Rice terpene phytoalexin synthesis gene OsCPS4 and application

By studying and applying the rice terpene phytoalexin synthesis gene OsCPS4, and using genetic transformation methods to cultivate transgenic rice resistant to brown planthoppers, the problem of unclear mechanism of rice resistance to brown planthoppers was solved, and significant insect resistance effect was achieved.

CN120060300BActive Publication Date: 2026-01-06HUAZHONG AGRI UNIV +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510281464.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-11
Publication Date
2026-01-06
Estimated Expiration
2045-03-11

AI Technical Summary

Technical Problem

In the existing technology, the mechanism of rice resistance to brown planthopper is unclear, the role of the OsCPS4 gene in insect resistance is not well understood, and research on phytoalexins in the field of insect resistance is insufficient.

Method used

By studying the expression and function of the rice terpene phytoalexin synthesis gene OsCPS4, we used Agrobacterium-mediated genetic transformation to achieve overexpression and RNAi inhibition of OsCPS4 in rice, constructed overexpression vectors and RNAi vectors, and cultivated transgenic plants resistant to brown planthoppers.

Benefits of technology

OsCPS4 overexpression significantly improved resistance to brown planthopper, while RNAi inhibition significantly reduced resistance, providing a molecular mechanism basis and breeding reference for rice resistance to brown planthopper.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060300B_ABST
    Figure CN120060300B_ABST
Patent Text Reader

Abstract

The application discloses a rice terpene phytoalexin synthesis gene OsCPS4 and application, relates to the field of plant genetic engineering, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1. The application is a good example that the rice terpene phytoalexin participates in crop insect resistance, has certain reference value for understanding the regulation of the rice terpene phytoalexin on pest resistance, and OsCPS4 the research on the gene provides a good theoretical basis for the molecular mechanism of the rice brown plant hopper resistance gene, and has important significance for molecular design breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and particularly to a gene for synthesizing terpenoid phytoalexins in rice. OsCPS4 and its applications. Background Technology

[0002] Rice ( Oryza sativa Due to the hot and humid growing environment, which is highly conducive to the growth and reproduction of pathogens and pests, rice is threatened by a large number of diseases and pests during its growth process. Among them, the brown planthopper (… Nilaparvata lugens Brown planthoppers (Stål.; BPH) are among the most widespread and damaging pests affecting rice production in my country. A typical piercing-sucking insect, they use their specialized needle-like mouthparts to pierce and suck sap from the phloem of rice stems, causing damage such as nutrient loss, yellowing leaves, wilting, lodging, and severe yield reduction, sometimes resulting in total crop failure (Wang et al., 2008; Cheng et al., 2012). Besides direct damage, brown planthoppers can also spread or induce various rice diseases, causing indirect harm. Therefore, controlling the development and damage caused by brown planthoppers is a crucial requirement for ensuring the safety of rice production in my country.

[0003] Phytoalexins are a class of secondary metabolites of plants. The types and contents of phytoalexins are specific to different species, and the types and contents of phytoalexins vary greatly from species in response to different environmental stresses or natural environments.

[0004] Currently, 16 phytoprotective elements have been identified in rice. Except for naringenin and chrysanthin, which are flavonoid phytoprotective elements, the remaining 14 are terpenoid phytoprotective elements. Based on the basic carbon skeleton, phytoprotective elements in rice can be divided into four categories: phytocassanes AE, oryzalexins AF, momilactones A and B, and oryzalexin S (Koga et al, 1995; Cho et al, 2004; Peters et al, 2006). Naringenin, phytocassanes, and momilactones are the main phytoprotective elements in rice. GGDP (geranylgeranyl diphosphate) is a major precursor to rice terpenoid phytoprotective agents. It is converted into ent-copalyl diphosphate and syn-copalyl diphosphate via OsCPS2 and OsCPS4, respectively. Ent-copalyl diphosphate, under the influence of OsKSL7 and OsKSL10, undergoes a series of reactions to ultimately form phytocarcinogen AE and rice defensin AF, respectively. Syn-copalyl diphosphate, under the influence of OsKSL4 and OsKSL8, undergoes a series of reactions to ultimately form oreganolide A, B, and rice defensin S, respectively. Cherry blossom extract is converted into naringenin under the influence of the NOMT gene. Current research indicates that phytoprotective agents exhibit non-specific broad-spectrum resistance against many pathogens, but their application in insect resistance has not yet been studied.

[0005] Rice brown planthopper resistance gene Bph6 This is a novel, broad-spectrum insect-resistant gene that encodes a previously unstudied protein. It exhibits high resistance to both brown planthoppers and white-backed planthoppers, and has significant application value in breeding rice varieties resistant to brown planthoppers (Guo et al., 2018). The study found that BPH feeding induces the production of terpene phytoalexin genes. OsCPS4 And in Bph6 The upregulation was more significant in plants, indicating that phytoalexins... Bph6 It plays an important role in the resistance signaling pathway. However, the specific mechanism of action is not well understood. Meanwhile, OsCPS4 OsCPS4 is an important gene in the phytoalexin synthesis pathway, but its role in rice resistance to brown planthopper remains unknown. Summary of the Invention

[0006] The purpose of this invention is to provide a gene for synthesizing rice terpenoid phytoalexins. OsCPS4 And its functional study on rice resistance to brown planthopper.

[0007] The first aspect of this invention is to provide a rice terpene phytoalexin synthesis gene. OsCPS4 According to the analysis of NCBI 9311, the CDS sequence of the gene is shown in SEQ ID NO.1, and its full-length ORF is 2304 bp.

[0008] Those skilled in the art should understand that, based on the nucleotide sequence shown in SEQ ID No. 1, replacing, deleting, and / or adding one or more nucleotides can yield an amino acid sequence with the same function. For example, in sequences under different rice backgrounds, replacing or deleting one or more nucleotides does not result in frameshift mutations in the encoded amino acid sequence; only partial amino acid deletions or point mutations occur. Therefore, the gene described in this invention also includes nucleotide sequences with the same function, obtained by replacing, deleting, and / or adding one or more nucleotides to the nucleotide sequence shown in SEQ ID No. 1.

[0009] Furthermore, the ORF sequence of the gene is shown in SEQ ID NO.1, encoding 767 amino acids.

[0010] OsCPS4 The discovery and experimental progress of genes:

[0011] 1) Discovery Process: In studying the changes in the expression levels of rice-related genes after treatment with 6-BA and feeding by brown planthoppers, it was found that compared to the control group, OsCPS4 The expression level in Bph6 -NIL materials show a significant upregulation.

[0012] 2) Genetic transformation verification function: OsCPS4 The full-length ORF was inserted into the vector pRHV containing the ubi promoter. Using Agrobacterium EHA105-mediated genetic transformation, the overexpression vector was introduced into Nipponbare bacteria, ultimately yielding... OsCPS4 Twenty-one transgenic plants were overexpressed. Similarly, [the following was done]. OsCPS4 RNAi vector transformation Bph6 -NIL was used to obtain 22 RNAi-inhibited plants.

[0013] The screening primers are respectively

[0014] Hyg-L:GCTCCATACAAGCCAACCAC (5'-3')

[0015] Hyg-R:GAAAAAGCTGAACTCACCG (5'-3')

[0016] Insect resistance was identified in T3 generation transgenic homozygous plants. OsCPS4 Overexpression upregulates plant resistance to brown planthopper. OsCPS4RNAi significantly downregulated plant resistance to brown planthoppers.

[0017] The second aspect of this invention is the rice terpene phytoalexin synthesis gene described above. OsCPS4 Application in the breeding of brown planthopper-resistant rice varieties.

[0018] OsCPS4 Methods for cultivating plants that overexpress the gene include:

[0019] 1) Transformation of plant cells with polynucleotides; said polynucleotides contain genes for the synthesis of rice terpene phytoalexins. OsCPS4 The ORF, whose nucleotide sequence is shown in SEQ ID NO.1;

[0020] 2) The transformed plant cells regenerate into plants;

[0021] 3) Cultivate regenerated plants and overexpress the above polynucleotides.

[0022] The plant in question is a monocotyledonous plant.

[0023] The monocotyledonous plant mentioned is rice.

[0024] Rice terpene phytoalexin synthesis gene OsCPS4 The molecular detection method involves amplifying the genomic DNA of the transgenic rice to be tested using the primer pair and detecting the amplification product. These primers are vector primers, and this sequence is not present in the wild-type rice genome. If a 728bp amplification fragment is obtained using primers Hyg-F and Hyg-R, it indicates a transgenic positive plant; if this fragment is not amplified, it indicates a transgenic negative plant.

[0025] A third aspect of the invention is to provide a protein encoded by the aforementioned gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0026] It should be understood that, without affecting the activity of the OsCPS4 protein (i.e. not at the active site of the protein), those skilled in the art can make various substitutions, additions and / or deletions of one or more amino acids in the amino acid sequence shown in SEQ ID NO.2 to obtain an amino acid sequence with equivalent function.

[0027] The present invention also includes, based on the sense or antisense sequence of the polynucleotide, a cloning vector or expression vector containing the polynucleotide sequence or a fragment thereof, a host cell containing the vector, a transformed plant cell containing the nucleotide sequence or a fragment thereof, and a transgenic plant.

[0028] Compared with the prior art, the beneficial effects of the present invention are:

[0029] 1. This invention is a good example of the role of rice terpenoid phytoprotective agents in crop insect resistance, which has certain reference value for understanding the regulation of pest resistance by rice terpenoid phytoprotective agents.

[0030] 2. OsCPS4 The study of genes has provided a sound theoretical basis for the molecular mechanism of rice resistance to brown planthopper genes, which is of great significance for molecular design breeding. Attached Figure Description

[0031] Figure 1 for OsCPS4 Expression detection. After 6-BA treatment and feeding by brown planthoppers, OsCPS4 Expression levels were significantly upregulated and increased. OsCPS4 Expression was induced by 6-BA treatment and also by feeding on brown planthoppers;

[0032] Figure 2 For the identification of insect resistance in transgenic and knockout mutant seedlings using the group method;

[0033] Figure 3 To identify the resistance of transgenic and knockout mutant brown planthoppers to honeydew and insect weight gain methods. Detailed Implementation

[0034] Unless otherwise specified, the techniques used are conventional techniques well known to those skilled in the art; the experimental methods used are all conventional methods and can be performed according to the described recombination techniques (see Molecular Cloning, Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); and the materials and reagents used are all commercially available.

[0035]

Example 1

[0036] When studying the changes in the expression levels of rice-related genes after treatment with 6-BA and brown planthopper, it was found that... OsCPS4 The expression level was significantly upregulated compared to the control group. Primers were designed for the ORF, and PCR amplification was performed using Nipponbare rice (template) cDNA as a template. A high-fidelity enzyme KOD-Plus-Neo (TOYOBO, Japan) was used in a 50 µl reaction system. PCR conditions were: 94℃ pre-denaturation for 2 min, 95℃ denaturation for 10 s, 68℃ annealing extension for 30 s / kb, for 32 cycles. The PCR system is as follows:

[0037] Element Volume (μl) Final concentration Double distilled water 31μl - 10× PCR Buffer 5μl 1× 2 mM dNTPs 5μl 0.2mM each 25 mM Mg2+ 3μl 1.5mM Primer F + Primer R (10 μM) 1.5μl + 1.5μl 0.3μM each KOD-Plus-Neo (U / μl) 1μl 1U / 50μl DNA template 2 μl (100 ng / μl) 200ng / 50μl Total volume 50μl -

[0038] The PCR products were recovered and ligated into the pMD18-T vector. Positive clones were screened and sequenced. The results are shown in SEQ ID No. 1.

[0039] [Example 2] Rice OsCPS4 Quantitative PCR detection of genes

[0040] In order to understand OsCPS4 Whether the gene is induced by cytokinin 6-BA, take Bph6 Expression analysis of NIL samples treated with Mock, 6-BA (a common cytokinin), and Lov (a cytokinin synthesis inhibitor) revealed that 6-BA treatment induced upregulation of this gene expression. Figure 1 A).

[0041] In order to understand OsCPS4 Whether the gene is induced by feeding on brown planthoppers, Bph6 -NIL expression analysis was performed on samples treated with brown planthoppers at different feeding times, and the results showed that the expression of this gene was upregulated inducible by brown planthopper feeding. Figure 1 B).

[0042] The primers used for quantitative PCR are:

[0043] OsCPS4-qRTF: TGACGAGGCTGGGCATATC (5'-3')

[0044] OsCPS4-qRTR: TTCTGGAGTCCAGTTCCTGAAA (5'-3')

[0045]

Example 3

[0046] OsCPS4 Construction of overexpression vectors

[0047] The inventors designed primers by truncating a segment from each end of the OsCPS4 ORF, with the following sequences:

[0048] OECPS4-F: ATTCCCGGGATGCCGGTCTTCACTGCGT (5'-3')

[0049] OECPS4-R: ATTCCCGGGAATCACATCTTGGAATATGAC (5'-3')

[0050] The vector used was pRHV (provided by Researcher Ning Yuese of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences). The pRHV vector was digested with SamI enzyme, and the exogenous fragment was directly ligated into the digested and dephosphated vector. Based on the sequence information in SEQ ID No. 1, the ORF was amplified by PCR, digested, and then ligated into the vector. After sequencing verification, the resulting vector was identified as the OsCPS4 gene overexpression vector, which was electroporated into Agrobacterium EHA105. Single colonies were picked and cultured for expansion. After PCR verification, an equal volume of 50% glycerol was added, mixed thoroughly, and stored at -80℃ for later use.

[0051] OsCPS4 Inhibition vector construction

[0052] The inventor will OsCPS4 Primers were designed based on a non-homologous sequence, the sequence of which is as follows:

[0053] RiCPS4-R1F: CCTTCACGCTCGCCGCCGTCG (5'-3')

[0054] RiCPS4-R1R: CCTCTCTCGCATTTATCGGTG (5'-3')

[0055] RiCPS4-R1P3: GGGGTACCGAATTCCTCGAGCCTCTCTCGCATTTATCGGTG(5'-3')

[0056] RiCPS4-R1P4:

[0057] CAGTTGGGAAATTGGGTTCGAAGACAATGCTGGGGATTGACT(5'-3')

[0058] Meanwhile, the determination of the PDK intron fragment and primer design are as follows:

[0059] PdkP3 F: CTCGAGGAATTCGGTACCCC

[0060] PdkP4 R: TTCGAACCCAATTTCCCAACTG

[0061] The vector used was pCXUN (provided by Researcher Ning Yuese of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences). The pCXUN vector was digested with XcmI to remove the exogenous fragment, which was then directly ligated into the digested and dephosphated vector. Based on the sequence information in SEQ ID No. 1, a specific sequence and PDK intron on OsCPS4 were first amplified by PCR. Then, non-homologous sequences were ligated to the PDK intron via overlap PCR. After purification and addition of alpha, the ligation was performed and the resulting vector was ligated into the digested vector. After sequencing verification, the obtained vector became the OsCPS4 gene RNAi repressor vector. This vector was then transformed into Agrobacterium EHA105. Single colonies were picked and cultured for expansion. After PCR verification, an equal volume of 50% glycerol was added, and the mixture was stored at -80℃ for later use.

[0062] Genetic transformation

[0063] The above-mentioned genetic transformation was performed using Agrobacterium EHA105-mediated transformation (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282). OsCPS4 Gene overexpression vector was introduced into Nipponbare.

[0064] Using hygromycin primers Hyg-L and Hyg-R, 21 overexpressing transgenic plants and 22 RNAi knockout transgenic plants were obtained. Southern blot and progeny PCR identification yielded 3 homozygous transgenic lines at different insertion sites and 2 homozygous transgenic lines at different insertion sites.

[0065]

Example 4

[0066] Seedling Group Law

[0067] The materials to be identified ( OsCPS 4 overexpression plants ( OsCPS4 -OE), OsCPS4 Inhibit plant ( OsCPS4 -Ri), Japan Haruwa Bph6-NIL removed approximately 60 seeds, soaked and germinated them, and then sown them in 10 cm diameter plastic cups, about 20 seeds per cup, with three cups per material. When the seedlings reached the three-leaf stage, the poorly growing seedlings were removed. Each cup of material was then covered with a mesh bag, and 2nd-3rd instar brown planthopper nymphs were introduced into the bag at a rate of 8 brown planthoppers per seedling. When more than 90% of the susceptible control group died, the resistance level of each cup of material was recorded. Figure 2 ).

[0068] Measurement of honeydew amount and weight gain of brown planthoppers

[0069] The sealing film was made into appropriately sized bags, each wax bag was numbered and weighed using a balance, and the wax bags were tied to rice stems. Simultaneously, newly emerged female brown planthoppers were collected, numbered, and weighed, then placed into the corresponding numbered wax bags. Forty-eight hours after the brown planthoppers began feeding, both the brown planthoppers and the wax bags were weighed separately. The difference between the two weighings of the wax bags was recorded as the honeydew amount of the brown planthoppers, and the difference between the two weighings of the brown planthopper nymphs was recorded as the weight gain of the brown planthoppers. Each sample was subjected to 30 independent biological replicates. Figure 3 ).

Claims

1. The use of rice terpenoid phytoalexin synthesis gene OsCPS4 in breeding rice varieties resistant to the brown planthopper, characterized in that: The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the OsCPS4 gene is shown as SEQ ID NO.

2.

3. Use of the polynucleotide vector containing the OsCPS4 gene of claim 2 in breeding brown planthopper-resistant rice varieties.

4. Use of the host containing the vector of claim 3 in breeding brown planthopper-resistant rice varieties.

5. Use of the transgenic material containing the vector of claim 3 in breeding brown planthopper-resistant rice varieties.