to leaves.

[0147] Furthermore, transgenic Sedum alfredii lines driven by the Sphma2 promoter showed a stronger ability to transport cadmium to the aboveground parts than those driven by the 35S promoter. This further demonstrates that not only the Sphma2 gene but also the Sphma2 promoter plays a key role in cadmium transport, further confirming that Sphma2, driven by the Sphma2 promoter, is a key element for cadmium hyperaccumulation in Sedum serrata. Its expression in other non-hyperaccumulator plants can impart partial hyperaccumulation characteristics, thus possessing significant application value in the assembly of plants for phytoremediation projects.

[0148] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A DNA fragment or its related biological material; The DNA fragment sequentially comprises a SpHMA2 gene transcriptional regulatory element and a SpHMA2 gene; The nucleotide sequence of the SpHMA2 gene transcriptional regulatory element is as shown in positions 1 - 2384 of Sequence 1 in the sequence listing; The nucleotide sequence of the SpHMA2 gene is a DNA molecule as shown in positions 2385 - 6942 of Sequence 1 in the sequence listing or a DNA molecule as shown in Sequence 2 in the sequence listing; The related biological material is a recombinant vector or a recombinant microorganism containing the DNA fragment.

2. Use of the DNA fragment or its related biological material according to Claim 1 in any one of the following 1) - 4): 1) Regulating the heavy metal accumulation ability of plants; 2) Regulating the heavy metal transport and / or distribution of plants; 3) Cultivating heavy metal hyperaccumulating plants; 4) Treating and / or remediating soil heavy metal pollution.

3. Use of the SpHMA2 protein or its related biological material in any one of the following 1) - 4): 1) Regulating the heavy metal accumulation ability of plants; 2) Regulating the heavy metal transport and / or distribution of plants; 3) Cultivating heavy metal hyperaccumulating plants; 4) Treating and / or remediating soil heavy metal pollution; The SpHMA2 protein is any one of the following (a1) - (a4): (a1) The protein as shown in Sequence 3 in the sequence listing; (a2) A fusion protein obtained by connecting a tag to the N - terminus and / or C - terminus of the protein in (a1); (a3) A protein related to plant heavy metal transport and / or distribution obtained by substituting and / or deleting and / or adding one or several amino acid residues to (a1); (a4) A protein having more than 98% identity with (a1) and related to plant heavy metal transport and / or distribution; The related biological material is a nucleic acid molecule encoding the SpHMA2 protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

4. According to the use described in Claim 3, characterized in that: The expression cassette comprises a SpHMA2 gene transcriptional regulatory element and a SpHMA2 gene.

5. According to the use described in Claim 3 or 4, characterized in that: The nucleic acid molecule encoding the SpHMA2 protein is any one of the following (A1) - (A3) DNA molecules: (A1) The DNA molecule as shown in positions 2385 - 6942 of Sequence 1 in the sequence listing; (A2) The DNA molecule as shown in Sequence 2 in the sequence listing; (A3) A DNA molecule having more than 75% identity with (A1) or (A2) and encoding the SpHMA2 protein.

6. Use of a substance that inhibits the SpHMA2 protein described in Claim 3 in any one of the following (d1) - (d3): (d1) Reducing the heavy metal accumulation ability of plants; (d2) Inhibiting heavy metal transport and / or distribution; (d3) Cultivating heavy metal non - hyperaccumulating plants.

7. A method for cultivating a heavy metal hyperaccumulating plant, which is as follows (1) or (2): The (1) includes the step of introducing the DNA fragment described in claim 1 into a recipient plant to obtain a transgenic plant; the heavy metal accumulation ability of the transgenic plant is higher than that of the recipient plant; The (2) includes the step of increasing the activity and / or content of the SpHMA2 protein described in claim 1 in a recipient plant to obtain a transgenic plant; the heavy metal accumulation ability of the transgenic plant is higher than that of the recipient plant.

8. According to the method described in claim 7, It is characterized in that: In the (2), the method for increasing the activity and / or content of the SpHMA2 protein described in claim 1 in the recipient plant is to overexpress the SpHMA2 protein in the recipient plant; And / or, the method for overexpression is to introduce the DNA molecule shown in Sequence 1 into the recipient plant.

9. A method for cultivating a non-heavy metal hyperaccumulating plant, including the step of reducing the activity and / or content of the SpHMA2 protein described in claim 1 in a recipient plant to obtain a transgenic plant; the heavy metal accumulation ability of the transgenic plant is lower than that of the recipient plant.

10. According to any one of the applications described in claims 1-5 or according to any one of the methods described in claims 6-8, It is characterized in that: The heavy metal is cadmium.

Images