Application of methyltransferase genes CmCMT2 and CmDRM2 in regulating chrysanthemum flowering

By isolating the CmCMT2 and CmDRM2 genes from the chrysanthemum variety 'Shenma', constructing an RNAi silencing expression vector, obtaining transgenic plants, and conducting phenotypic observation and RNA-seq analysis, the role of the CmCMT2 and CmDRM2 genes in regulating the flowering time and flowering period of chrysanthemum was revealed. This solved the problem of unclear mechanism of influence of methylation level on gibberellin content and flowering time, and realized the regulation of chrysanthemum flowering time.

CN120060334BActive Publication Date: 2026-02-13HENAN UNIVERSITY

Patent Information

Application Number
CN202510225213.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-27
Publication Date
2026-02-13
Estimated Expiration
2045-02-27

AI Technical Summary

Technical Problem

In the prior art, the mechanism by which changes in methylation levels affect gibberellin content and flowering time is unclear, especially the mechanism by which non-CG methylation levels affect the flowering time of chrysanthemums.

Method used

By isolating the CmCMT2 and CmDRM2 genes from the chrysanthemum variety 'Shenma', constructing an RNAi silencing expression vector, and using genetic transformation methods to obtain CmCMT2-RNAi and CmDRM2-RNAi transgenic 'Shenma' plants, phenotypic observation and RNA-seq analysis were conducted to explore the influence of genes on chrysanthemum flowering.

Benefits of technology

The study found that decreased expression levels of the CmCMT2 and CmDRM2 genes led to early flowering in chrysanthemums, regulated the flowering period of chrysanthemums, affected gibberellin synthesis, and thus regulated the flowering time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present application belongs to the technical field of genetic engineering, and particularly relates to a methyltransferase gene CmCMT2 and CmDRM2 application in regulating chrysanthemum flowering. The present application constructs an RNAi silencing expression vector by isolating CmCMT2 and CmDRM2 genes in a chrysanthemum variety "Jinma", and obtains CmCMT2 -RNAi and CmDRM2 -RNAi transgenic "Jinma" plants by using a genetic transformation method, then performs phenotype observation and statistics on the transgenic plants, and explores CmCMT2 and CmDRM2 the mechanism of the genes affecting early flowering of chrysanthemum by using an RNA-seq method. The CmCMT2 and CmDRM2 genes are cloned from the chrysanthemum variety "Jinma", and spatiotemporal expression analysis shows that CmCMT2 and CmDRM2 the genes are highly expressed during the process of "Jinma" from bud development to color change; and CmCMT2 and CmDRM2 the expression level in leaves gradually decreases during the growth and development of "Jinma". The research results show that CmCMT2 and CmDRM2 the content of GA1 is changed by negatively regulating the expression of CmG20ox2a and CmG20ox2b , so that the flowering period of chrysanthemum is advanced by 15 and 8 days, respectively.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of methyltransferase genes CmCMT2 and CmDRM2 in regulation of chrysanthemum flowering. BACKGROUND

[0002] DNA methylation is essential for regulating gene transcription, transposon silencing and genomic imprinting in eukaryotic genomes. Moreover, it plays an important role in regulating the growth and development process of plants. In addition to CG methylation, plant DNA also contains CHG and CHH type methylation. It is generally believed that CHH methylation can only be maintained by DRM2 through the RdDM pathway. However, in Arabidopsis, DRM2-mediated CHH methylation only accounts for about 35% of the total CHH methylation. CMT2 can maintain about 70% of the CHH methylation level, which is independent of RdDM. In addition, the RdDM pathway mediated by DRM2 mainly performs CHH methylation in more homochromatin regions, including short transposons (TEs) in the chromosome arm and the edge of long TEs in the pericentromere region, while in more heterochromatin sites (such as long TEs), CHH methylation is mediated by CMT2. Studies have shown that DRM2 is strongly expressed in petals, anthers and stigmas in Arabidopsis; in kiwifruit, CMT2 is significantly expressed in flowers, and DRM2 is more significantly expressed in stems and flowers than in the early development stage; during the development of Xanthoceras sorbifolia Bunge flowers, the expression level of XsCMT2 decreases. In summary, the different expression patterns of CMT2 and DRM2 genes in flowers indicate that they may have important regulatory roles in flower development and flowering.

[0003] Gibberellins (GA) is an important hormone related to cell growth and differentiation, and has been shown to promote flowering in many plants, including Arabidopsis. GA includes a large class of compounds and intermediates, and more than 130 GAs have been found. Among them, only GA1, GA3, GA4 and GA7 are considered to have biological activity, and GA1 and GA4 are the main active GAs for promoting plant growth and development. In Arabidopsis, under LD conditions, GA acts together with CO to induce flowering by promoting the expression of FT and TSF in leaves; under SD conditions, GA is needed to promote the expression of the LFY promoter, therefore, LFY and SOC1 cannot be expressed in the ga1-3 mutant lacking GA, resulting in failure to flower under SD conditions. Although a lot of research has been done on the process of GA affecting the flowering pathway, the mechanism of the effect of the change in methylation level, especially the change in the level of non-CG type methylation, on the content of GA and flowering time is still unclear. SUMMARY

[0004] The purpose of the present application is to clone CmCMT2 and CmDRM2 genes from Chrysanthemum variety "Jinma" by bioinformatics method, and identify them by fluorescence quantitative PCR, subcellular localization, transgenic verification, RNA-seq and other analysis methods.

[0005] To achieve the above-mentioned purpose, the present application first clones CmCMT2 and CmDRM2 genes from Chrysanthemum variety "Jinma" by bioinformatics method, and identifies them by fluorescence quantitative PCR, subcellular localization, transgenic verification, RNA-seq and other analysis methods.

[0006] Further, the present application provides the application of Chrysanthemum methyltransferase genes CmCMT2 and / or CmDRM2 in regulating the growth and development, flowering time or flowering period of plants in the chrysanthemum family (for example, Chrysanthemum).

[0007] Specifically, the present application is based on Chrysanthemum methyltransferase genes CmCMT2 and CmDRM2, and by constructing an RNAi gene silencing expression vector, transforming Agrobacterium competent cells, and transforming Chrysanthemum leaves by Agrobacterium-mediated method, the influence of CmCMT2 and / or CmDRM2 on the growth and development, flowering time or flowering period of Chrysanthemum is studied.

[0008] Specifically, the decrease of the expression level of Chrysanthemum methyltransferase genes CmCMT2 and CmDRM2 will lead to different degrees of early flowering phenomenon, that is, the advance of flowering period.

[0009] Further, the present application also provides the application of methyltransferase genes CmCMT2 and / or CmDRM2 in regulating the development of Chrysanthemum flower buds, regulating flower color or improving flowering period.

[0010] Further, the present application also provides the application of Chrysanthemum methyltransferase genes CmCMT2 and / or CmDRM2 in regulating the gibberellin synthesis during the flowering period.

[0011] Further, the present application also provides the application of RNAi gene silencing expression vector in regulating the growth and development, flowering time or flowering period of plants in the chrysanthemum family (for example, Chrysanthemum).

[0012] Specifically, in application, the specific sequences of CmCMT2 gene and CmDRM2 gene are connected into a composite vector constructed by plasmids pART27 and pKANNIBAL to obtain an RNAi gene silencing expression vector, the constructed RNAi gene silencing expression vector is transformed into Agrobacterium competent cells, and then the leaves of chrysanthemum (for example, chrysanthemum) are transformed by Agrobacterium-mediated method.

[0013] Further, the application also provides an RNAi gene silencing expression vector constructed by CmCMT2 gene and CmDRM2 gene and plasmids pART27 and pKANNIBAL.

[0014] Specifically, the RNAi gene silencing expression vector is constructed by the following method:

[0015] 1) The plasmids pART27 and pKANNIBAL are cut by Not I enzyme, and then the part of plasmid pKANNIBAL containing intron is connected into plasmid pART27 by T4 DNA ligase to construct a composite expression vector.

[0016] 2) According to the conserved sequences of CmCMT2 gene and CmDRM2 gene, the RNAi fragment of 200-500 bp is designed, the primer is designed by Premier 5.0 software, and then the composite vector in step 1) is connected, and the RNAi gene silencing expression vector is obtained.

[0017] Specifically, the RNAi fragment sequence of CmCMT2 gene is shown as SEQ ID NO. 1, and the RNAi fragment sequence of CmDRM2 gene is shown as SEQ ID NO. 2.

[0018] Specifically, in the construction process of the RNAi gene silencing expression vector, the part of primer sequences used are as follows:

[0019] CMT2-F-Xho I: TTGGAGAGGACACGCTCGAG.CTTACCTCGTCCGGGTGATGTTGAT.

[0020] CMT2-R-Kpn I: ATTTCCTTACCAAGCTGGGGTACC.ATTGAGGAAGACCATAACAGCCAGC.

[0021] CMT2-F-Xba I: TCATTAAAGCAGGACTCTAGA.CTTACCTCGTCCGGGTGATGTTGAT.

[0022] Anti-CMT2-R-HindIII:GGTTCGAAATCGATAAGCTT. ATTGAGGAAGACCATAACAGCCAGC.

[0023] Positive DRM2-F-XhoⅠ: TTGGAGAGGACACGCTCGAG; TATGACGAGAGTCTTCTTGATGG.

[0024] Positive DRM2-R-KpnⅠ:ATTTCCTTACCAAGCTGGGGTACC. GTCCCTTCTGCTTCTTTCTTTTC.

[0025] Anti-DRM2-F-XbaⅠ: TCATTAAAGCAGGACTCTAGA; TATGACGAGAGTCTTCTTGATGG.

[0026] Anti-DRM2-R-HindⅢ: GGTTCGAAATCGATAAGCTT; GTCCCTTCTGCTTCTTTCTTTTC.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] This invention isolates the CmCMT2 and CmDRM2 genes from the chrysanthemum variety "Shenma," constructs RNAi silencing expression vectors, and obtains CmCMT2-RNAi and CmDRM2-RNAi transgenic "Shenma" plants using genetic transformation. Phenotypic observation and statistical analysis of the transgenic plants are then conducted, and key genes influencing chrysanthemum flowering are identified using RNA-seq methods to explore the mechanism by which CmCMT2 and CmDRM2 genes affect early flowering in chrysanthemums. The CmCMT2 and CmDRM2 genes, cloned from "Shenma," were highly expressed during the development of flower buds and color change in "Shenma." Furthermore, the expression levels of CmCMT2 and CmDRM2 in leaves gradually decrease during the growth and development of "Shenma." These results indicate that CmCMT2 and CmDRM2 regulate the flowering period of chrysanthemums by negatively regulating the expression of CmG20ox2a and CmG20ox2b, thereby altering the GA1 content. Attached Figure Description

[0029] Figure 1 This describes the principle of RNAi vector construction in this invention;

[0030] Figure 2 Phylogenetic analysis for CmCMT2 and CmDRM2; where A is CmCMT2 and B is CmDRM2;

[0031] Figure 3 RNAi fragment models and subcellular localization of CmCMT2 and CmDRM2; wherein, (A) the location model of RNAi fragment in the gene silencing expression vector of CmCMT2 and CmDRM2; (B) the subcellular localization of CmCMT2 and CmDRM2 proteins;

[0032] Figure 4 Temporal and spatial expression analysis of CmCMT2 (A) and CmDRM2 (B) genes; wherein, EFa as the internal reference, 2 -ΔΔCt determined by qRT-PCR; the numerical values represent the average values ± SE of three repeated measurements, (P<0.05); SS: seedling stage; VS: vegetative growth stage; RS: reproductive growth stage; Root: root; Stem: stem; Leaf: leaf; FBD, flower bud development stage; VC, color change stage; EO, early opening stage; OF, open flower stage;

[0033] Figure 5 Phenotypic identification of CmCMT2-RNAi and CmDRM2-RNAi transgenic chrysanthemums; wherein, (A) expression analysis of CmCMT2 and CmDRM2 in WT, CmCMT2-RNAi and CmDRM2-RNAi; (B) the development process of flower buds of wild type and transgenic plants; FBD, flower bud development stage; VC, color change stage; EO, early opening stage; OF, open flower stage; SF, senescent flower stage; Target value: 1 cm; Phenotype photos of 90 days (C) and 110 days (D); Target value: 2 cm;

[0034] Figure 6 RNA-seq principal component analysis (A) and sample correlation heat map (B) of CmCMT2 and CmDRM2 transgenic chrysanthemums.

[0035] Figure 7 RNA-seq analysis of CmCMT2 and CmDRM2 transgenic chrysanthemums; wherein, (A) the number statistics of differentially expressed genes (DEGs) of CmCMT2 and CmDRM2 transgenic chrysanthemums; WT vs RNAi-4 (B) and WT vs RNAi-3 (C) KEGG enrichment analysis of differentially expressed genes;

[0036] Figure 8 Expression analysis of flowering and GA content regulation pathway genes in WT vs RNAi-4 (A) and WT vs RNAi-3 (B);

[0037] Figure 9 Analysis of gibberellin content in CmCMT2 and CmDRM2 transgenic chrysanthemums. DETAILED DESCRIPTION

[0038] The application will be further described in conjunction with the following examples. The embodiments of the present application are not limited to the following examples. Unless otherwise specified, the reagents, methods, and apparatuses used in the present application are conventional reagents, methods, and apparatuses in the art. Unless otherwise defined, all the professional and scientific terms used herein have the same meaning as understood by those skilled in the art. In addition, any method and material similar or equivalent to those described can be used in the present application.

[0039] Example 1

[0040] 1.1 Experimental materials

[0041] 1.1.1 Plant materials

[0042] The material used in the present study is the chrysanthemum variety 'Jinma'. The tissue culture seedlings of the chrysanthemum variety 'Jinma' were cultured in an incubator. The roots (R), stems (S), and leaves (L) of the seedling stage (SS), vegetative growth stage (VS), and reproductive growth stage (RS), and the flower buds and flowers of the flower bud development stage (FBD), color change stage (VC), early flowering stage (EO), and flowering stage (OF) of the reproductive growth stage were sampled, with each sample containing at least three biological replicates. After quick freezing in liquid nitrogen, the samples were stored in a -80°C refrigerator for subsequent extraction of RNA for temporal and spatial expression analysis experiments.

[0043] The transgenic material used in the present study is the chrysanthemum variety 'Jinma' tissue culture seedlings preserved in the laboratory.

[0044] The material used for transcriptome sequencing in the present study is the transgenic and wild type (WT) of the chrysanthemum variety 'Jinma'. The WT, CmCMT2-RNAi, and CmDRM2-RNAi materials were cultured until the stage of approaching the appearance of flower buds (the period when the earliest flower buds were observed in all materials). The 3-5 leaves from the top down (fully expanded leaves) were sampled, quick-frozen in liquid nitrogen, and stored in a -80°C refrigerator for RNA extraction for transcriptome sequencing.

[0045] 1.1.2 Main reagents

[0046] Spectinomycin hydrochloride (22189-32-8, Spectinomycin), Kanamycin sulfate (25389-94-0, Kanamycin Sulfate), Rifampicin (13292-46-1, Rifampicin), MS medium (M519), Agar powder (9002-18-0), Sucrose (57-50-1) were purchased from Shanghai Macclin Biochemical Technology Co., Ltd. (Macclin); Plant DNA MiniSyetem (ND-26, Plant DNA MiniSyetem) was purchased from Beijing Nulease Biotech Co., Ltd.; KK Fast Plant Total RNA Kit (ZP405K, KK Fast Plant Total RNA Kit), V-ELUTE Gel Mini Purification Kit (ZPV202, V-ELUTE Gel Mini Purification Kit), Miniquick Purification Kit (ZP201, Miniquick Purification Kit), Plasmid Miniprep Kit (ZP101, Plasmid Miniprep Kit), DNA Marker (ZM404; DL2000 DNA Marker), ExRed and SE Seamless Cloning and Assembly Kit (ZC231, SE Seamless Cloning and Assembly Kit) were purchased from Beijing Zhuangmeng International Biological Gene Technology Co., Ltd. (Zhuangmeng); Restriction endonuclease Kpnl (R3142V), Xhol (R0146V) and specific endonuclease McrBC (M0272) were purchased from New England Biolabs (Beijing) Limited Liability Company (NEB); DNA Bisulfite Conversion Kit (DP215-02, DNA Bisulfite Conversion Kit) and 2xTaq PCR Mix (KT201, 2xTaq PCR Mix) were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; PrimeSTAR® Max DNA Polymerase (R045A, PrimeSTAR® Max DNA Polymerase) and PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A, PrimeScript™ RT reagent Kit with gDNA Eraser) were purchased from Takara Bio Company (Beijing) Limited Liability Company (Takara); ChamQ Universal SYBRqPCR Master Mix (Q711-02, ChamQ Universal SYBRqPCR Master Mix) was purchased from Nanjing Novozyme Bio-tech Co., Ltd.; Yeast extract, sorbitol, spermidine, CaCl2, tryptone, NaCl, NaOH and Silwet-L77 were purchased from Beijing Solabio Technology Co., Ltd.Methanol and formic acid (HPLC eluent) were purchased from Komiyu Chemical Reagent Co., Ltd. 1 mL syringe, 0.22 μm filter membrane (organic phase), inner cannula, sample injection vial and inner cannula were purchased from Solabio Limited Company.

[0047] 1.1.3 Vectors and strains

[0048] DH5α competent cells (ZC101, DH5α Chemically Competent Cell) and GV3101 competent cells (ZC141, GV3101 Chemically Competent Cell) were purchased from Beijing Zhuangmeng International Biological Gene Technology Co., Ltd. (Zhuangmeng); Overexpression vectors pSAK277, pSAK277-GFP (carrying CaMV35S enhancer promoter) and RNAi silencing expression pART27 vector (commercial product) and pKANNIBAL vector (commercial product) were stored in the laboratory.

[0049] 1.2 Experimental methods

[0050] 1.2.1 Identification of CmCMT2 and CmDRM2 genes in Chrysanthemum ‘Shenma’ and construction of phylogenetic tree

[0051] According to the published transcriptome data of Chrysanthemum variety ‘Shenma’ (Zhao W, Ding L, Liu J, et al. Regulation of lignin biosynthesis by an atypical bHLH protein CmHLB in Chrysanthemum [J]. Journal of Experimental Botany, 2022, 73(8):2403-19), a local Blast database of ‘Shenma’ was constructed. Since CMT2 and DRM2 in Chrysanthemum wild species Chrysanthemum morifolium, Chrysanthemum coronarium, Chrysanthemum morifolium Gojo-0 and Chrysanthemum cultivar ‘Zhongshan Ziguigui’ have been identified in the laboratory, CMT2 and DRM2 in these Chrysanthemum wild species and cultivars, as well as Arabidopsis thaliana, Solanum lycopersicum, Oryza sativa, Zea mays and Populus were searched in the local Blast database of Chrysanthemum variety ‘Shenma’ to obtain CMT2 and DRM2 in Chrysanthemum variety ‘Shenma’, and a phylogenetic tree was constructed.

[0052] The alignment is performed by using Alignment, Align by ClustaIW (default parameters) in MAGA 7.0 software (Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets [J]. Molecular biology and evolution, 2016, 33(7): 1870-1874). After the alignment is completed, the.meg format file is saved by selecting Data-Export Alignment, and then the.meg format file is used to construct a phylogenetic tree by using MAGA 7.0 software, with the parameters set as: Neighbor-joining, p-distance, complete deletion, bootstrap (replicates = 1000), and the parameters selected as default values.

[0053] The nucleotide sequence of the CmCMT2 gene (as shown in SEQ ID NO. 3):

[0054]

[0055] The nucleotide sequence of the CmDRM2 gene (as shown in SEQ ID NO. 4):

[0056]

[0057] Amino acid sequence encoded by the CmCMT2 gene:

[0058] MVADNGEAPTSQPPPLPPLPPPSSPSQPTPTQPTPQLHSIRRRSPRLVECGNSVEVPAKKKAKVTTSLVGVEFNDGGERVSFLIGDPVNDEEARRRWPWRYDIEELKRKGRYPTTKINSEDDDDELILNVKCHYLQAKILKHVFDLGDCAIVKGEEEGHDHVGRILEFFKTNTNEEYFRVQWFFRAEDTVIKDAATSNDKKRVFYSTLMNDNPLDCIVSKVKVLKVAPGINLKSIPKCDFYYDMEYNINYSTFSTIKDDVSSNNCCLSSSDKKEEIHSNGSIGKEEIHSNGSIGKEEIHSNGSIGKEDIHSNGSIGKEEIHSNGSIGKEEIHSNGSIGTSINGTLTRCKSHKSELTLLDIYSGCGGMSTGLCFGAKLSGVDLSTKWAVDANKCACESLRLNHPETQIRNEYAEDFLDLIKEWDKLCKKYKVKEEKTDGHDPMLSGSQDDVTPSKADNIVAKDEYEVEKLVDICYSDLDGTNKRELKFKVRWAGYGPSDDTWESIQGLRKCQDKIREFVHKGVKAKILPRPGDVDIICGGPPCQGISGHNRHRNFESPLEDERNYQIVVFMEIISFLKPRYVLMENVGDILRYANGSLARYAISCLVREYYQVRLGIMAAGCYGLPQFRLRVFLWGAHHDEHLPPFPLPTHDVVFKYGSPTGFERNVVAYDKGKLQNIEKCVLLKDAISDLPPVSNSESRDEMNYTNAPETEFQKFIRATKSDMLGNASLSSCDKKKPLLYDHRPFSLNEDDCLRVSRVPKRKGASFRDLPGIVFGDDNVVTRAPEPELMPSGKHWVPNYAINFNDGKNMKSFARVWWDETVSTVLCAPNYRTEAIIHPEQDRVLTIRECARLQGFPDFYALSGTVKERYRQVGNAVAVPVGRALGYTLGMALQKLSGDEPLVTLPPKFAHSTTIDLLQPSLAIEP

[0059] Amino acid sequence encoded by CmDRM2 gene:

[0060] MDVHASVEENNAIDWDTEDELEIENIAMTSNAASTSAGPSNVSLIQHFIGMGFPENFVTKAIKKNGESDSDRLLETILAYMDGHVSDEENVDIDSDTKDDLEIQNIASTSCSTPVTSNNGEASSSGGPSNSNSVQHFIDMGFPAELVTRAIKENEENDTEKILESLLTYSQMAPEELDTCHASSSQQQCVTYDELSSDYDESLLDGFSEDDSLSESEITDNKSLPENEQMLLSLASMGYTVEEASAAVARCGPDASIAELTDFISAAQMAKTEAAFFEEEKPKVFLNPKLKRKMYQEALKRKKQKGPLTEEEEVIRIPKPMIGFGVPSESSIVTHRTLPDAAIGRPFFYYENVALAPKGVWDTISRFLFDVAPEFVDSKHFCAAARKRGYVHNLPIDNRFPLLPLQPRTIHGALPLTRRWWPAWDKRTNLNCLQTAYGSAKLTDRLRKALEKWGDEPPDHVKRYVLDECRRWNLVWVGKNKLATLEPDEVEMLLGFPRNHTRGGGISRTDRYKSLGNSFQVDTVAYHLSVLKKIFPNGINVLSLFSGIGGAEVALHRLGVPLKTVVSVELSEANRDIVRSWWEQTNQKGNLVHLDDVQKLHGDKLEELIKLYGRFDLVVGGSPCNNLAGGNRVSRDGLEGEQSSLFYDYFRILDTVKAIMK

[0061] 1.2.2 Construction of RNAi vectors

[0062] The primers for vector construction are shown in Table 1, and the specific construction methods are as follows:

[0063] First, pART27 and pKANNIBAL vectors were digested by Not I enzyme, and then the intron-containing part of the pKANNIBAL vector was connected into pART27 by T4 DNA ligase to construct a composite vector. Then, according to the conserved sequences of CmCMT2 and CmDRM2 genes, 200-500 bp RNAi fragments were designed, and the primers (Table 1) were designed by Premier 5.0 software, and then connected with the composite vector. The schematic diagram and principle of the construction of the RNAi vector are as follows Figure 1 The sequence of the RNAi fragment of the CmCMT2 gene is shown as SEQ ID NO. 1, and the sequence of the RNAi fragment of the CmDRM2 gene is shown as SEQ ID NO. 2.

[0064] Table 1. Primer list.

[0065]

[0066] 1.2.3 Expression analysis of the spatiotemporal expression of CmCMT2 and CmDRM2 genes in chrysanthemum ‘Shenma’

[0067] The total RNA of the preserved material (roots (R), stems (S), and leaves (L) of seedling stage (SS), vegetative growth stage (VS), and reproductive growth stage (RS), and flower buds and flowers of the reproductive growth stage (FBD), vermillion color stage (VC), early flowering stage (EO), and flowering stage (OF)) in step 1.1 was extracted by using the KK ultrafast plant total RNA extraction kit (Invitrogen). The total RNA of each extraction sample was detected by 1% agarose gel electrophoresis, and the RNA sample was detected by NanoDrop2000 microspectrophotometer (Thermo Fisher). The RNA sample with A260 / A280 value between 1.8-2.2 was reverse transcribed, and the reverse-transcribed cDNA was diluted to 200 ng / µL for subsequent experiments. The quantitative primer was designed by using Premier 5.0 software, and the primer (Table 1) was synthesized by Shanghai Sangon Biological Engineering Co., Ltd. The fluorescent quantitative PCR reaction was performed by using fluorescent quantitative Mix (SYBR qPCR Master Mix) on LightCycler® 480 II real-time fluorescent quantitative PCR instrument (Roche) (the reaction system is shown in Table 2), and CmEFα gene was used as an internal reference. Each sample was naturally repeated for 3 times.

[0068] According to the calculation method of relative expression amount in the literature (Livak K J, Schmittgen T D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method [J]. Methods, 2001, 25(4): 402-408), the Cp value obtained by qRT-PCR data was calculated by Excel software 2 -△△CT The relative expression amount was calculated, and the calculated value was calculated for significant difference (Duncan test method, P<0.05) by SPSS19.0 software.

[0069] Table 2 Fluorescence quantitative PCR reaction system

[0070]

[0071] 1.2.4 CmCMT2 and CmDRM2 gene silencing expression vector transformation of chrysanthemum 'Godman'

[0072] The constructed RNAi vector was transformed into Agrobacterium competent cells, and then transformed into the leaves of 'Godman' by Agrobacterium-mediated method. The specific steps are as follows:

[0073] (1) Wild type 'Godman' tissue culture seedlings were expanded on MS solid medium (top bud was taken). After 35-45 d of culture, the third and fourth leaves of the tissue culture seedlings were taken, and the leaves were cut into 0.3 × 0.3 cm 2 squares with the front of the leaves facing up on the pre-culture medium (MS 4.43 g / L + sucrose 30 g / L + agar 7 g / L + 6-BA 1.0 mg / L + NAA 0.5 mg / L, pH 5.8) for 3 d.

[0074] (2) On the second day of leaf disc culture, the stored glycerol Agrobacterium was taken out from the-80℃ refrigerator, and was naturally thawed. 500-1000 μL was added to 40-50 mL YEB liquid medium containing rifampicin (Rif) and spectinomycin (Spec) resistance (100 mL conical flask), and was cultured overnight at 28℃ on a shaker.

[0075] (3) The next day, the bacterial solution was activated to OD 600When the value is about 0.5, centrifugal collection of the bacterial body is performed in a centrifuge (room temperature, 5000 rpm, 10 min), the supernatant is discarded in an ultra-clean bench, and the bacterial body is resuspended with a reselection liquid (MS 4.43 / L + sucrose 30 g / L, pH 5.8) to make the final OD of the bacterial body about 0.5 (generally, the ratio of the reselection liquid to the bacterial body is 1:1). 600 When the value is about 0.5, centrifugal collection of the bacterial body is performed in a centrifuge (room temperature, 5000 rpm, 10 min), the supernatant is discarded in an ultra-clean bench, and the bacterial body is resuspended with a reselection liquid (MS 4.43 / L + sucrose 30 g / L, pH 5.8) to make the final OD of the bacterial body about 0.5 (generally, the ratio of the reselection liquid to the bacterial body is 1:1).

[0076] (4) The leaf disc at the end of the pre-culture is immersed in the prepared reselection bacterial liquid, and slowly shaken for 10 min, then the leaf disc is dried with filter paper, and finally placed in a co-culture medium (same as the pre-culture medium) for dark culture for 3 d.

[0077] (5) The leaf disc at the end of the co-culture is transferred to a decarboxylation culture medium (MS 4.43 g / L + sucrose 30 g / L + agar 7 g / L + 6-BA 1.0 mg / L + NAA 0.5 mg / L + Carb 500 mg / L) for culture under light for 5-7 d.

[0078] (6) After the decarboxylation treatment, four selection stages, selection I, selection II, selection III, and selection IV, are performed, and the medium is replaced every two weeks until reaching selection IV, and the glass bottle is replaced at selection IV to increase the culture space. If no seedling is grown at selection IV, the selection IV medium is continuously replaced every two weeks until the seedling is grown.

[0079] Selection I: MS 4.43 g / L + sucrose 30 g / L + agar 7 g / L + 6-BA 1.0 mg / L + NAA 0.5 mg / L + Carb 350 mg / L + Kan 10 mg / L;

[0080] Selection II: MS 4.43 g / L + sucrose 30 g / L + agar 7 g / L + 6-BA 1.0 mg / L + NAA 0.5 mg / L + Carb 300 mg / L + Kan 9 mg / L;

[0081] Selection III: MS 4.43 g / L + sucrose 30 g / L + agar 7 g / L + 6-BA 1.0 mg / L + NAA 0.5 mg / L + Carb 250 mg / L + Kan 8 mg / L;

[0082] Selection IV: MS 4.43 g / L + sucrose 30 g / L + agar 7 g / L + 6-BA 1.0 mg / L + NAA 0.5 mg / L + Carb 200 mg / L + Kan 7 mg / L.

[0083] (7) After the resistant buds are differentiated, when they grow to 2-3 cm, the resistant buds are transferred to rooting screening medium (Kanamycin resistance: MS 4.43 g / L + sucrose 30 g / L + agar 7 g / L + Carb 200 mg / L + Kan 7 mg / L.) for screening, and the seedlings that can normally root in the rooting screening medium are reserved, and then their leaves are taken for PCR verification. The verification primer is shown in Table 1.

[0084] (8) The transgenic seedlings obtained finally are expanded, and then the expanded transgenic seedlings are acclimated, and finally grown in a culture box for about 30 days for field transplanting, and the phenotype is observed and the data are counted for more than twice.

[0085] 1.2.5 Subcellular localization

[0086] According to the method in the literature (Von A A. Subcellular Localization of GUS-and GFP-Tagged Proteins in Onion Epidermal Cells [J]. CSH protocols, 2007, 2007(2): pdb.prot4689), 35:GFP-ClROS1a and 35:GFP plasmids are transiently introduced into onion epidermal cells by high-pressure gas particle bombardment. The transformed cells are cultured in MS medium at 22°C in the dark for 16 hours, and then observed using a Zeiss LSM780 confocal microscope. mCherry is a nuclear marker as a control. The specific method is as follows:

[0087] (1) Preparation of microbullets

[0088] Weigh gold powder with a specification of 1.0 μm into a 2 mL sterile centrifuge tube; then slowly add 1 mL of anhydrous ethanol to the centrifuge tube, mix well by shaking; stand for 10 min; centrifuge at 10,000 rpm for 1 min; discard the supernatant, and add 1 mL of sterile water again, mix well by shaking; centrifuge at 10,000 rpm for 1 min, repeat 3-4 times; discard the supernatant, and prepare a 100 mg / mL gold powder solution, which is stored in a -20°C refrigerator for standby.

[0089] (2) Preparation of medium

[0090] High osmotic medium: MS 4.43 g / L + sucrose 30 g / L + agar 10 g / L + sorbitol 72.8 g / L

[0091] MS medium: MS 4.43 g / L + sucrose 30 g / L + agar 10 g / L

[0092] (3) Prepare onion

[0093] Select fresh, yellow, large onions, cut at 7:00-9:00 pm, select the third to fifth layers and cut into 2-3 cm squares, and lay them flat on the high osmotic medium (the side away from the onion flesh is in contact with the medium), and incubate overnight in the dark in the tissue culture room. 2

[0094] (4) Extract plasmid

[0095] Follow the operation method of the plasmid extraction kit of different companies, but the plasmid concentration should be high and there should be no impurities.

[0096] (5) Reagent preparation

[0097] 2.5 M CaCl2: Dissolve 2.7745 g CaCl2 in 10 mL sterile distilled water, filter with a water filter membrane in a clean bench, and store in a sterile centrifuge tube at 4°C for standby.

[0098] 0.1 M spermidine: Dissolve 15.7 μL spermidine in 984.3 μL sterile water, filter with a water filter membrane (this reagent is prepared as needed).

[0099] (6) Mix plasmid and gold powder

[0100] Mix the stored gold powder thoroughly, take 30 μL gold powder into a sterile centrifuge tube, add 5 μg plasmid, mix thoroughly, then add 20 μL 2.5 M CaCl2, mix thoroughly, then add 8 μL 0.1 M spermidine, mix thoroughly, and place on ice for 20 min, vortex for 4-5 times during the period.

[0101] (7) Wash the plasmid and gold powder

[0102] Add 80 μL anhydrous ethanol, centrifuge at 13,000 g for 20 sec, discard the supernatant (leave about 20 μL); add 20-30 μL anhydrous ethanol, vortex vigorously for 3-5 sec, add anhydrous ethanol to 20 μL, centrifuge at 13,000 g, discard the supernatant, repeat 3 times; resuspend with 80 μL anhydrous ethanol, mix thoroughly by blowing.

[0103] ​(8) Biolistics

[0104] The onion epidermis was transferred from Gamborg's B5 medium to MS medium for biolistics. The flying membrane (yellow) and the fixed steel mesh and fixer were soaked in 75% alcohol, dried in the clean bench and operated. The gold powder was placed on the yellow flying membrane (position of the central hole), dried and loaded into the fixer; the small disc was at the upper end of the gene gun, which must be replaced each time.

[0105] (9) Culture

[0106] The biolistic onion epidermis was cultured in the tissue culture room under dark conditions for 16-24 h.

[0107] (10) Observation of GFP signal

[0108] The fluorescence signal was observed and photographed using a LSM710 laser confocal microscope.

[0109] 1.2.6 RNA extraction and transcriptome sequencing and analysis

[0110] The top buds of the transgenic CmCMT2-RNAi, CmDRM2-RNAi and wild type WT 'Jinma' with consistent growth were selected for cutting in mid-July of the same year. After the cutting seedlings grew and rooted (about early August), they were transferred to large nutrient pots and cultured in an incubator. When the transgenic and wild type 'Jinma' had fully expanded leaves reaching 15 pieces, they were transferred outdoors for natural dark treatment (about early September). The dark treatment lasted for about a month, and when the earliest budding plants were observed, the leaves of the transgenic and wild type 'Jinma' were sampled (the 3rd-5th fully expanded leaves from top to bottom). Each sample had 3 biological replicates, and each replicate had at least 3 plants. Guangzhou Kidebio Biotechnology Co., Ltd. extracted RNA, constructed a library, and then used Illumina Novaseq6000 for sequencing. The specific steps are as follows:

[0111] (1) RNA extraction, library construction and sequencing

[0112] Total RNA was extracted according to the Trizol kit instructions. The quality of the RNA was detected by Agilent 2100 and agarose gel electrophoresis. Then the mRNA was enriched by Oligo (dT) beads. After purification, the cDNA fragments were end-repaired, A base was added, and connected with Illumina sequencing adapters. The reverse connection was purified by AMPure XP Beads (1.0X) and PCR amplified. The obtained cDNA library was sequenced by Illumina Novaseq6000 platform by Gideobio Technology Co., Ltd. (Guangzhou, China).

[0113] (2) Bioinformatics analysis

[0114] The raw reads were filtered by fastp (version 0.18.0) to obtain clean reads. The reference genome index was established, and HISAT2.2.4 was used to map paired-end clean reads to the reference genome. StringTiev1.3.1 was used to assemble the mapped reads of each sample based on the reference genome. Then RSEM software was used to calculate the FPKM of the expression of gene i, C was the number of fragments mapped to gene i, N was the total number of fragments mapped to the reference gene, and L was the base number of gene i. Therefore, the calculated gene expression can be directly used to compare the differences in gene expression between different samples. Finally, the R package gmodels (http: / / www.r-project.org / ) was used for principal component analysis (PCA).

[0115] (3) Differential expression genes (DEGs) and enrichment analysis

[0116] DESeq2 software was used to analyze the differential expression of RNA between two different samples. Genes with a false discovery rate (FDR) parameter less than 0.05 and an absolute fold change ≥ 2 were considered to be differentially expressed genes. Then the differential genes were subjected to Gene Ontology (GO) functional classification and enrichment analysis, KEGG biological pathway classification and enrichment analysis.

[0117] 1.2.7 Hormone determination

[0118] Hormone extraction sample: 1.2.6, grind the tissue sample thoroughly in liquid nitrogen, take 0.2 g of sample in a 2.0 mL centrifuge tube, and store in liquid nitrogen. Add the prepared hormone extraction solution (methanol: water: formic acid = 80%: 19%: 1%) to the centrifuge tube containing the sample, mix thoroughly, and then place it on ice. Then, shake it on a shaker for 3-5 h at 4°C, and let it stand overnight in a 4°C refrigerator. After overnight low-temperature extraction, centrifuge at 10,000 rpm for 15 min at 4°C in a high-speed low-temperature centrifuge, and collect 800 μL of supernatant in a 1.5 mL centrifuge tube. Perform nitrogen blowing in a nitrogen blowing instrument in the dark until dryness (about 1.5-2 h), and finally redissolve with 100 μL of 40% methanol, mix thoroughly, and then perform a short centrifugation. Then, filter with a 0.22 μm organic filter membrane, and add the filtered liquid to a liquid phase vial with an inner cannula, cover it with a pre-cut lid, and use it for UPLC-MS / MS analysis (mass spectrometry).

[0119] 2.1 Results and analysis

[0120] 2.1.1 Identification and phylogenetic analysis of CmCMT2 and CmDRM2

[0121] Previous studies have found that CMT2 and DRM2 genes are highly expressed during the flowering period, so the two methyltransferases AtCMT2 and AtDRM2 of Arabidopsis thaliana were used to perform local Blast on the transcriptome data of ‘Godiva’, and the CmCMT2 and CmDRM2 genes in ‘Godiva’ were obtained. The nucleotide lengths of CmCMT2 and CmDRM2 were 2778 and 1986 bp, respectively. Phylogenetic trees were constructed for CmCMT2 and CmDRM2 with wild and cultivated species of Chrysanthemum, and model plants Arabidopsis thaliana, Oryza sativa, Solanum lycopersicum, Zea mays, and Populus. The results showed that CmCMT2 was most closely related to ClCMT2a / c in Chrysanthemum leucanthum and CsGCMT2a in Chrysanthemum morifolium Gojo-0, followed by CmoCMT2a / b in ‘Zhongshan Zgui’ (A). CmDRM2 was relatively close in evolutionary relationship to ClDRM2a in Chrysanthemum leucanthum, CnDRM2a in Chrysanthemum morifolium, and CmoDRM2a / b / c in ‘Zhongshan Zgui’, and clustered in a subpopulation (B). Figure 2 A}). CmDRM2 was relatively close in evolutionary relationship to ClDRM2a in Chrysanthemum leucanthum, CnDRM2a in Chrysanthemum morifolium, and CmoDRM2a / b / c in ‘Zhongshan Zgui’, and clustered in a subpopulation (B). Figure 2

[0122] 2.1.2 Construction of CmCMT2 and CmDRM2 gene silencing vectors and protein localization analysis

[0123] ​Previous studies have shown that the methylation level of early-flowering varieties is lower than that of late-flowering varieties in chrysanthemum, and the expression level of ClCMT2 and ClDRM2 is higher than that of other periods in the flowering stage. In order to explore the function of CmCMT2 and CmDRM2 in 'Shenma', this study first constructed the silencing expression vectors of the two genes. The gene fragments used to construct the silencing expression vectors were located in the conserved region of CmCMT2 and CmDRM2 genes. In the CmCMT2 gene, the sequence of the 1578-1879 bp region was selected to construct the RNAi vector, while in the CmDRM2 gene, the sequence of the 595-849 bp region was selected to construct the RNAi vector. Figure 1 and Figure 3 A).

[0124] To further explore the function of CmCMT2 and CmDRM2 proteins, the full-length CmCMT2 and CmDRM2 gene sequences excluding the stop codon were isolated from 'Shenma' and connected into the overexpression vector containing the GFP tag. Using the gene gun technique, 35S pro :GFP- CmCMT2 and 35S pro :GFP- CmDRM2 fusion vectors were bombarded into onion epidermal cells, and the fluorescence positions of 35S pro :GFP- CmCMT2 and 35S pro :GFP- CmDRM2 fusion proteins were evaluated by laser confocal microscopy. The results showed that 35S pro :GFP- CmCMT2 and 35S pro :GFP- CmDRM2 fusion proteins had green fluorescence signals in the nucleus, while 35S pro :GFP protein had green fluorescence signals in the cell membrane and nucleus, and the nuclear localization marker mCherry protein showed that the green fluorescence positions of 35S pro :GFP- CmCMT2 and 35S pro :GFP- CmDRM2 fusion proteins were consistent (B). In summary, CmCMT2 and CmDRM2 are localized in the nucleus, and their functions are mainly exercised in the nucleus. Figure 3 B). In summary, CmCMT2 and CmDRM2 are localized in the nucleus, and their functions are mainly exercised in the nucleus.

[0125] 2.1.3 Temporal and spatial expression analysis of CmCMT2 and CmDRM2 genes

[0126] To determine the expression pattern of CmCMT2 and CmDRM2 genes in 'Shenma', qRT-PCR was performed using RNA extracted from different organs at different developmental stages (Fig. 2A and Fig. 2B). Figure 4). The results showed that the expression levels of CmCMT2 and CmDRM2 in the flower bud development until the color change process were significantly higher than those in other organs at other periods. The expression level of CmCMT2 gradually decreased during the process from the flower bud to the fully open flower, while CmDRM2 began to significantly decrease after the flower color change. In addition, in the leaves, the expression levels of CmCMT2 and CmDRM2 showed a gradually decreasing trend during the whole growth process. In the stems, the expression levels of CmCMT2 and CmDRM2 were relatively stable and not significantly different between different periods. In the roots, CmCMT2 and CmDRM2 showed different expression patterns. CmCMT2 significantly decreased in the roots from the seedling stage to the reproductive stage, while CmDRM2 had almost no change in the seedling stage and the vegetative growth stage, but significantly increased in the reproductive growth stage. In summary, the expression patterns of CmCMT2 and CmDRM2 in 'Jinma' were almost the same in different development periods of other organs except in the roots, indicating that CmCMT2 and CmDRM2 might have similar functions in the growth and development of 'Jinma'.

[0127] 2.1.4 CmCMT2 and CmDRM2 expression reduction leads to early flowering of 'Jinma'

[0128] In view of the fact that the expression levels of CmCMT2 and CmDRM2 genes in the leaves of 'Jinma' gradually decreased during the growth and development process, and the expression levels of CmCMT2 and CmDRM2 genes significantly decreased from the flower bud to the full bloom stage. To study whether CmCMT2 and CmDRM2 are involved in the regulation of the flowering period of 'Jinma', the silencing expression vectors of CmCMT2 and CmDRM2 genes were first transformed into 'Jinma', and transgenic chrysanthemums with silenced expression of CmCMT2 and CmDRM2 were obtained (CmCMT2-RNAi and CmDRM2-RNAi, respectively). Figure 5 A). The results showed that the expression levels of CmCMT2 and CmDRM2 in CmCMT2-RNAi and CmDRM2-RNAi transgenic plants were reduced by 27.1%, 28.7% and 22.1%, 29.4%, respectively.

[0129] Secondly, to explore the effect of CmCMT2 and CmDRM2 on the flowering period of 'Jinma', two strains of CmCMT2-RNAi (CmCMT2-RNAi-4, CmCMT2-RNAi-17) and two strains of CmDRM2-RNAi (CmDRM2-RNAi-3, CmDRM2-RNAi-4) were cultured. The results showed that CmCMT2 and CmDRM2 could both make the flowering period of 'Jinma' advance, but the flowering time showed differences. The two strains of CmCMT2-RNAi were 15 days earlier than WT at the present bud and early flowering stage (CmCMT2-RNAi-4 and CmCMT2-RNAi-17 were 15 days and 10 days earlier than WT, respectively), while the two strains of CmDRM2-RNAi were 10 days earlier than WT at the present bud and early flowering stage (CmDRM2-RNAi-3 and CmDRM2-RNAi-4 were 10 days and 5 days earlier than WT, respectively). Figure 5B), and showed a significant early flowering phenotype compared to WT at 90 and 110 days (Fig. 1C and D). Figure 5 C and D). While the two lines of CmDRM2-RNAi showed 8 days earlier bud stage and early flowering stage compared to WT (Fig. 1C and D). Figure 5 B), and showed a significant early flowering phenotype compared to WT at 90 and 110 days (Fig. 1C and D). Figure 5 C and D).

[0130] 2.1.5 Transcriptome analysis of CmCMT2 and CmDRM2 transgenic chrysanthemum

[0131] To further elucidate the molecular mechanism of CmCMT2 and CmDRM2 regulating flowering, leaf samples (3-5 from top, about 80 days) of wild type ‘Jinma’, CmCMT2-RNAi-4 (RNAi-4) and CmDRM2-RNAi-3 (RNAi-3) transgenic lines were sampled for transcriptome sequencing. There were 3 natural replicates for each sample of wild type and transgenic lines, and a total of 9 samples, with the genome of chrysanthemum variety ‘Zhongshan Zongui’ as the reference genome. The length of the original reads and clean reads in the 9 samples was more than 5,455,489,800 bp and 5,292,205,534 bp, respectively. The filtered data Q20 was greater than 95.83%, Q30 was greater than 89.39%, and the GC ratio was more than 43.16% (Table 3). Then the clean reads were aligned with the ‘Zhongshan Zongui’ genome. In the 9 samples, the average number of reads obtained was 44,828,400, of which less than 25.08% of the reads were not aligned, the single alignment rate was more than 51.59%, the multiple alignment rate was less than 26.37%, and the total alignment rate was more than 74.92% (Table 4). Finally, according to the reads that can be located to the genome, the distribution in the genome was calculated, and the regions aligned to the genome were divided into exon region, intron region and intergenic region. It was found that the alignment rate to the exon region was the highest, with an average alignment rate of 86.58%, and the alignment rate to the intron region and intergenic region was lower, with an intron region alignment rate of less than 5.78% and an intergenic region alignment rate of less than 8.08% (Table 5).

[0132] To detect the correlation between the transcriptome samples, principal component analysis (PCA) and correlation between samples were performed on the 9 samples. The PCA results showed that the dispersion between the three groups of WT, RNAi-4 and RNAi-3 was small, of which the dispersion of WT was the smallest (Fig. 2A). The correlation heat map between samples showed that the three biological replicates of WT, RNAi-4 and RNAi-3 had good repeatability, with a correlation coefficient of more than 0.996 (Fig. 2B). Figure 6 A). The correlation heat map between samples showed that the three biological replicates of WT, RNAi-4 and RNAi-3 had good repeatability, with a correlation coefficient of more than 0.996 (Fig. 2B). Figure 6B). In summary, the correlation between WT, RNAi-4 and RNAi-3 repeats was good, and the sequencing data was reliable.

[0133] Table 3. Reads statistics of transcriptome.

[0134]

[0135] Table 4. Comparative analysis with Zhongshan Ziguigenome.

[0136]

[0137] Table 5. Statistical analysis of genome region comparison with Zhongshan Ziguigenome.

[0138]

[0139] By comparing wild type with RNAi-4 and RNAi-3, differentially expressed genes (EDGs) were screened, and the screening criteria for differential genes were: FDR < 0.05; |log2 FoldChange (2). The results are shown in Figure 7. In WT vs RNAi-4 and WT vs RNAi-3, 25002 and 22172 EDGs were screened, respectively (Figure 7A). Among them, in WT vs RNAi-4, 8083 genes were up-regulated, and 16919 genes were down-regulated; in WT vs RNAi-3, 7186 genes were up-regulated, and 14986 genes were down-regulated (Figure 7A).

[0140] In order to explore the reason of early flowering caused by silencing expression of CmCMT2 and CmDRM2 in chrysanthemum, KEGG enrichment analysis was performed on the EDGs in the transcriptome. In WT vs RNAi-4, the differential genes were enriched in ribosome, secondary metabolite biosynthesis, photosynthesis-antennae, metabolic pathways, phenylpropanoid biosynthesis, photosynthesis, fatty acid elongation, plant-pathogen interaction, MAPK signaling pathway-plant, and biotin metabolism (Figure 8B); in WT vs RNAi-3, the differential genes were enriched in ribosome, photosynthesis-antennae, photosynthesis, secondary metabolite biosynthesis, metabolic pathways, phenylpropanoid biosynthesis, plant-pathogen interaction, fatty acid elongation, MAPK signaling pathway-plant, and biotin metabolism (Figure 8B). Figure 7 Figure 7 ​C). In summary, common enrichment in most pathways was found in WT vs RNAi-4 and WT vs RNAi-3, and the main cause of flowering was mainly affected by photoperiod and hormones, among which the photoperiod pathway was not significantly enriched, and gibberellin (GA) has been shown to affect flowering time, so the present application focuses on the hormone regulation in the metabolic pathway (biosynthesis and metabolic pathways of secondary metabolites), which may be the reason for the change of flowering time of CmCMT2 and CmDRM2 silenced chrysanthemum.

[0141] 2.1.6 Analysis of differentially expressed genes of GA synthesis and flowering regulation

[0142] Further screening of differentially expressed genes in the photoperiod pathway that regulate flowering and gibberellin (GA) content, screening genes that may regulate flowering in WT-vs-RNAi-4 and WT-vs-RNAi-3, and the results showed that they had similar differentially expressed genes. In the flowering regulation pathway, GIs, COs, FTs and AP1s, etc. were screened out in WT-vs-RNAi-4 and WT-vs-RNAi-3, and the expression of the genes was significantly different (P<0.05) (Table 2). Figure 8 ). In addition, the same differentially expressed genes regulating GA were found in WT-vs-RNAi-4 and WT-vs-RNAi-3, GA20ox1a, GA20ox1 (evm.TU.scaffold_1806.761 and evm.TU.scaffold_9272.33 down-regulated) and GA20ox2a, GA20ox2b (evm.TU.scaffold_166.251 and evm.TU.scaffold_12101.1 up-regulated) (Table 3). Figure 8 Since GA20ox2a and GA20ox2b positively regulate the content of GA, it is speculated that the early flowering of CmCMT2 and CmDRM2 transgenic chrysanthemum is due to the up-regulated expression of GA20ox2a and GA20ox2b, which promotes the increase of GA content, leading to changes in the expression of genes regulating flowering, resulting in the change of flowering time of CmCMT2 and CmDRM2 transgenic chrysanthemum.

[0143] 2.1.7 Analysis of gibberellin content in CmCMT2 and CmDRM2 transgenic chrysanthemum

[0144] To investigate whether the changes in flower time of CmCMT2 and CmDRM2 transgenic chrysanthemums were caused by the changes in GA content, the GA content in CmCMT2 and CmDRM2 transgenic chrysanthemums was analyzed by UPLC-MS / MS. The results showed that only GA1 was detected in CmCMT2 and CmDRM2 transgenic chrysanthemums, and other active GA3, GA4 and GA7 might have low content and could not be detected. The GA1 content in two lines of CmCMT2 transgenic chrysanthemums was significantly higher than that in WT, and the GA1 content was about 2 times that of WT ( Figure 9 ). The GA1 content in two lines of CmDRM2 transgenic chrysanthemums was also significantly higher than that in WT, but the GA1 content was relatively less improved compared with WT ( Figure 9 ).

[0145] 2.2 Discussion

[0146] Gibberellins (GAs) are important hormones related to cell growth and differentiation, and have important regulatory effects on the elongation or swelling of roots, hypocotyls, leaves, stems, stamens and pistils, etc. GAs have been shown to promote flowering in many plants, including Arabidopsis. In Arabidopsis, GA4 is the main bioactive GA for growth processes and induction of flowering. The activity of GA20-oxidases (GA20ox), which are enzymes involved in GA biosynthesis, regulates the GA content in various plants. In Arabidopsis, these enzymes are encoded by five gene families: AtGA20ox1-AtGA20ox5. AtGA20ox1 and AtGA20ox2 play redundant roles in promoting hypocotyl and internode elongation, flowering time, anther filament elongation, seed number per silique, and silique elongation. AtGA20ox1 contributes more to internode and filament elongation, while AtGA20ox2 contributes more to flowering time and silique length.

[0147] Most of the cultivated chrysanthemum must be induced by short day to bloom, while in the model plant Arabidopsis, GA treatment can accelerate flowering. It was found that exogenous GA3 can make the chrysanthemum bloom 5 days earlier and the flowering period is extended by 7 days. The mutant of chrysanthemum variety 'Jinma' that can bloom under long day conditions, up-regulates the expression of biological clock genes and CmFTL3 under short day conditions, inducing flower bud formation and flowering; under long day conditions, the GA signal pathway related genes GA20ox and GID are up-regulated, and GA2ox and GAI are down-regulated, thereby inducing the transcription of SOC1 and LFY; at the same time, under both LD and SD conditions, the GA content of the mutant leaves is higher than that of WT, and the mutant has more branches. In addition, in the chrysanthemum mutant CmBBX24-RNAi, the GA synthesis pathway related genes are up-regulated, and the early flowering phenotype is exhibited. In addition, under both LD and SD conditions, the active GA1 content in the mutant and WT is much higher than that of GA4; under LD conditions, the GA1 and GA4 contents in the leaves of CmBBX24-RNAi are 2.3 and 1.8 times those of WT, respectively, and the GA1 content is at least 5 times higher than that of other active GA. In chrysanthemum, CmBBX24 can regulate flowering by affecting the synthesis of gibberellins, overexpression of CmMYB2 causes early flowering, and CmMYB2-RNAi causes late flowering; through the interaction experiment, it is found that CmMYB2 and CmBBX24 have interaction, which indicates that CmMYB2 regulates flowering by affecting the synthesis of gibberellins.

[0148] In this study, the present application constructs CmCMT2 and CmDRM2 silencing expression vectors, and finds that the decrease of CmCMT2 and CmDRM2 expression levels in 'Jinma' leads to different degrees of early flowering phenomenon (CmCMT2-RNAi and CmDRM2-RNAi) Figure 5 ), then RNA-seq sequencing and KEGG analysis find that EDGs are mainly enriched in metabolic pathways. It is reported that gibberellin (GA) promotes plant flowering, so the analysis of EDGs involved in gibberellin regulation in the metabolic pathway finds that GA synthesis genes CmG20ox2a and CmG20ox2b are significantly up-regulated in CmCMT2 and CmDRM2 transgenic chrysanthemum, and then the active GA (GA1, GA3, GA4 and GA7) is found to increase in CmCMT2 and CmDRM2 transgenic chrysanthemum. This is inconsistent with the research in Arabidopsis, where the active gibberellin involved in flowering regulation is mainly GA4. However, in chrysanthemum, the CmBBX24-RNAi mutant chrysanthemum shows an early flowering phenotype, with GA1 content at least 5 times higher than that of other active GA, which is consistent with the high GA1 content in this study ( Figure 9), the possible reason for this difference is species-specific and different sampling sites. Therefore, the changes in GA1 content in CmCMT2 and CmDRM2 transgenic chrysanthemums in this study may be the main reason for the early flowering, and there is a certain dose problem in the early flowering of GA1 content. In summary, CmCMT2 and CmDRM2 genes in chrysanthemum may change the expression level of CmG20ox2a and CmG20ox2b by changing the methylation of the promoters of CmG20ox2a and CmG20ox2b, thereby changing the flowering time of chrysanthemum.

[0149] 2.3 Summary

[0150] In this study, CmCMT2 and CmDRM2 genes were identified from 'Shenma' by bioinformatics methods, and the main conclusions were obtained by fluorescence quantitative PCR, subcellular localization, transgenic verification, RNA-seq and other analyses.

[0151] (1) CmCMT2 and CmDRM2 genes were cloned from 'Shenma', and the temporal and spatial expression analysis showed that CmCMT2 and CmDRM2 were highly expressed during the development of 'Shenma' flower buds to color change; and the expression level of CmCMT2 and CmDRM2 in 'Shenma' gradually decreased during growth and development.(2) The expression levels of CmCMT2-RNAi and CmDRM2-RNAi transgenic 'Shenma' were reduced by 27.1%, 28.7% and 22.1%, 29.4%, respectively; Phenotypic analysis showed that the flowering time of CmCMT2-RNAi-4, CmCMT2-RNAi-17 and CmDRM2-RNAi-3, CmDRM2-RNAi-4 transgenic 'Shenma' was 15, 15 and 8, 8 days earlier, respectively.(3) RNA-seq analysis of CmCMT2-RNAi and CmDRM2-RNAi transgenic 'Shenma' showed that the differentially expressed genes (DEGs) in the metabolic pathway were significantly enriched, and the expression of GA synthesis genes CmG20ox2a and CmG20ox2b was significantly increased.(4) Hormone content determination analysis showed that the content of GA1 in CmCMT2-RNAi-4, CmCMT2-RNAi-17 and CmDRM2-RNAi-3 and CmDRM2-RNAi-4 was 2.05, 1.73 times and 1.12, 1.24 times of WT, respectively, and had significant difference with WT.

[0152] In summary, the results of this study showed that CmCMT2 and CmDRM2 changed the content of GA1 by negatively regulating the expression of CmG20ox2a and CmG20ox2b, thereby regulating the flowering time of chrysanthemum.

Claims

1. Chrysanthemum methyltransferase gene CmCMT2 and / or CmDRM2 Its application in regulating the flowering period of chrysanthemums is characterized by, By inhibiting the chrysanthemum methyltransferase gene CmCMT2 and / or CmDRM2 This advances the flowering period; The chrysanthemum variety mentioned is "Shenma"; CmCMT2 The nucleotide sequence of the gene is shown in SEQ ID NO.3; CmDRM2 The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, When applied, it is based on the chrysanthemum methyltransferase gene. CmCMT2 and CmDRM2 We constructed an RNAi gene silencing expression vector, transformed Agrobacterium competent cells, and then transformed chrysanthemum leaves using the Agrobacterium-mediated transformation method. Chrysanthemum methyltransferase gene CmCMT2 and CmDRM2 Silence or a decline in the level of expression can lead to earlier flowering.

3. The application according to claim 2, characterized in that, The RNAi gene silencing expression vector was constructed using the following method: 1) The plasmids pART27 and pKANNIBAL were digested with Not I enzyme, and then the intron-containing portion of plasmid pKANNIBAL was ligated into plasmid pART27 using T4 DNA ligase to construct a composite vector; 2) According to CmCMT2 Genes and CmDRM2 The conserved gene sequence was used to design 200-500 bp RNAi fragments, and primers were designed using Premier 5.0 software. These fragments were then ligated with the composite vector from step 1) to obtain the final RNAi fragment.

4. The application according to claim 3, characterized in that, CmCMT2 The RNAi fragment sequence of the gene is shown in SEQ ID NO.

1. CmDRM2 The RNAi fragment sequence of the gene is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Application of open-field chrysanthemum methyltransferase genes CmCMT2 and CmCMT2cd in controlling color of open-field chrysanthemum

    CN118581137A

  • Application of open field chrysanthemum methyltransferase genes CmDRM2a and CmDRM2b in controlling color of open field chrysanthemum

    CN118599892A

Cited By

  • Application of CmIAA27 in regulation and control of lateral branch development of chrysanthemum

    CN122060757A