Single plasmid one-step method genome efficient editing technology and application

Abstract

The invention relates to the field of genetic engineering technology and biological medicine, in particular to an efficient gene editing method and application of single-plasmid one-step phage and bacteria. The sequence of the constructed editing vector LPE274 is shown as SEQ ID NO.1, a simple, convenient, rapid, economical and efficient genome editing method is provided based on the vector, the vector has the functions of donor plasmids and targeting plasmids, use of antibiotic resistance genes is reduced, and accurate and efficient editing of target spots can be achieved without adding an inducer; multiple electroporation processes are avoided, the operation complexity is greatly reduced, and time and cost are saved.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering technology and biomedicine, and particularly relates to a single plasmid one-step high-efficiency genome editing technology and its applications. Background Art

[0002] Bacteriophages are viruses that parasitize prokaryotes such as bacteria and archaea, specifically infecting and killing bacteria. The emergence of the bacterial resistance crisis has reignited people's interest in using bacteriophages as antibacterial agents. However, using certain natural bacteriophages as antibacterial agents has potential limitations. If the bacteriophage is lysogenic, most of them will integrate into the host chromosome and enter a dormant state, unable to achieve the ideal antibacterial effect; or the bacterial host range of some natural bacteriophages is relatively narrow. Therefore, it is necessary to design engineered bacteriophages with enhanced therapeutic characteristics, safety functions, and host ranges. Traditional bacteriophage gene editing methods include random mutagenesis and homologous recombination, which are often inefficient, time-consuming, and laborious, greatly limiting the related research on bacteriophages. In recent years, researchers have applied the CRISPR-Cas system as a negative selection marker to bacteriophage genome editing technology, improving the editing efficiency of the bacteriophage genome.

[0003] CRISPR-Cas is an adaptive immune defense system formed by bacteria and archaea during long-term evolution to combat bacteriophage infection or foreign DNA invasion. The gene editing method based on the CRISPR-Cas system uses the Cas-crRNA complex to target specific sites in the genome to generate double-strand break incisions, and then exchanges fragments with a donor plasmid carrying homologous fragments through homologous recombination, thereby obtaining the recombinant bacteriophage that meets the expectations. Currently, the CRISPR-Cas system has been used for genome editing of various bacteria or bacteriophages. For example, Woudstra C et al. used the pCas / pTargetF dual plasmid system for genome editing of Salmonella bacteriophages; Chen Y et al. demonstrated that the dual plasmid system based on FnCas12a can be used for Salmonella bacteriophage gene editing. Compared with the traditional homologous recombination editing method, the dual plasmid bacteriophage editing method based on the CRISPR system significantly improves the editing efficiency of the bacteriophage genome. However, the dual plasmid system usually involves the use of multiple antibiotic resistance genes, the use of inducers, and multiple transformations of host bacteria, and the operation process is time-consuming and laborious, especially for host bacteria with low natural transformation efficiency.

[0004] In the applicant's previous work, the reported pCas / pTargetF dual plasmid system and Cas9 / pUC19 dual plasmid system were used for functional verification in Salmonella, and it was found that the transformation efficiency of Salmonella was very low, which restricted the process of genome editing and made the entire editing process time-consuming.

[0005] At present, there is a lack of convenient, economical and efficient methods for editing Salmonella phages, and there is little research on the genome editing of Salmonella phages. Summary of the Invention

[0006] The object of the present invention is to provide a high-efficiency gene editing method for phages or bacteria by a single plasmid one-step method, and the sequence of the editing vector LPE274 is shown as SEQ ID NO.1.

[0007] Another object of the present invention is to provide the application of the high-efficiency gene editing method for phages or bacteria by a single plasmid one-step method. To achieve the above object, the present invention takes the following technical measures:

[0008] A high-efficiency gene editing method for phages or bacteria by a single plasmid one-step method, the method comprising:

[0009] When the editing object is bacteria, based on the vector LPE274, an editing vector for the gene of the bacteria to be edited is constructed, and then transformed into the bacteria to screen positive transformants;

[0010] When the editing object is a phage, based on the vector LPE274, an editing vector for the gene of the phage to be edited is constructed, and then transformed into the phage host bacterium, and then infected with the phage to be edited, pick phage plaques, and screen positive recombinant phages;

[0011] The sequence of the vector LPE274 is shown as SEQ ID NO.1.

[0012] In the above method, preferably, the phage is a phage with Salmonella as the host;

[0013] In the above method, preferably, the bacterium is Salmonella.

[0014] The application of the above method in the high-efficiency gene editing of phages or bacteria.

[0015] In the above application, preferably, the phage has Salmonella as the host;

[0016] In the above application, preferably, the bacterium is Salmonella.

[0017] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0018] (1) The present invention constructs a novel single-plasmid one-step Salmonella phage genome editing system, which uses a single plasmid to simultaneously achieve the functions of a donor plasmid and a targeting plasmid. The conversion rate of this plasmid in Salmonella is extremely high, completely overcoming the problem of the low conversion rate of current Salmonella and the need for repeated operations, laying a good foundation for the subsequent gene editing of phages.

[0019] (2) The method of the present invention reduces the use of antibiotic resistance genes, expands the applicable range of low-titer bacteria, and can achieve efficient gene editing without the need for inducers and avoiding multiple host bacterium transformation processes, greatly reducing the time and cost of gene editing operations.

[0020] (3) The editing vector provided by the present invention has an editing efficiency higher than 99% for phages with Salmonella as the host.

[0021] (4) This application only uses a single plasmid to simultaneously express the CRISPR-Cas complex and provide a homologous recombination template. The single-plasmid editing system has a shorter construction period compared to the two-plasmid editing system, can save time, and makes the editing process faster and more convenient. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram for verifying the cleavage activities of SpCas9, LbCas12a, and MbCas12a against multiple phage genomes.

[0023] Figure 2 Flowchart of the single-plasmid one-step phage genome editing technology.

[0024] Figure 3 Schematic diagram for knocking out the orf41 gene of Salmonella phage.

[0025] Figure 4 Schematic diagram for knocking in the green fluorescent protein gene into the Salmonella phage genome.

[0026] Figure 5 Schematic diagram for detecting Salmonella pathogenic bacteria in lettuce by a phage with Salmonella as the host and replacing the luciferase gene.

[0027] Figure 6 Schematic diagram for knocking out the hypothetical protein gene of Salmonella. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0028] The following further illustrates the present invention in conjunction with embodiments, but the scope claimed by the present invention is not limited to the scope described in the embodiments. The technical solutions described in the present invention are all conventional technologies if not otherwise specified; the reagents or materials are all from commercial channels if not otherwise specifically stated.

[0029] In the applicant's previous experiments, when using the pCas / pTargetF dual plasmid system of Woudstra C et al. and the Cas9 / pUC19 dual plasmid system to transform Salmonella, almost no positive transformants were obtained. Therefore, the applicant also tried to use the single plasmid system constructed by the applicant to transform Salmonella, and the transformation efficiency increased relatively. However, the editing effect of the phage was insufficient and still could not meet the requirements of large-scale editing. Therefore, the applicant continued to further optimize the self-constructed single plasmid system.

[0030] Example 1:

[0031] Construction of editing vectors LPE274, LPE275, and LPE288 expressing different Cas proteins:

[0032] The p15A replicon, chloramphenicol resistance gene fragment, Ptrc promoter fragment, nucleic acid fragment corresponding to the LbCas12a protein, and crRNA sequence were ligated. Each reaction product was transformed into Escherichia coli DH5α, and then spread on LA plates containing chloramphenicol and cultured at 37°C until colonies appeared. Colonies were picked for identification of positive clones of transformants. An editing vector expressing the LbCas12a protein was obtained, and the sequence of the obtained editing vector LPE274 is shown in SEQ ID NO.1. According to actual needs, the homologous arm sequence and the target fragment can be cloned outside any functional element of this vector. The vector has modularized each functional element and can be replaced according to needs, improving convenience.

[0033] Meanwhile, the applicant replaced the DNA fragment of LbCas12a in the editing vector LPE274 with the DNA fragment of MbCas12a from Moraxella bovoculi or SpCas9 derived from Streptococcus pyogenes respectively, and obtained editing vectors LPE275 and LPE288.

[0034] Transformation efficiency of the editing vector LPE274 in Salmonella:

[0035] LPE274 was transferred into Salmonella (ATCC 13311) by a conventional method, the situation of positive transformants was investigated, and then the transformation efficiency was calculated.

[0036] The transformation efficiency of the obtained editing vector LPE274 in Salmonella was: 1.02*10^4 CFU / μg, while in the previous exploration process, the transformation efficiencies of the pCas / pTargetF dual plasmid system and the Cas9 / pUC19 dual plasmid system in Salmonella were 3.8*10^2 CFU / μg and 14 CFU / μg respectively.

[0037] Transformation efficiency = (number of colonies * dilution factor) / amount of plasmid DNA used (μg)

[0038] It can be seen that the single plasmid system provided by the present invention significantly improves the transformation efficiency in Salmonella.

[0039] Example 2:

[0040] Detect the cleavage activities of the editing vectors LPE274, LPE275, and LPE288 against the Salmonella phage genome:

[0041] (1) Select different phage genome targets: According to the PAM sequence of the CRISPR-Cas system, different sites of different Salmonella phages are selected as targets for comparing the cleavage activities of Cas proteins. Different phages and their corresponding spacer sequences are shown in Tables 1 and 2 below. The spacer sequences were synthesized by Sangon Biotech Co., Ltd. Different spacers were cloned into the editing vectors LPE274, LPE275, and LPE288 respectively to obtain targeting plasmids targeting different sites of the phage.

[0042] (2) Transform the above-obtained targeting plasmids into Salmonella ATCC 13311 (the host bacterium of phages LPST153 and LPST94) or Salmonella LST4 (the host bacterium of phage LPST83). Among them, the negative controls were to transform the vectors LPE274, LPE275, or LPE288 without spacer sequences respectively. The negative control strains do not have crRNA and will not target and cleave the phage genome. Similarly, if the expressed Cas protein-crRNA complex has no cleavage activity against the phage, the phage genome will not be cleaved ( Figure 1 in A, Figure 1 in B).

[0043] The phage counts obtained can be used to calculate the EOP efficiency. The smaller the EOP value, the higher the spacer cleavage efficiency and the higher the success rate of subsequent experiments. EOP is calculated by dividing the plaque-forming units (PFU) produced by the phage by the input PFU.

[0044] The results are as Figure 1 shown. Since SpCas9 has little cleavage effect on the tested LPST153 phage ( Figure 1 in C and Table 3), it was excluded first. MbCas12a also has weak cleavage activities against multiple phage targets tested ( Figure 1 in D and Figure 2 in E), while LbCas12a has strong cleavage activities ( Figure 1 in D and Figure 1Therefore, LPE274 expressing LbCas12a was selected as the subsequent phage genome editing vector.

[0045] Table 1 Different spacer targets of different Salmonella phages selected for editing vector LPE274 or LPE275

[0046]

[0047]

[0048] Table 2 Different spacer targets of different Salmonella phages selected for editing vector LPE288

[0049]

[0050] Table 3 SpCas9 has no significant cleavage activity against the tested Salmonella phage LPST94

[0051] Plasmid Phage Transformed host bacteria EOP EOP EOP LPE288 LPST94 Salmonella 1.12 0.99 1.15

[0052] Note: EOP is calculated by dividing the resulting plaque-forming units (PFU) by the input PFU.

[0053] Example 3:

[0054] One-step method for highly efficient phage gene editing with a single plasmid:

[0055] The method of the present invention can achieve functions such as gene knock-in, knock-out, and replacement in the phage genome;

[0056] When it is necessary to knock in a gene in the phage genome, amplify the upstream and downstream homologous arm DNA fragments of the phage gene locus to be edited, then ligate the target fragment to be knocked in with the upstream and downstream homologous arms and clone them onto the editing vector LPE274. Select a suitable spacer target and clone it into LPE274 to construct a Cas-crRNA sequence, and obtain an editing plasmid.

[0057] When it is necessary to knock out a gene in the phage genome, amplify and ligate the upstream and downstream homologous arms of the gene to be knocked out, and then clone them onto the editing vector LPE274. Select a suitable spacer target and clone it into LPE274 to construct a Cas-crRNA sequence, and obtain an editing plasmid.

[0058] When it is necessary to replace a gene in the phage genome, amplify the upstream and downstream homologous arms of the gene to be replaced in the phage genome and ligate them with the gene to be replaced, and then clone them onto the editing vector LPE274. Select a suitable spacer target and clone it into LPE274 to construct a Cas-crRNA sequence, and obtain an editing plasmid.

[0059] Subsequently, the constructed editing plasmid was transformed into the host bacterium. When the phage to be edited infects the host bacterium carrying the editing plasmid, homologous recombination occurs between the phage genome and the homologous sequence on the editing plasmid to obtain a recombinant phage, and the Cas protein-crRNA complex expressed by the plasmid targets and cleaves the genome of the wild-type phage, thereby achieving the purpose of enriching the recombinant phage( Figure 2 ).

[0060] Example 4:

[0061] Knockout of the orf41 gene of Salmonella phage LPST153 by a single plasmid one-step method:

[0062] (1) Synthesize the spacer sequence 153-4 of the orf41 gene of Salmonella phage, and construct the targeting plasmid LPE274-153-4 to verify the targeting cleavage activity of the plasmid against the spacer153-4 of Salmonella phage LPST153. The method is the same as in Example 2, and the results show that it has high cleavage activity( Figure 2 in A).

[0063] (2) Using the genome of Salmonella phage LPST153 (Islam et al 2020) as a template, amplify the upstream homologous arm T153-41-UP fragment using primers T153-41-U-F / T153-41-U-R, and amplify the downstream homologous arm T153-41-DOWN fragment using primers T153-41-D-F / T153-41-D-R. Connect the upstream and downstream homologous arms, and then synthesize the corresponding spacer sequence 153-4.

[0064] (3) Connect the above homologous arms to the linearized LPE274 vector, and insert the corresponding spacer sequence into the connected plasmid to construct an editing plasmid. Finally, use primers for PCR verification and send it to the company for sequencing. The linearized LPE274 vector is obtained by amplifying the LPE274 vector with pLb-F and pLb-R.

[0065] (4) Knockout of the orf41 gene of Salmonella phage: Transform the editing plasmid constructed in (3) into Salmonella ATCC 13311 to obtain the Salmonella to be edited. Then, infect the edited strain with Salmonella phage LPST153, pick the phage plaques, and obtain the recombinant phage after sequencing verification.

[0066] The results show that the single plasmid one-step phage editing technology can achieve gene knockout of Salmonella phage( Figure 3 in B and Figure 3 in C), and the gene editing efficiency is 100% (21 / 21).

[0067] Calculation of editing efficiency: The editing efficiency is calculated by dividing the number of successfully recombined plaques by the number of all picked plaques.

[0068] Table 4 Primers used for constructing LPE274-153-4-△orf41

[0069]

[0070]

[0071] Example 5:

[0072] Knocking in the GFP protein gene in Salmonella phage LPST153 by the single plasmid one-step method:

[0073] (1) Fragment amplification and fusion: Amplify the GFP gene, and use primer pairs to amplify the upstream and downstream homologous arm fragments with LPST153 as the template. The primers used are:

[0074] Upstream homologous arm: T153-U-F: tcctttgctcatGCTTCCTCCTCCagcctttttgaaaaccagcg

[0075] T153-U-R: attaattgtcaaGCGGCCGCatcgcaggtcttggtactgcaa

[0076] Downstream homologous arm: T153-D-F: tgccgatcagacactgtgtcgaacctgttgttgaactggcg

[0077] T153-D-R: tggatgagctctacaaataaaacactatatgaaaccccttgggt.

[0078] Then use the Overlap fusion PCR method to fuse the above three fragments ( Figure 4 in A).

[0079] (2) Vector linearization: Using the LPE274-153-1 plasmid (i.e., in Example 2, obtained by cloning spacer153-1 into the editing vector LPE274) as the template, use the specific primers pLb-F and pLb-R to amplify the LPE274 vector to obtain a linearized vector.

[0080] (4) Vector cloning: Splice the fusion fragment obtained in step (1) into the above linearized vector, and then transform it into Escherichia coli DH5α.

[0081] (5) Verification of transformants: Pick the transformants after overnight culture above for identification of positive clones of transformants. Select part of the bacterial solution of PCR-positive clones and send it to the company for sequencing, and the edited plasmid LPE274-153-1-GFP with GFP inserted into the LPST153 genome can be obtained.

[0082] (6) Transform the plasmid into Salmonella ATCC 13311, and refer to the method in Example 4 for phage editing experiment.

[0083] The results showed that the single-plasmid one-step phage / bacteria editing technology successfully knocked in the green fluorescent protein gene in the Salmonella phage genome, and the editing efficiency reached 100% (9 / 9) ( Figure 4 in B).

[0084] Example 6:

[0085] Application of phage knocked in luciferase gene in detecting pathogenic Salmonella in lettuce:

[0086] Preparation of lettuce samples: Remove the outermost two layers from the fresh lettuce bought from the vegetable market. Wash the remaining part with distilled water, and then disinfect the surface with 75% ethanol. Place the treated lettuce in a biosafety cabinet and sterilize it with ultraviolet light for 10 minutes on both sides. If it cannot be used in time, put the sample in a box with water to ensure relative humidity, and place it in a 4°C refrigerator, preferably not exceeding 24 hours.

[0087] Place the sample flat in the center of a sterile petri dish. Take 10 μL of ATCC13311 bacterial solution at 1×10 7 CFU / mL and drop it on the surface of the lettuce sample to obtain a Salmonella-contaminated lettuce sample. Place the sample in a biosafety cabinet and let it stand for 20 minutes to allow the ATCC13311 bacterial solution to fully adsorb to the surface of the sample.

[0088] After 20 minutes, pipette 10 μL of the engineered phage LPEK22::nLuc with a phage titer of 1×10 4 PFU / mL, drop it and completely cover the surface of the lettuce contaminated with the ATCC13311 bacterial solution. Then add 5 μL of luciferin substrate, place the sample at 37°C and let it stand for 12 hours, and then observe whether there is blue fluorescence in the dark box.

[0089] The preparation method of the engineered phage LPEK22::nLuc is as follows:

[0090] (1) Select spacers 22-1 and 22-2 of the phage LPEK22 (Zhang Y et al 2023) target. Clone the two spacers into the crRNA of vector LPE274 respectively to construct the targeting plasmids LPE289 (spacer22-1) and LPE291 (spacer22-2). Subsequently, transform the two targeting plasmids into strain LST3 (ATCC14028) respectively, and then infect the strains carrying the targeting plasmids with phage LPEK22 to verify the targeting cleavage activity of the two targets. The results show that both LPE289 and LPE291 have high cleavage activity against the phage and can be used as effective reverse screening targets( Figure 5 in A).

[0091] (2) Fragment amplification and fusion: Amplify the luciferase gene. Use primer pairs to amplify the upstream and downstream homologous arm fragments with LPEK22 as the template. The primers used are:

[0092] Upstream homologous arm: K22-U-F: tgccgatcagacactgtgtctgttttcaataaatgggtaatgaacc

[0093] K22-U-R: agccggatgattaattgtcaagatgtagttctctcttcaaagtgt

[0094] Downstream homologous arm: K22-D-F: gtgaacgtattctagcataagagattaatatatgagcaatttaccactg

[0095] K22-D-R: agccggatgattaattgtcaagatgtagttctctcttcaaagtgt

[0096] Then use the Overlap fusion RCR method to fuse the above three fragments( Figure 5 in B).

[0097] (3) Vector linearization: Use the specific primers pLb-F / R to amplify the LPE289 plasmid with the LPE289 plasmid as the template to obtain a linearized vector.

[0098] (4) Vector cloning: Connect the fusion fragment in step (2) with the linearized vector in (3), and then transform DH5α.

[0099] (5) Verification of transformants: Pick the transformants after the above overnight culture for positive clone identification. Select a part of the bacterial liquid of the PCR-positive clone for sequencing, and obtain the editing plasmid LPE327 with luciferase inserted into the LPEK22 genome.

[0100] (6) Transform the plasmid into the LST3 strain, and refer to the method of Example 4 for phage editing experiments.

[0101] The results showed that the hypothetical protein gene in the phage LPEK22 genome was successfully replaced with the luciferase gene ( Figure 5 in B), and the editing efficiency reached 100% (40 / 40) ( Figure 5 in C).

[0102] The results showed that the engineered phage LPEK22::nLuc could successfully detect Salmonella in production ( Figure 5 in D), further indicating that as long as the phage can use Salmonella as the host, the method of the present invention can be successfully used for editing and the expected results can be successfully achieved.

[0103] Example 7:

[0104] Transformation of the editing vector LPE274 and specificity of targeted editing

[0105] To verify the transformation and targeted editing specificity of the editing vector LPE274, the present invention tested the function of this vector in Staphylococcus aureus RN4220 and Mycobacterium tuberculosis. The Staphylococcus aureus RN4220 strain is derived from NCTC8325-4 and is a restriction endonuclease-deficient strain, which has been proven to be able to accept DNA plasmids from other species outside. The present invention used a conventional transformation method for testing and found that after the editing vector was transformed into Staphylococcus aureus RN4220 and Mycobacterium tuberculosis, no transformants could be obtained. It is speculated that this is because the vector replicon cannot replicate in the tested strains, which proves that the editing vector LPE274 of the present invention is specific for Enterobacteria such as Salmonella.

[0106] Example 8:

[0107] Application of the single-plasmid one-step method in Salmonella genome editing:

[0108] (1) Design spacers according to the genome of Salmonella typhimurium LST1 (ATCC13311), insert the spacer sequences into the LPE274 vector, and verify the cleavage activities of Cas proteins targeting different spacer sequences, all of which can effectively cleave. The selected spacer sites are shown in Table 5 below.

[0109] (2) Using the genome of Salmonella typhimurium ATCC13311 as a template, the upstream homologous arm 13311-1-UP fragment was amplified using primers 13311-1-U-F / 13311-1-U-R, and the downstream homologous arm 13311-1-DOWN fragment was amplified using primers 13311-1-D-F / 13311-1-D-R. The upstream and downstream homologous arms were ligated ( Figure 6 in A).

[0110] (3) The above homologous fragment was ligated with the LPE274 vector carrying 13311spacer-1 to construct the editing plasmid LPE274-13311-1-Δhp. PCR verification was performed and the plasmid was sent to the company for sequencing. The sequencing primers were 13311-YZ-1-F and 13311-YZ-1-R.

[0111] Finally, the editing plasmid was transformed into Salmonella ATCC1331 strain for gene editing, and the transformants were picked for sequencing verification. The results showed that the single-plasmid one-step phage and bacterial editing technology could achieve gene knockout of Salmonella ( Figure 6 in B).

[0112] Table 5 Primers used for constructing the LPE274-13311-1-Δhp plasmid

[0113]

[0114]

Claims

1. A single-plasmid one-step method for efficient gene editing of bacteriophage or bacteria, the method comprising: When the editing object is bacteria, the editing vector of the bacterial gene to be edited is constructed based on the vector LPE274, and then the bacteria are transformed and positive transformants are screened; When the editing object is a bacteriophage, the editing vector of the phage gene to be edited is constructed based on the vector LPE274, and then transformed into the phage host bacteria, and then infected with the phage to be edited, the plaques are picked, and the positive recombinant phages are screened; The sequence of the vector LPE274 is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that: The bacteriophage is a bacteriophage that takes Enterobacter as a host.

3. The method according to claim 1, characterized in that: The bacteria are Enterobacter.

4. The method according to claim 1, characterized in that: The bacteriophage is a bacteriophage that takes Salmonella as a host.

5. The method according to claim 1, characterized in that: The bacteria is Salmonella.

6. Application of the method of claim 1 in efficient gene editing of bacteriophages or bacteria.

7. The use according to claim 4, characterized in that: The bacteriophage is a bacteriophage that takes Enterobacter as a host.

8. The use according to claim 4, characterized in that: The bacteria are Enterobacter.

9. The use according to claim 4, characterized in that: The bacteriophage is a bacteriophage that takes Salmonella as a host.

10. The use according to claim 4, characterized in that: The bacteria is Salmonella.

Images