Application of tobacco NtCLE23 gene in improvement of drought resistance of tobacco

By overexpressing the NtCLE23 gene in tobacco, the activity of SOD and CAT enzymes was improved, and the problem of insufficient drought resistance of tobacco under drought conditions was solved, and the effect of significantly improving drought resistance was achieved.

CN120060335AActive Publication Date: 2025-05-30SHANDONG QINGDAO TOBACCO
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510226221.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-27
Publication Date
2025-05-30
Estimated Expiration
2045-02-27

AI Technical Summary

Technical Problem

Climatic conditions such as high temperature and drought often affect the quality of tobacco. The existing technology requires the development of more drought resistance genes to improve the drought resistance of tobacco.

Method used

By overexpressing the tobacco NtCLE23 gene, the activity of SOD and CAT enzymes is improved, thereby enhancing the reactive oxygen scavenging ability of the plants under drought conditions and improving drought resistance.

Benefits of technology

By increasing the activity of SOD and CAT enzymes, the accumulation of reactive oxygen species is reduced, and the drought resistance of tobacco is significantly improved, avoiding the problem of limited plant growth and development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060335A_ABST
    Figure CN120060335A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of bioengineering and application thereof, and particularly relates to application of a tobacco NtCLE23 gene in improvement of drought resistance of tobacco. Experimental research proves that NtCLE23 gene overexpression can improve the ability of plants to remove active oxygen in vivo under the drought condition by improving the enzyme activity of SOD and CAT, so that accumulation of the active oxygen is reduced, and the drought resistance of the plants is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering and its application, and particularly relates to the application of tobacco NtCLE23 gene in improving the drought resistance of tobacco. Background Art

[0002] Tobacco (Nicotiana tabacum L.), an annual herbaceous plant in the Solanaceae family, is widely cultivated in my country and is an important economic crop. Native to South America, tobacco prefers warmth, is intolerant of cold, and is relatively heat-tolerant. Its growth requirements are very sensitive to factors such as moisture and temperature. Therefore, high temperatures and drought often significantly impact tobacco quality. Therefore, research on tobacco drought resistance is crucial.

[0003] CLE genes are a class of genes widely found in plants. CLE genes have been identified in species such as Arabidopsis, tomato, cotton, and soybean. Existing studies have shown that CLE genes are expressed in various plant parts and play a role in various processes throughout the plant life cycle. Currently, in-depth research is underway on the role and molecular mechanisms of CLE genes in maintaining the balance between stem cell division and differentiation in meristems during plant growth and development. Additionally, related studies have shown that CLE genes play a role in stomatal development, pollen tube elongation, and regulating leaf senescence. In recent years, studies have also revealed that CLE polypeptides play a role in plant stress tolerance. Chinese Patent CN116622764A discloses the use of the tobacco NtCLE9 gene to enhance drought tolerance in tobacco. However, not all CLE genes enhance drought tolerance in tobacco. Differences in gene expression levels, signaling pathways, and regulatory networks can lead to ineffectiveness of this effect. However, NtCLE9-overexpressing plants sometimes experience restricted plant growth and development, possibly because NtCLE9 overexpression affects some unknown plant growth and development processes. More CLE genes need to be developed and applied to improve tobacco drought resistance.

[0004] Summary of the Invention

[0005] The technical problem to be solved by the present invention is that climate conditions such as high temperature and drought often become important factors affecting tobacco quality. It is very necessary to carry out research on tobacco drought resistance and it is necessary to develop more drought-resistant genes.

[0006] To address the above problems, the present invention provides a tobacco NtCLE23 gene for use in improving tobacco drought resistance. Experimental studies have confirmed that overexpression of the NtCLE23 gene can enhance the plant's ability to scavenge reactive oxygen species in the body under drought conditions by increasing the enzyme activities of SOD and CAT, thereby reducing the accumulation of reactive oxygen species and improving the plant's drought resistance.

[0007] To achieve the above object, the present invention is specifically implemented through the following technical solutions: application of tobacco NtCLE23 gene in improving tobacco drought resistance, the gene sequence of which is shown in SEQ ID NO.1.

[0008] SEQ ID NO.1:

[0009] ATGGTGAATATATTTCATTTTATTCTTCTTTCTTCTCCTTGTTACCTCTTCAAGACTCCAGGCAATCCGGCAGCCGGCACAAGTTTCCGGTACGCCGTCGGCAAGAAAAGTACAAGTTTTTCTACCTTTGGCTAATGCTCCGGCTGCTCAAGATGTTGGGTCTTCCAAGAGGAGAACTCCTACTGGATCAAATCCTTTACATAACAAGAAAAGATAG.

[0010] Further research on NtCLE9 revealed that plants overexpressing NtCLE9 sometimes experience restricted growth and development, likely due to NtCLE9 overexpression affecting some unknown plant growth and development process. The inventors continued to explore other CLE genes and discovered that the NtCLE23-OE plants described in this paper did not exhibit this effect.

[0011] Under drought conditions, plants face a variety of physiological stresses, among which the accumulation of reactive oxygen species is a key issue. Reactive oxygen species include superoxide anion radicals (O 2- ), hydrogen peroxide (H2O2) and hydroxyl radicals (·OH), etc. Excessive accumulation of these reactive oxygen species can cause serious oxidative damage to plant cells, destroy the integrity of cell membranes, and damage biological macromolecules such as proteins and nucleic acids, thereby affecting the normal growth and development of plants.

[0012] The present invention proves through experiments that the NtCLE23 gene can improve the plant's ability to scavenge active oxygen in the body under drought conditions by increasing the enzyme activities of SOD and CAT, thereby reducing the accumulation of active oxygen and improving the plant's drought resistance.

[0013] The present invention uses the tobacco NtCLE23 gene to construct an overexpression vector and NtCLE23 overexpressing tobacco transgenic plants. The present invention uses the tobacco NtCLE23 gene to construct an overexpression vector and then performs tobacco transgenic to obtain NtCLE23 overexpressing tobacco transgenic plants with high drought resistance.

[0014] The present invention has the following beneficial effects:

[0015] (1) The present invention discovered and confirmed the application of tobacco NtCLE23 gene in improving tobacco drought resistance, and studied and verified the corresponding mechanism of action.

[0016] (2) The present invention experiments and optimizes the application effect of tobacco NtCLE23 gene in improving tobacco drought resistance, and obtains NtCLE23 overexpressing tobacco transgenic plants with significant drought resistance and stable expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The relative expression levels of the NtCLE23 gene in wild-type tobacco (control) and NtCLE23-overexpressing tobacco; WT: wild-type tobacco; NtCLE23-OE: NtCLE23 gene overexpressing tobacco.

[0018] Figure 2 This is the base change of the NtCLE23 gene in the NtCLE23 gene-edited plants.

[0019] Figure 3 Effects of drought stress on wild-type tobacco (WT), NtCLE23-overexpressing tobacco (NtCLE23-OE) and NtCLE23 gene-edited tobacco (NtCLE23-CRISPR).

[0020] Figure 4 Effects of drought stress on the total chlorophyll content of wild-type tobacco (WT), NtCLE23-overexpressing tobacco (NtCLE23-OE) and NtCLE23 gene-edited tobacco (NtCLE23-CRISPR).

[0021] Figure 5 Effects of drought stress on the SOD, CAT and POD activities of wild-type tobacco (WT), NtCLE23-overexpressing tobacco (NtCLE23-OE) and NtCLE23 gene-edited tobacco (NtCLE23-CRISPR). DETAILED DESCRIPTION

[0022] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0023] Example 1:

[0024] The gene overexpression vector used in this example was pCHF3. PCR amplification of NtCLE23 was performed using the cDNA from Nicotiana tabacum K326 as a template to obtain the complete CDS sequence of the gene. The PCR amplification primers are as follows (depending on the vector, the primers were end-contained with SacI and KpnI restriction sites, respectively):

[0025] NtCLE23-F:GAGCTCATGGTGAATATATTTCA

[0026] NtCLE23-R:GGTACCCTATCTTTCTTGTTATG

[0027] The complete CDS sequence of NtCLE23 was used to construct the CaMV35S::NtCLE23 overexpression vector through enzyme digestion and ligation.

[0028] Methods for obtaining NtCLE23 overexpressing tobacco transgenic plants:

[0029] Preparation of sterile seedlings: Take common tobacco K326 seeds, disinfect them and sow them on MS solid culture medium. When the leaves grow to 5-8 leaves, select green leaves and infect them with Agrobacterium.

[0030] Preparation of Agrobacterium: The above overexpression vector was transformed into Agrobacterium LBA4404. The correct single colony was picked and shaken in YEP liquid medium containing the corresponding antibiotics until the bacterial liquid OD 600 The value is about 0.6-0.8. Collect the cells by centrifugation, resuspend the cells in liquid MS medium, and dilute to OD 600 =0.8, 20 mg / L acetosyringone was added, and the Agrobacterium infection solution was used to infect tobacco leaves.

[0031] Tobacco leaf infection and culture: This process is carried out in a clean bench, and all utensils used have been disinfected and sterilized. Take sterile leaves, cut them into squares with a blade of about 1 cm in length, and immerse them in the prepared Agrobacterium infection solution for 8 minutes. The infected leaves are spread with the veins facing up on the co-cultivation medium (MS solid medium + 1mg / L 6-BA + 0.1mg / L IAA) and cultured in the dark at 22°C for 3 days. The co-cultivated leaves are inoculated with the veins facing down on S1 medium (MS solid medium + 1mg / L 6-BA + 0.1mg / L IAA + 500mg / L Cef + selection marker antibiotics) and cultured in the dark at 25°C for 2-3 weeks until buds of 0.1-0.5cm grow on the edge of the leaves. The buds were broken off and transferred to S2 medium (MS solid medium + 0.5mg / L6-BA + 0.05mg / L IAA + 500mg / L Cef + screening marker antibiotics), cultured at 25℃ for 4-5 weeks until they grew into strong seedlings. The culture medium can be renewed during this period. Take the strong seedlings, remove the swollen callus tissue at the bottom and the yellow leaves at the bottom, inoculate them into rooting medium (MS solid medium + 500mg / L Cef + screening marker antibiotics), cultured at 25℃ for 3-4 weeks, and when 3-10 roots are formed and the roots are about 3cm long, transplant them to nutrient soil to obtain the following results: Figure 1 Stable NtCLE23 overexpressing plants (NtCLE23-OE) are shown.

[0032] Comparative Example:

[0033] CRISPR gene editing vector construction process:

[0034] The gene editing vector used in this study is pDC45. The gRNA sequence is as follows:

[0035] gRNA-NtCLE23-F:tgcaTGGGTCTTCCAAGAGGAGAACTCCTACTGG

[0036] gRNA-NtCLE23-R:aaacCCAGTAGGAGTTCTCCTCTTGGAAGACCCA

[0037] A double-stranded gRNA with sticky ends was synthesized, and the pDC45 vector was linearized with BsaI. The linearized vector and the double-stranded gRNA were ligated by T4 to construct the NtCLE23 gene editing vector.

[0038] The tobacco genetic modification process was the same as in Example 1, and the following Figure 1 The stably expressed CRISPR gene-edited plant (NtCLE23-CRISPR) shown

[0039] like Figure 2 As shown, compared with the original CDS sequence, the NtCLE23 CDS of CRISPR gene-edited tobacco underwent a 3-base deletion, resulting in a frameshift mutation.

[0040] Effect verification:

[0041] To investigate the function of NtCLE23 gene in tobacco drought resistance, we subjected transgenic tobacco plants and wild-type tobacco WT (as control) plants to drought stress ( Figure 3 Before the drought treatment began, the growth status of the plants was kept consistent and the soil moisture content was kept consistent. No water was applied for 10 days and then rewatered. The total chlorophyll content of the plants was measured before and after the drought treatment for 10 days ( Figure 4 ), superoxide dismutase SOD, catalase CAT and peroxidase POD activities ( Figure 5 ) and other physiological and biochemical indicators.

[0042] Determination of total chlorophyll content: Remove surface dirt and midrib from tobacco leaves, weigh them, cut them into small pieces, and place them in a 50 mL centrifuge tube. Add an appropriate volume (depending on the weight of the leaf tissue, generally 20-40 mL) of anhydrous ethanol. Allow to stand overnight in the dark to allow chlorophyll a and chlorophyll b to fully dissolve in the anhydrous ethanol. Measure the absorbance of the chlorophyll extract at 665 nm and 649 nm using a spectrophotometer. Calculate the chlorophyll content according to the following formula:

[0043] Chlorophyll a = 13.95D 665 -6.88D 649

[0044] Chlorophyll b = 24.96D 649 -7.32D 665

[0045] Total chlorophyll content = (chlorophyll a + chlorophyll b) * anhydrous ethanol volume / leaf tissue weight

[0046] Superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) activities were detected using the Boxbio-AKAO001M-50S, Boxbio-AKAO003-2M, and Boxbio-AKAO005M kits, respectively.

[0047] from Figure 3As can be seen, NtCLE23-OE plants, NtCLE23-CRISPR plants, and wild-type tobacco (WT) plants had similar growth patterns before drought treatment. After 10 days of drought treatment, the lower leaves of all plants turned yellow and dried, while the remaining leaves shrank, curled, and wilted. However, NtCLE23-OE plants showed significantly better growth than wild-type tobacco (WT), while NtCLE23-CRISPR plants showed significantly worse growth than wild-type tobacco (WT). Two days after rehydration, the leaves of NtCLE23-CRISPR plants failed to return to normal growth. Both NtCLE23-OE and wild-type tobacco (WT) plants returned to a relatively upright growth pattern after rehydration, with NtCLE23-OE plants showing the best growth of their lower leaves.

[0048] from Figure 4 It can be seen that after 10 days of drought treatment, the total chlorophyll content of all plants decreased, but the total chlorophyll content of NtCLE23-OE plants was higher than that of wild-type plants WT and NtCLE23-CRISPR plants.

[0049] from Figure 5 As can be seen, before the onset of drought treatment, there were no significant differences in antioxidant enzyme activities among all plants. After 10 days of drought treatment, superoxide dismutase (SOD) and catalase (CAT) activities in NtCLE23-OE plants were higher than those in wild-type and NtCLE23-CRISPR plants, while peroxidase (POD) activity was lower than that in wild-type plants. We hypothesize that overexpression of the NtCLE23 gene may enhance the plant's ability to scavenge reactive oxygen species (ROS) under drought conditions by increasing SOD and CAT enzyme activities, thereby reducing ROS accumulation and improving the plant's drought tolerance.

[0050] Finally, it should be noted that while the above examples describe specific embodiments of the present invention, they are not intended to limit the present invention. Those skilled in the art will understand that these are merely illustrative and that the scope of the present invention is defined by the appended claims. All modifications or equivalent substitutions are intended to be included within the scope of the present invention. The raw materials in the above examples, unless otherwise specified, were commercially available.

Claims

1. Application of tobacco NtCLE23 gene in improving tobacco drought resistance, the gene sequence of which is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: By using the overexpression vector constructed by the tobacco NtCLE23 gene described in claim 1, an overexpression plant with improved tobacco drought resistance is obtained.

Citation Information

Patent Citations

  • Application of tobacco NtCLE9 gene in improvement of drought resistance of tobacco

    CN116622764A

  • Generating transgenic potatoes with novel resistance to potato cyst nematodes by silencing nematode parasitism genes of CLE -1 and CLE-4s

    US8569578B1