Application of the rice OsHsfA1 gene in regulating rice resistance to rice blast fungus
By knocking out or overexpressing the rice OsHsfA1 gene to regulate rice blast fungus resistance, the environmental pollution problem of pesticide control of rice blast has been solved, and a highly efficient disease-resistant breeding effect has been achieved.
Patent Information
- Application Number
- CN202510180739.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-19
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2045-02-19
AI Technical Summary
In existing technologies, pesticide control of rice blast presents environmental pollution problems, while disease-resistant breeding lacks effective new agents, making it difficult to effectively control rice blast.
By studying the relationship between the rice OsHsfA1 gene and the immune response to rice blast, knocking out or overexpressing the gene yielded high expression of the OsHsfA1 protein, which regulates the resistance to rice blast fungus. Knocking out or overexpressing the OsHsfA1 protein also regulated the silencing or overexpression of the OsHsfA1 gene in rice, thereby improving the resistance of rice to rice blast fungus.
Knocking out the OsHsfA1 gene reduces the rice blast fungus defense capability, while overexpressing the OsHsfA1 gene enhances the rice blast fungus resistance, thus achieving the goal of improving rice's defense capability against rice blast through gene regulation.
Smart Images

Figure CN120060330B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to the application of the rice OsHsfA1 gene in regulating rice resistance to rice blast fungus. Background Technology
[0002] Rice, as an important monocotyledonous food crop, is particularly susceptible to diseases, with rice blast being the "number one killer" among them. Caused by the rice blast fungus (Magnaporthe oryzae), rice blast can occur at different stages and parts of rice growth and development, including leaf blast, neck blast, and grain blast, causing enormous losses to rice production. It is estimated that the annual yield reduction due to rice blast is equivalent to 10% to 30% of the global total rice production—a staggering figure that highlights the immense harm rice blast poses to agricultural production.
[0003] Currently, the main methods for controlling rice blast include pesticide use and disease-resistant breeding. However, while pesticide use mitigates the impact of the disease to some extent, the resulting pesticide residues and negative environmental impacts cannot be ignored. This not only threatens human health but also poses a potential threat to the balance of the ecosystem. In contrast, disease-resistant breeding is considered a more economical and effective control method. By exploring new rice blast resistance genes and resistance resources, and breeding broad-spectrum resistant varieties, the resistance of rice to rice blast can be fundamentally improved. However, despite some progress in disease-resistant breeding, very little is known about new agents for effectively controlling rice blast.
[0004] This invention elucidates the regulatory mechanism of rice disease resistance at the molecular level, identifies new disease resistance-related genes, and applies them to inhibit the formation of appressoriums of rice blast fungus. The aim is to effectively apply these genes to the control of rice blast and develop highly effective pesticides for its prevention and control. Summary of the Invention
[0005] To address the problems existing in the prior art, the purpose of this invention is to design and provide a technical solution for the application of the rice OsHsfA1 gene in regulating rice resistance to rice blast fungus. This invention has found that the rice OsHsfA1 gene is related to the immune response of rice to rice blast fungus. Knocking out the OsHsfA1 gene reduces the rice's defense against rice blast fungus, while overexpressing the OsHsfA1 gene can improve the rice's resistance to rice blast fungus.
[0006] The technical solution of the present invention is as follows:
[0007] This invention provides the application of the rice OsHsfA1 gene in regulating rice resistance to rice blast fungus.
[0008] Preferably, the CDS nucleotide sequence of the rice OsHsfA1 gene is shown in SEQ ID No. 2.
[0009] This invention also provides the application of the rice disease resistance factor OsHsfA1 protein in regulating rice resistance to rice blast fungus.
[0010] Preferably, the amino acid sequence of the rice pathogenic factor OsHsfA1 protein is shown in SEQ ID No. 1.
[0011] The present invention also provides a method for regulating the resistance of rice to rice blast fungus. When it is necessary to reduce the resistance of rice to rice blast fungus, the OsHsfA1 gene in rice is silenced or knocked out; when it is necessary to increase the resistance of rice to rice blast fungus, the OsHsfA1 gene in rice is overexpressed.
[0012] This invention also provides the application of the rice OsHsfA1 gene in rice breeding, by screening rice plants that highly express the rice OsHsfA1 gene to obtain rice lines resistant to rice blast fungus.
[0013] This invention also provides the application of the rice disease resistance factor OsHsfA1 protein in rice breeding, and obtains rice lines resistant to rice blast fungus by screening rice plants with high expression levels of the rice disease resistance factor OsHsfA1 protein.
[0014] This invention also provides a method for constructing transgenic rice resistant to rice blast fungus, wherein the rice OsHsfA1 gene is transferred into rice plants to obtain transgenic rice with high expression of the rice OsHsfA1 gene.
[0015] Specifically, the CDS region nucleotide sequence of the rice OsHsfA1 gene is cloned into a vector, first transferred into Agrobacterium, and then transferred into rice cells through callus transformation to obtain transgenic rice that highly expresses the rice OsHsfA1 gene.
[0016] Preferably, the vector is the pCAMBIA1300ubi vector.
[0017] This invention has revealed that the rice gene OsHsfA1 plays a crucial role in rice resistance to rice blast. Deletion of the OsHsfA1 gene reduces the basic defense capacity of rice against rice blast fungus, while overexpression of the OsHsfA1 gene enhances the resistance of rice to rice blast fungus. Therefore, the rice OsHsfA1 gene can be used to improve rice resistance to rice blast fungus. Attached Figure Description
[0018] Figure 1 Figure 1 shows the results of rice blast resistance identification for the OsHsfA1 knockout mutant; where A: live inoculation figure; B: relative mycelial biomass of diseased leaves, **p<0.001.
[0019] Figure 2 Figure 1 shows the results of rice blast resistance identification of OsHsfA1 overexpression mutant; where A: live inoculation figure; B: relative mycelial biomass of diseased leaves, **p<0.01.
[0020] Figure 3 Figure 1 shows the results of expression of defense-related genes and reactive oxygen species (ROS) in rice by the OsHsfA1 homozygous knockout mutant. In the figure, AB: relative expression levels of defense-related genes KS4 and NAC4; C: ROS accumulation in wild-type and knockout OsHsfA1 mutant plants after chitin treatment, **p<0.01.
[0021] Figure 4 Figure 1 shows the results of ROS expression and reactive oxygen species (ROS) assay in rice defense-related genes by OsHsfA1 overexpression mutant. In the figure, AB represents the relative expression levels of rice defense-related genes KS4 and NAC4; C represents the ROS accumulation in wild-type and OsHsfA1OE overexpression mutant plants after chitin treatment, **p<0.01. Detailed Implementation
[0022] The following detailed description is provided with reference to the embodiments: This embodiment is implemented based on the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.
[0023] Example 1
[0024] Obtaining the OsHsfA1 gene knockout mutant in rice.
[0025] The amino acid sequence of the rice OsHsfA1 protein is shown in SEQ ID No. 1, and the gene sequence (CDS sequence) of the rice OsHsfA1 gene is shown in SEQ ID No. 2. We used CRISPR / Cas9 technology to perform targeted knockout of the target gene, thereby obtaining the OsHsfA1 gene knockout mutant.
[0026] The steps for constructing the knockout vector are as follows:
[0027] (1) First, based on the gene number of OsHsfA1, download its reference sequence in Nipponbare (https: / / rice.uga.edu / cgi-bin / sequence_display.cgi?orf=LOC_Os03g63750.1), determine the target site, and design the adapter primer OsHsfA1cas9-F / R. The primer sequences are as follows:
[0028] OsHsfA1cas9-F:ggcCAGAGGTCCCCAGCTAACTC;
[0029] OsHsfA1cas9-R:aaacGAGTTAGCTGGGACCTCTG;
[0030] (2) Target linker preparation: Dissolve the linker primers into a 100 μM stock solution, take 1 μL of each and add it to 98 μL ddH2O to mix and dilute to 1 μM. After treating the mixture at 90℃ for 30s, move it to room temperature and cool for 20min to complete the annealing.
[0031] (3) gRNA expression cassette ligation reaction: The enzyme-digested pYL gRNA-U3 vector was ligated with the corresponding target adapter. The PCR reaction system is as follows:
[0032]
[0033] The PCR reaction conditions are as follows:
[0034] 37℃, 5 min; 20℃, 5 min. 5 cycles in total.
[0035] (4) gRNA expression cassette amplification (two rounds of nested PCR amplification):
[0036] The product obtained from ligation in (3) was used for the first round of amplification. The PCR reaction system is as follows:
[0037]
[0038]
[0039] The UF / gDNA-R primer sequence for the first round of PCR amplification is:
[0040] UF: 5-CTCCGTTTTACCTGTGGAATCG-3;
[0041] gRNA-R: 5-CGGAGGAAAATTCCATCCAC-3.
[0042] The conditions for the first round of PCR amplification are shown in Table 1:
[0043] Table 1
[0044]
[0045] After amplification, 3 μL of the amplification product was taken for electrophoresis. The target band size was 564 bp. The product obtained from the first round of amplification was diluted 20-fold and used as a template for the second round of amplification.
[0046] The reaction system for the second round of PCR amplification is as follows:
[0047]
[0048] The primer sequences for the second round of PCR amplification are:
[0049] Uctcg-B1':5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3';
[0050] gRcggt-BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3'.
[0051] The conditions for the second round of PCR amplification are shown in Table 2:
[0052] Table 2
[0053]
[0054] After amplification, 3 μL of the amplification product was taken for electrophoresis to check the product length. The second-round amplification product was purified and its concentration was determined.
[0055] (5) Cutting and ligating simultaneously (two rounds of nested PCR amplification):
[0056] Take about 20 ng of the purified product from step (4), add about 20 ng of uncut pYLCRISPR / Cas9-MH plasmid, and digest with 10 U BsaI enzyme in a 15 μL reaction system at 37 °C for 10 min.
[0057] After enzyme digestion, 1.5 μL of 10×T4 ligase buffer and 35 U of T4 ligase were added to the system. The PCR reaction system is shown in Table 3.
[0058] Table 3
[0059]
[0060] The ligated plasmid was transformed into *E. coli* using the heat shock method, and positive clones were selected for detection. After successful sequencing, the plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd. for callus transformation. Using ZH11 as the background, rice OsHsfA1 gene knockout mutants OsHsfA1-3 and OsHsfA1-5 were obtained.
[0061] Example 2
[0062] Obtaining rice OsHsfA1 gene overexpression mutant.
[0063] Primers OsHsfA1OX-F / R were designed based on the CDS sequence of OsHsfA1. The primer sequences are as follows:
[0064] OsHsfA1OE-F:gtgttatacttctgcaggagctcATGGAGGCCGCCGTTGCT;
[0065] OsHsfA1OE-R: gcccttgctcaccatggatccTCCTGTATGTGTGTGATGACAGGA;
[0066] Using the ZH11 (Zhonghua 11) genome as a template, the CDS sequence of the OsHsfA1 gene was amplified using primers OsHsfA1OX-F / R. After purification, the amplified product was ligated into the pCAMBIA1300ubi vector (SacI / BamHI double digestion) using seamless cloning technology. The ligated plasmid was transformed into E. coli using a heat shock method, and positive clones were selected for detection. After successful sequencing, the plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd., transformed into Agrobacterium, and then introduced into rice callus tissue for transformation. Using the ZH11 line as a background, rice OsHsfA1 gene overexpression mutants OsHsfA1OE-1 and OsHsfA1OE-2 were obtained.
[0067] Example 3
[0068] The effect of OsHsfA1 on disease resistance in rice.
[0069] To verify the involvement of the OsHsfA1 gene in the defense response of rice against rice blast, we examined the changes in resistance to rice blast in OsHsfA1 knockout mutants and overexpression mutants. The specific procedures are as follows:
[0070] Wild-type rice blast fungus strain RB22 was activated on OA medium and cultured in the dark at 25°C for 3 days, followed by light culture for 4 days. Sterile ddH2O was added to the culture dish, and the mycelia were gently scraped off with an inoculation loop to elute the rice blast fungus spores from the medium. The eluent was filtered through a filter cloth to obtain a spore suspension. The spore suspension was placed in a 2 mL centrifuge tube and centrifuged at 12000 rpm for 2 min. The supernatant was discarded (avoiding the discarding of spores at the bottom). Sterile ddH2O was added to adjust the spore concentration to no less than 1 × 10⁻⁶. 6 1 / mL of 0.1% Gelatin (final Gelatin concentration 0.01%, v / v) was added to the spore solution for inoculation with rice blast fungus.
[0071] Spray inoculation: Water 3-4 leaf-aged rice seedlings (mutants and wild types) thoroughly (3-5 seedlings per pot), ensuring the water level exceeds the soil surface to guarantee good sealing. Insert a cylindrical transparent PVC film into the soil from the bottom, cover with plastic wrap, and completely seal the rice seedlings. Make a hole in the center of the plastic wrap, and apply 1 mL of spore suspension per pot to the seedlings, ensuring each leaf forms a fine mist of water droplets. Cover with another layer of plastic wrap and seal. After 24 hours of darkness at 22℃, restore normal light and humidity. Incubate under high humidity for 5-7 days, then assess disease incidence. Each experiment was repeated three times.
[0072] Mycelial biomass determination: Total DNA was extracted from rice lesions using the CTAB method. The amount of the Mopot2 gene (MGG_13294) of the rice blast fungus was detected using the rice gene OsUbiquitin (LOC_Os03g13170) as an internal control, and fungal biomass was analyzed by real-time quantitative PCR. Using 2... -ΔΔCT The relative expression level of the gene was calculated using this method. The primer sequences are:
[0073] qOsUBQ-F:AAGAAGCTGAAGCATCCAGC;
[0074] qOsUBQ-R: CCAGGACAAGATGATCTGCC;
[0075] Mopot2-F: ACGACCCGTCTTTACTTATTTGG;
[0076] Mopot2-R: AAGTAGCGTTGGTTTTGTTGGAT.
[0077] Vaccination results ( Figure 1-2 The results showed that, compared with the wild type, the knockout mutants OsHsfA1-3 and OsHsfA1-5 had significantly larger lesion areas and significantly weakened resistance to rice blast; while the overexpression mutants OsHsfA1OE-1 and OsHsfA1OE-2 had significantly smaller lesion areas and significantly enhanced resistance to rice blast, indicating that OsHsfA1 is essential for rice resistance to rice blast.
[0078] Example 4
[0079] The effects of OsHsfA1 on the expression of defense-related genes and reactive oxygen species bursts in rice blast fungus.
[0080] In Example 3, samples were collected 3 days after spray inoculation and stored at -80℃. Total RNA was extracted from the samples using Trizol reagent, and then 1 μg was used to synthesize cDNA via reverse transcription using M-MLV reverse transcriptase and Olig(dT). The rice gene OsUbiquitin (LOC_Os03g13170) was used as an internal control. Real-time quantitative PCR was performed on rice defense-related genes.
[0081] Reaction system:
[0082]
[0083] Reaction conditions:
[0084] Pre-denaturation at 95℃ for 30 seconds; denaturation at 95℃ for 20 seconds, extension at 60℃ for 30 seconds, 40 cycles. Use 2 -ΔΔCT The relative expression level of a gene can be calculated.
[0085] Primer sequences are shown in Table 4:
[0086] Table 4
[0087]
[0088]
[0089] Reactive oxygen species burst measurement:
[0090] Wild-type and mutant rice leaves were cut, and holes were punched on both sides of the main vein using a 0.5 cm punch. The obtained leaf discs were then placed in sterile ddH2O and incubated overnight in the dark. Three leaf discs from each sample were randomly selected and placed in 1.5 mL test tubes containing 100 μL luminol, 1 μL horseradish peroxidase, and 1 μL chitin. The tubes were then quickly placed in a Glomax 20 / 20 Luminometer instrument, and fluorescence was detected every 10 seconds for a total of 20 minutes. Each sample was tested three times.
[0091] Quantitative real-time PCR results showed that the expression levels of defense-related genes NAC4 and KS4 were significantly downregulated in the knockout mutant OsHsfA1. Figure 3 AB); The expression levels of defense-related genes OsPAL and OsNAC4 were significantly upregulated in the overexpression mutant. Figure 4 (AB). The above results suggest that OsHsfA1 may be involved in the rice blast resistance response.
[0092] The results of luminol chemiluminescence assay showed that, compared with the wild type, the chitin-induced ROS in the knockout mutant increased at a slower rate and accumulated at a significantly lower level than in the wild type. Figure 3C). In the overexpression mutant, the ROS growth rate is faster, and its accumulation is significantly higher than that of the wild type. Figure 4 C). The results showed that the deletion of the OsHsfA1 gene reduced the basic defense ability of rice against rice blast fungus, while the overexpression of the OsHsfA1 gene enhanced the basic defense ability of rice against rice blast fungus.
Claims
1. Rice OsHsfA1 The application of genes in regulating rice resistance to rice blast fungus, the rice OsHsfA1 The nucleotide sequence of the gene CDS is shown in SEQ ID No.
2. When it is necessary to improve the resistance of rice to rice blast fungus, the gene CDS in rice is used. OsHsfA1 Gene overexpression.
2. Application of rice disease resistance factor OsHsfA1 protein in regulating rice resistance to rice blast fungus. The amino acid sequence of the rice pathogenic factor OsHsfA1 protein is shown in SEQ ID No.
1. When it is necessary to improve rice resistance to rice blast fungus, the amino acid sequence of the rice pathogenic factor OsHsfA1 protein is used. OsHsfA1 Gene overexpression.
3. A method for regulating rice resistance to rice blast fungus, characterized in that, When it is necessary to improve the resistance of rice to rice blast fungus, the rice... OsHsfA1 Gene overexpression, the rice OsHsfA1 The nucleotide sequence of the gene CDS is shown in SEQ ID No.
2.
4. Rice OsHsfA1 The application of genes in rice breeding, through screening for rice varieties with high gene expression. OsHsfA1 Rice lines resistant to rice blast fungus were obtained from rice plants that produced the gene. OsHsfA1 The nucleotide sequence of the gene CDS is shown in SEQ ID No.
2.
5. Application of rice disease resistance factor OsHsfA1 protein in rice breeding: Rice lines resistant to rice blast fungus were obtained by screening rice plants with high expression levels of rice disease resistance factor OsHsfA1 protein. The amino acid sequence of the rice pathogenic factor OsHsfA1 protein is shown in SEQ ID No.
1.
6. A method for constructing transgenic rice resistant to rice blast fungus, characterized in that, Rice OsHsfA1 High expression of the gene was obtained by transferring it into rice plants. OsHsfA1 Transgenic rice of the gene, the rice OsHsfA1 The nucleotide sequence of the gene CDS is shown in SEQ ID No.
2.
7. The method for constructing transgenic rice resistant to rice blast fungus as described in claim 6, characterized in that, Rice OsHsfA1 The CDS region nucleotide sequence of the gene was cloned into a vector, first transformed into Agrobacterium, and then transformed into rice cells through callus transformation to obtain rice with high expression. OsHsfA1 Genetically modified rice.
8. The method for constructing transgenic rice resistant to rice blast fungus as described in claim 7, characterized in that, The vector is pCAMBIA1300ubi.
Citation Information
Patent Citations
Application of rice OsHPP08 gene in regulation and control of resistance of rice to magnaporthe oryzae
CN115109786A
Plant Responses
US20100138958A1