Soybean PISTILLATAD (PId) gene as well as knockout method and application thereof
The soybean PId gene was knocked out through CRISPR/Cas9 technology and a homozygous mutant was constructed, which solved the problem that the regulation gene for the main stem node number of soybean was not effectively explored, and achieved an increase in soybean production.
Patent Information
- Application Number
- CN202510227986.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-02-28
AI Technical Summary
The existing technology has not yet effectively explored the regulation gene for soybean main stem nodes, which has affected the increase in soybean production.
The soybean PId gene was specifically knocked out through CRISPR/Cas9 technology to construct PId homozygous mutants, and applied to create soybean germplasm resources with a large number of main stem nodes.
It has successfully verified that the soybean PId gene is involved in regulating the number of main stem nodes and the increase of soybean production through this technology, which has important agronomic application value.
Smart Images

Figure CN120060336A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to the soybean PISTILLATA d (PId) gene, its knockout method and application. Background Art
[0002] The number of nodes on the main stem of soybean is an important agronomic trait and a key factor directly affecting the yield per plant. The development process of the main stem of soybean can be divided into two stages: (1) Vegetative growth stage, leaf primordia are generated at both wings of the shoot apical meristem (SAM), and axillary meristems are generated in the leaf axils; (2) Reproductive growth stage, the apical / axillary meristems are transformed into inflorescence meristems (IM), and the inflorescence meristems differentiate into lateral floral meristems (FM), generating flower buds (Benlloch R, Berbel A, Serrano-Mislata A, et al. (2007) Floral Initiation and inflorescence architecture: a comparative view. Annals of Botany 100: 659-676.). Plant morphogenesis is determined by the properties and differentiation of meristems (Coen E S, Nugent J M. (1994) Evolution of flowers and inflorescences. Development Supplement 107-116.), and is jointly regulated and interacted by genes of vegetative shoot apical meristems, inflorescence meristems and floral meristems (Sussmilch F C, Berbel A, Hecht V, et al. (2015) Pea VEGETATIVE2 is an FD homolog that is essential for flowering and compound inflorescence development. Plant Cell 27: 1046-1060.). Terminal Flower 1 (TFL1) gene regulates the properties and differentiation of the shoot apical meristem and is an inhibitor of the developmental stage transition (Benlloch et al., 2007). In the Arabidopsis tfl1 mutant plants, the inflorescence meristems at the apex are prematurely transformed into floral meristems, and the indeterminate inflorescence is transformed into a determinate inflorescence (Shannon S and Meeks-Wagner D. (1991) A mutation in Arabidopsis TFL1 gene affects inflorescence meristem development. The Plant Cell 3: 877-892.).LEAFY (LFY) and APETALA1 (AP1) are meristem identity genes that determine the differentiation of floral meristems. At the same time, AP1 is also a regulatory gene for floral organ development, determining the differentiation of sepals and petals (Bowman, J.L., Alvarez, J., Weigel, D., et al. (1993) Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 119: 721-743.). In floral meristems, AP1 and LFY directly inhibit the expression of the TFL1 gene, maintaining the determinate growth habit of stems (Wagner D, Sablowski R W M, and Meyerowitz E M. (1999) Transcriptional activation of APETALA1 by LEAFY. Science 285: 582-584.; Kaufmann K, Wellmer F,. J M, et al. (2010) Orchestration of floral initiation by APETALA1. Science 328:85–89.). AP1 and LFY induce the expression of floral organ development genes AP2, PISTILLATA (PI), and AGAMOUS (AG), promoting flower development (Ratcliffe, O.J., Amaya, I., Vincent, C.A., et al. (1998). A common mechanism controls the life cycle and architecture of plants. Development 125:1609–1615.). It has been reported that the soybean homologs of TFL1 and AP1 are involved in regulating main stem development and yield formation (Yue L., Li X., Fang C., et al. (2021) FT5a interferes with the Dt1-AP1 feedback loop to control flowering time and shoot determinacy in soybean. Journal of Integrative Plant Biology 00:1-19.; Chen L., Nan H., Kong L., et al. (2020) Soybean AP1 homologs control flowering time and plant height. Journal of Integrative Plant Biology 62(12):1868-1879.). However, there are no reports on other meristem identity genes and floral organ development regulatory genes in main stem development and yield formation.
[0003] The gene editing technology mediated by the CRISPR / Cas9 system is an accurate, rapid, and highly efficient genome editing technology developed in recent years. In this system, the artificially designed target sequence is transcribed into a guiding gRNA in cells. Under the guidance of gRNA, the endonuclease Cas9 recognizes the target gene and cuts it, resulting in double-stranded DNA breaks. Thus, the cell initiates its self-repair mechanism, and base insertion, deletion mutations, or substitution mutations may occur during repair, thereby disrupting the function of the target gene. With the continuous improvement of the CRISPR / Cas9 technology, it has become simpler and faster to edit soybean genes, which is of great significance for exploring new genes regulating the number of main stem nodes in soybeans. Summary of the Invention
[0004] To overcome the deficiencies of the above-mentioned prior art, the present invention provides a method for specifically knocking out the soybean PId gene by CRISPR / Cas9 and its application in creating soybean germplasm resources with more main stem nodes.
[0005] To achieve the above object, the technical solution adopted by the present invention is:
[0006] The present invention provides the application of a mutant of the soybean PId gene in changing the plant type of soybean varieties and / or increasing the yield of soybean.
[0007] The present invention also provides the application of a mutant of the soybean PId gene in cultivating soybean varieties with more main stem nodes.
[0008] Preferably, the mutants of the soybean PId gene include a mutant with a 2bp deletion in the exon region of the PId gene and a mutant with a 33bp deletion in the exon region and a 13bp deletion in the intron of the PId gene.
[0009] Preferably, the mutants of the soybean PId gene are obtained by specifically knocking out the soybean PId gene using the CRISPR / Cas9 technology.
[0010] More preferably, the method for specifically knocking out the soybean PId gene using the CRISPR / Cas9 technology is as follows:
[0011] S1. Construct a Cas9gRNA vector pYLCRISPR / Cas9-PId-T1 inserted with the editing target site T1 of the soybean PId gene using the pYLCRISPR / Cas9 vector as the backbone, and transfect it into Agrobacterium competent cells. Select monoclonal colonies for PCR detection to confirm the successful transfer of pYLCRISPR / Cas9-PId-T1; the nucleotide sequence of the editing target site T1 of the soybean PId gene is as shown in SEQ ID No: 7;
[0012] S2. Infect soybean cotyledons with the selected positive monoclonal colonies, and screen plants resistant to Basta (glufosinate) to obtain T0 generation stable transformed plants;
[0013] S3. Extract the DNA of fresh leaves of T0 generation transgenic soybeans, amplify the plasmid backbone fragment, and screen positive lines;
[0014] S4. After harvesting the seeds of positive T0 generation plants, extract the leaf DNA of T1 generation plants, amplify the plasmid backbone fragment and the PId gene fragment, and then screen out the T1 generation stable homozygous pid mutants by agarose gel electrophoresis and PCR product sequencing.
[0015] Furthermore, the method for constructing the Cas9 gRNA vector pYLCRISPR / Cas9-PId-T1 with the soybean PId gene editing target site T1 inserted therein is as follows: After PCR amplification of the target primers shown in SEQ ID No: 8 and SEQ ID No: 9, enzymatic digestion and ligation are performed with the gRNA expression cassette, and then a complete expression cassette containing a promoter, a target site, and gRNA is constructed through two rounds of PCR. Then, the obtained gRNA expression cassette is ligated with the pYLCRISPR / Cas9 vector, and after transformation of Escherichia coli competent cells, positive clones of Escherichia coli are screened.
[0016] Furthermore, Bsa I and T4 DNA ligase are used for enzymatic digestion and ligation of the target primers with the gRNA expression cassette.
[0017] Furthermore, the adapter primers U-F and gRNA-R shown in SEQ ID No: 1 and 2 are used for the first round of PCR; the adapter primers B1 and BL shown in SEQ ID No: 3 and 4 are used for the second round of PCR; the sequencing primers SP1 and SP3 shown in SEQ ID No: 5 and 6 are used for screening positive clones of Escherichia coli.
[0018] Furthermore, the PCR amplification program for the target double-stranded linker is 90 °C for 30 s, followed by annealing at room temperature.
[0019] Furthermore, the plasmid backbone fragment is amplified using the detection primers SP1 and SP3 shown in SEQ ID No: 5 and 6, and the PId gene fragment is amplified using the detection primers shown in SEQ ID No: 12 and 13.
[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0021] The present invention uses the CRISPR / Cas9 technology to perform targeted editing on the soybean PId gene (Glyma.06G117600), successfully constructs a PId homozygous mutant, transforms Agrobacterium, stably transforms soybeans, and obtains PId homozygous mutant soybean plants. Verification of whether the soybean PId gene participates in regulating the number of main stem nodes in soybeans reveals that the soybean PId gene indeed participates in regulating the number of main stem nodes and is expected to be applied to the creation of soybean germplasm resources with more main stem nodes. At the same time, the present invention is also of great significance for creating germplasm resources through the CRISPR / Cas9 technology to change the plant type of soybean varieties and increase soybean yield. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Electrophoresis diagram for knockout vector construction;
[0023] Where A is the first-round and second-round PCR products of sgRNA expression cassette amplification, B is the electrophoresis map of colony PCR products of Escherichia coli DH5α, and M is the 2kb DNA ladder.
[0024] Figure 2 Schematic diagram of the Cas9 sgRNA expression vector inserted with the editing site T1; Schematic diagram of the Cas9 sgRNA expression vector, which is based on the pYLCRISPR / Cas9 vector backbone, carrying the herbicide (Bar) gene, Cas9 gene, AtU3d promoter, target T1 and an expression vector of sgRNA.
[0025] Figure 3 To detect the editing effect of the target in transgenic hairy roots; The products of amplifying transgenic hairy roots with the target detection primers were sequenced, and the peaks near the target were double peaks.
[0026] Figure 4 For the screening of T0 generation transgenic positive plants:
[0027] PCR products of the plasmid backbone fragment, and M is the 2kb DNA ladder.
[0028] Figure 5 For the screening of stable homozygous pid mutants in the T1 generation;
[0029] PCR product sequencing peak map of the PId gene fragment near the target.
[0030] Figure 6 For the phenotypic identification of stable homozygous pid soybean mutants (A is Yinchuan, B is Jingzhou). Specific implementation manners
[0031] The following further describes the specific implementation manners of the present invention. It should be noted here that the description of these implementation manners is used to help understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the various implementation manners of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0032] The experimental methods in the following examples are all conventional methods unless otherwise specified, and the test materials used in the following examples are all commercially available through conventional channels unless otherwise specified.
[0033] In the following examples, the description of the YLCRISPR / Cas9 vector can be referred to the literature: Ma X., Zhu Q., Chen Y., and Liu Y.-G. (2016). CRISPR / Cas9 platforms for genome editing in plants: developments and applications. Mol. Plant. doi:10.1016 / j.molp.2016.04.009. The description of the gRNA vector can be referred to the literature: Ma X., Zhu Q., Chen Y., and Liu Y.-G. (2016). CRISPR / Cas9 platforms for genome editing in plants: developments and applications. Mol. Plant. doi:10.1016 / j.molp.2016.04.009.
[0034] In order to explore whether the soybean PId gene (Glyma.06G117600) is involved in regulating the number of main stem nodes and other functions, the present invention constructs a Cas9 gRNA vector pYLCRISPR / Cas9-PId-T1 inserted with the editing target site T1 of the soybean PId gene using the pYLCRISPR / Cas9 vector as a backbone, transfects the competent cells of Agrobacterium tumefaciens K599, selects monoclonal colonies for PCR detection to confirm the successful transfer of pYLCRISPR / Cas9-PId-T1, then infects soybean cotyledons, extracts the hairy root DNA of soybean cotyledons, and identifies the editing efficiency of this editing site by PCR.
[0035] The following further details the process of exploring whether the soybean PId gene is involved in regulating the number of main stem nodes and other functions in combination with examples.
[0036] 1. Construction of the CRISPR / Cas9 knockout vector inserted with the editing target site T1 of the soybean PId gene
[0037] 1.1. Sources of main reagents and materials
[0038] Escherichia coli (E. coli) DH5α, gRNA vector, and pYLCRISPR / Cas9 vector are all stored in our laboratory. The endotoxin-free plasmid extraction kit was purchased from CW Biotech Co., Ltd.; the agarose gel recovery kit was purchased from TransGen Biotech Co., Ltd.; KOD Plus Neo enzyme, Master Taq mix, restriction endonuclease Bsa I, T4 DNA ligase, CutSmart Buffer, kanamycin, spectinomycin, and DNAmaker were all purchased from TaKaRa Co., Ltd.; sequencing and primer synthesis were commissioned to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. to complete.
[0039] Adapter primers:
[0040] U-F: 5’CTCCGTTTTACCTGTGGAATCG 3’ (SEQ ID No: 1);
[0041] gRNA-R: 5’CGGAGGAAAATTCCATCCAC 3’ (SEQ ID No: 2);
[0042] B1: 5’TTCAGAGGTCTCTctcgACTAGTGGAATCGGCAGCAAAGG 3’ (SEQ ID No: 3);
[0043] BL: 5’AGCGTGGGTCTCGaccgACGCGTCCATCCACTCCAAGCTC 3’ (SEQ ID No: 4);
[0044] Sequencing primers:
[0045] SP1: 5’GTCGTGCTCCACATGTTGACC 3’ (SEQ ID No: 5);
[0046] SP3: 5’TGCAATAACTTCGTATAGGCT 3’ (SEQ ID No: 6).
[0047] 1.2. Design of target primers
[0048] According to the Phytozome database (Phytozome (doe.gov)) and NCBI database ( https: / / www.ncbi.nlm.nih.gov / )The gene sequences of PId (Glyma.06G117600) in two databases were used to design target sites on the CRISPRdirect (http: / / crispr.dbcls.jp) website. A 23-bp target sequence Target1 (CCTCTGGGATGCTAAGCATGAGG, SEQ ID No: 7) (located in the 398-420 bp interval of the PId gene) was found on the first exon of PId. Target primers were designed according to the target sequence.
[0049] Target primers:
[0050] 5’GTCACCTCATGCTTAGCATCCCAG 3’ (SEQ ID No: 8);
[0051] 5’AAACCTGGGATGCTAAGCATGAGG 3’ (SEQ ID No: 9).
[0052] 1.3. Operation steps (1) Ligation and amplification of target adapter and gRNA expression cassette
[0053] ① Amplification of target double-stranded adapter: The forward and reverse target primers were added to 0.5×TE and mixed to a concentration of 100 μmol / L. Then, 1 μL of each of the forward and reverse primers was added to a PCR tube, and ddH 2 O was added to 100 μL and PCR was carried out. The PCR program was 90°C for 30 s, followed by annealing at room temperature.
[0054] ② Enzymatic ligation of double-stranded adapter and gRNA expression cassette: A 10 μL enzymatic ligation reaction system was prepared: 2 μL of 10 ng / μL gRNA vector, 0.5 μL of 100 μmol / L target double-stranded adapter, 0.5 μL of Bsa I (10 U / μL), 0.2 μL of T4 DNA ligase, 1 μL of 10×NEB T4 DNA ligase buffer, 1 μL of 10×NEB Cut Smart Buffer, and 4.8 μL of ddH 2 O. The PCR program was: 37°C for 5 min, 20°C for 5 min, for a total of 5 cycles.
[0055] ③ Two rounds of PCR:
[0056] The first round of PCR to amplify the gRNA expression cassette:
[0057] A 15 μL PCR reaction system was prepared: 2 μL of the PCR product from the second step, 0.3 μL of high-fidelity enzyme KOD Plus Neo, 1.5 μL of KOD Plus Neo Buffer, 0.6 μL of MgSO4 , 1.5 μL dNTPs, 0.2 μL of 10 μmol / L U-F, 0.2 μL of 10 μmol / L gRNA-R, and ddH 2 O was made up to 15 μL. The PCR program was as follows: 95°C for 2 min; 10 cycles - 95°C for 15 s, 55°C for 15 s, 68°C for 10 s; 20 cycles - 95°C for 15 s, 60°C for 15 s, 68°C for 10 s, and hold at 16°C. 1% agarose gel electrophoresis was performed to check if there was a target band around 500 bp.
[0058] In the second round of PCR, the gRNA with the target site (i.e., the product of the previous round of PCR) was ligated with a specific adapter to construct a complete expression cassette containing a promoter (Ma X., Zhu Q., Chen Y., and Liu Y.-G. (2016). CRISPR / Cas9 platforms for genome editing in plants: developments and applications. Mol. Plant. doi:10.1016 / j.molp.2016.04.009.), the target site, and the gRNA:
[0059] Prepare a 20 μL reaction system: 2 μL of KOD Plus Neo Buffer, 2 μL of dNTPs Mix, 0.4 μL of KOD Plus Neo, 0.15 μL of Primer B1, 0.15 μL of Primer BL, 1 μL of a 10-fold dilution of the product of the first round of PCR, and make up to 20 μL with sterile water. The PCR program was: 95°C for 2 min, 28 cycles (95°C for 10 s, 58°C for 15 s, 68°C for 20 s), and hold at 16°C. 1% agarose gel electrophoresis was performed to check if there was a 500 bp band, and the target band was recovered.
[0060] (2) Ligation of the gRNA expression cassette with the pYLCRISPR / Cas9 vector
[0061] Prepare a 15 μL reaction system: 1.5 μL of Cut Smart Buffer, 0.5 μL of CRISPR / Cas9 plasmid, 1 μL of BsaI, add the purified product from the previous step to ensure its concentration is 60 - 70 ng / μL, and make up to 15 μL with ddH 2 O. The PCR program was: 37°C for 5 min, 10°C for 5 min, 20°C for 5 min, 37°C for 5 min, for a total of 15 cycles.
[0062] (3) Transformation of Escherichia coli competent cells
[0063] Add 10 μL of the ligation reaction solution from the previous step to Escherichia coli competent cells DH5α, incubate on ice for 30 min, heat shock at 42 °C for 30 s, incubate on ice for 2 min, then add 500 μL of LB culture medium in a laminar flow hood and incubate at 37 °C with shaking at 220 rpm for 1 hour. Then spread it on LB solid medium containing spectinomycin (Table 1) and culture it in an incubator at 37 °C for 12 hours.
[0064] (4) Screening of positive E. coli clones
[0065] Prepare a 10 μL reaction system: 5 μL of Master Taq mix, 0.2 μL each of primers SP1 and SP3, 4.6 μL of sterile water, and a small amount of colonies. Then perform PCR according to the program: 95 °C for 2 min; 35 cycles (95 °C for 30 s, 58 °C for 30 s, 72 °C for 90 s); 72 °C for 2 min. Then perform 1% agarose gel electrophoresis to check if a target band of about 500 bp appears. Finally, select positive clones for sequencing and extract plasmids from the positive clones with correct sequencing ( Figure 1 、 2 ).
[0066] Table 1 Medium formula
[0067]
[0068]
[0069] Note: "-" means no addition is required.
[0070] 2. Root hair transformation and detection of target editing efficiency
[0071] 2.1. Sources of main reagents and materials
[0072] The soybean variety is cultivated soybean (Glycine max L. Merrill) Willams82 (W82), and the hairy root-inducing Agrobacterium rhizogenes K599 is preserved in our laboratory (or can be purchased from Weidi Biotechnology). Kanamycin, rifampicin, spectinomycin, and DNAmaker are all purchased from TaKaRa Company. Yeast extract, agarose, MES, DMSO, sodium chloride, and other common reagents are mostly domestic analytical grade. The DNA extraction kit is purchased from Kangwei Century Company; sequencing and primer synthesis are entrusted to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.
[0073] Target detection primers:
[0074] T1-F: 5’TGCTCAAGTTTCCCTTATCATCT 3’ (SEQ ID No: 10);
[0075] T1-R: 5’CACTAGATCTGGCTGTATAGCTT 3’ (SEQ ID No: 11).
[0076] 2.2. Operation steps
[0077] (1) In vitro hairy root transformation of soybean
[0078] Transform the competent cells of Agrobacterium tumefaciens K599 with the plasmid pYLCRISPR / Cas9-PId-T1. After culturing at 28 °C for two days, perform colony PCR detection and screen positive monoclonal colonies. In addition, disinfect the soybean Willam82 seeds with 10% H 2 O 2 Disinfect the seed surface for 1 min and rinse it thoroughly with sterile deionized water. Then sow the disinfected seeds in the germination medium (Table 1) and culture them in a soybean artificial climate chamber for one week (12 hours of light, 12 hours of darkness). Then incubate the Agrobacterium rhizogenes K599 containing the target plasmid at 28 °C until the OD is about 0.6. After that, dip a scalpel into the bacterial solution and draw a grid on the front of the soybean cotyledons. Then place the cotyledons on the rooting medium and transfer them to the soybean artificial climate chamber for culturing for about 15 days.
[0079] (2) Detection of target editing efficiency
[0080] After hairy roots grow from the soybean cotyledon callus, extract the DNA of the hairy roots and amplify the PId gene fragment. The amplification reaction system (30 μL) is: 15 μL Master Taq mix, 2 μL T1-F primer, 2 μL T1-R primer, 10 μL sterile water, 1 μL DNA template. The PCR program is: 95 °C for 2 min; 35 PCR cycles (95 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min); finally 72 °C for 2 min. Sequence the PCR products and calculate the editing efficiency of the target according to the sequencing results. The sequencing results show that there are double peaks from the target site backwards, indicating that the designed target can effectively edit the coding region of the PId gene, and the editing efficiency of the target is 50% ( Figure 3 ).
[0081] 3. Creation of PId stable homozygous soybean mutants
[0082] 3.1. Sources of main reagents and materials
[0083] The soybean variety is the cultivated soybean (Glycine max L. Merrill) Willams82 (W82), and the Agrobacterium EHA101 is preserved in our laboratory (it can also be purchased from Vidi Biotechnology). Basta is purchased from Coolaber, and kanamycin, rifampicin, spectinomycin, and DNAmaker are all purchased from TaKaRa. Yeast extract, agarose, MES, DMSO, sodium chloride, and other common reagents are mostly of domestic analytical grade. The DNA extraction kit is purchased from ComWin Biotech Co., Ltd.; sequencing and primer synthesis are commissioned to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. to complete.
[0084] Scaffold detection primers:
[0085] SP1: 5’GTCGTGCTCCACATGTTGACC 3’ (SEQ ID No: 5);
[0086] SP3: 5’TGCAATAACTTCGTATAGGCT 3’ (SEQ ID No: 6).
[0087] Target detection primers:
[0088] T1-F: 5’TGCTCAAGTTTCCCTTATCATCT 3’ (SEQ ID No: 10);
[0089] T1-R: 5’CACTAGATCTGGCTGTATAGCTT 3’ (SEQ ID No: 11).
[0090] 3.2. Operating steps
[0091] (1) Stable transformation of soybean
[0092] Transform the competent cells of Agrobacterium EHA101 with the pYLCRISPR / Cas9-PId-T1 plasmid. After culturing at 28°C for two days, perform colony PCR detection using primers SP1 and SP3 to screen for positive monoclonal colonies. Then sow the disinfected soybean Willams82 (W82) seeds in the germination medium, and after culturing in the soybean artificial climate chamber for 3 days, take the cotyledon nodes as explants for Agrobacterium infection. After going through processes such as co-culture, shoot induction, shoot elongation, and rooting culture, screen the plants resistant to Basta (glufosinate) to obtain T0 generation stable transformed plants.
[0093] (2) Screening of T0 generation transgenic positive plants
[0094] Extract the DNA of fresh leaves of T0 generation transgenic soybeans and amplify the plasmid backbone fragment. The amplification reaction system (10 μL) is as follows: 5 μL Master Taq mix, 0.2 μL each of primers SP1 and SP3, 3.6 μL sterile water, and 1 μL DNA template. The PCR program is: 95°C for 2 min; 35 cycles (95°C for 30 s, 58°C for 30 s, 72°C for 90 s); 72°C for 2 min. Then, perform 1% agarose gel electrophoresis to check whether a target band of about 500 bp appears. The results show that the 2nd and 4th lines are positive lines, and the 1st, 3rd, 5th, 6th, and 7th lines are negative lines( Figure 4 ).
[0095] (3) Screening of stable homozygous pid mutants in T1 generation
[0096] After harvesting the seeds of the above positive T0 generation plants, extract the leaf DNA of T1 generation plants, amplify the plasmid backbone fragment using primers SP1 and SP3, and amplify the PId gene fragment using primers T1-F and T1-R. Then, perform 1% agarose gel electrophoresis and PCR product sequencing. The results show that homozygous lines of soybean PId without the cas9 backbone have been obtained. Among them, the exon region of the 2nd line is deleted by 2 bp (CC, at the 233-234 bp site of the PId gene), named pid-1; the exon region of the 4th line is deleted by 33 bp (TCTGGGAAGACCCTCTGGGATGCTAAGCATGAG (SEQ ID No: 12), at the 223-255 bp site of the PId gene), and the intron is deleted by 13 bp (GTAGGGTTTTTTA (SEQ ID No: 13), at the 256-268 bp site of the PId gene), named pid-2( Figure 5 ).
[0097] 4. Phenotypic identification of stable homozygous soybean mutants of PId
[0098] Plant the homozygous pid mutants pid-1, pid-2 and the control Williams82 (W82) plants in the Yinchuan soybean field test base (106°8′29.436″E, 38°29′50.352″N; natural long-day conditions) and the Jingzhou soybean field test base (111°45′4.6″E, 30°10′30.3″N; natural short-day conditions). At maturity, count the number of nodes and yield phenotypes. The results show that the number of nodes of pid-1 and pid-2 is increased compared with W82, and the yield is increased( Figure 6 ).
[0099] In summary, the soybean PId gene can regulate the number of nodes on the main stem of soybeans and is expected to be applied to the creation of soybean germplasm resources with a larger number of nodes on the main stem, which is also of great significance for creating germplasm resources through the CRISPR / Cas9 technology to change the plant type of soybean varieties and increase soybean yield.
[0100] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.
Claims
1. Application of soybean PId gene mutants in changing the plant type of soybean varieties and / or increasing soybean yield.
2. Application of soybean PId gene mutants in breeding soybean varieties with more main stem nodes.
3. The use according to claim 1 or 2, characterized in that: The mutants of the soybean PId gene include a mutant with a 2bp deletion in the exon region of the PId gene and a mutant with a 33bp deletion in the exon region of the PId gene and a 13bp deletion in the intron.
4. The use according to claim 1 or 2, characterized in that: The mutant of the soybean PId gene is obtained by specifically knocking out the soybean PId gene using CRISPR / Cas9 technology.
5. The use according to claim 4, characterized in that: The method for specifically knocking out the soybean PId gene using CRISPR / Cas9 technology is as follows: S1. Using the pYLCRISPR / Cas9 vector as a backbone, construct a Cas9gRNA vector pYLCRISPR / Cas9-PId-T1 inserted with the soybean PId gene editing target site T1, and transfect it into Agrobacterium competent cells, select single clones for PCR detection to confirm that pYLCRISPR / Cas9-PId-T1 is successfully transferred; the nucleotide sequence of the soybean PId gene editing target site T1 is shown in SEQ ID No: 7; S2, using the screened positive monoclonal to infect soybean cotyledons, screen for plants with Basta resistance, and obtain T0 generation stable transformed plants; S3, extracting DNA from fresh leaves of T0 generation transgenic soybeans, amplifying plasmid backbone fragments, and screening positive strains; S4. After harvesting seeds from the positive T0 generation plants, extract DNA from the leaves of the T1 generation plants, amplify the plasmid backbone fragment and the PId gene fragment, and then screen out the T1 generation stable homozygous pid mutants through agarose gel electrophoresis and PCR product sequencing.
6. The use according to claim 5, characterized in that: The method for constructing a Cas9gRNA vector pYLCRISPR / Cas9-PId-T1 inserted with the soybean PId gene editing target site T1 is as follows: after PCR amplification of the target primers shown in SEQ ID No: 8 and SEQ ID No: 9, restriction digestion and ligation with the gRNA expression cassette, two rounds of PCR are performed to construct a complete expression cassette containing a promoter, a target site and a gRNA, and then the obtained gRNA expression cassette is ligated with the pYLCRISPR / Cas9 vector, and Escherichia coli competent cells are transformed and Escherichia coli positive clones are screened.
7. The use according to claim 6, characterized in that: BsaI and T4 DNA ligase were used to digest and ligate the target primer and gRNA expression cassette.
8. The use according to claim 6, characterized in that: The first round of PCR was performed using the linker primers UF and gRNA-R shown in SEQ ID Nos: 1 and 2; the second round of PCR was performed using the linker primers B1 and BL shown in SEQ ID Nos: 3 and 4; and the sequencing primers SP1 and SP3 shown in SEQ ID Nos: 5 and 6 were used to screen the positive clones of Escherichia coli.
9. The use according to claim 6, characterized in that: The PCR amplification program for the target double-stranded adapter was 90°C for 30 s, followed by cooling and annealing at room temperature.
10. The use according to claim 6, characterized in that: The plasmid backbone fragment was amplified using the detection primers SP1 and SP3 shown in SEQ ID Nos: 5 and 6, and the PId gene fragment was amplified using the detection primers shown in SEQ ID Nos: 12 and 13.
Citation Information
Patent Citations
Method to produce sterile male flowers and partenocarpic fruits by genetic silencing, associated sequences and vectors containing said sequences
CN101275139A
Rubber tree flower organ characteristic factor gene and encoded product and application thereof
CN108165553A
Application of protein GmFULa in regulating soybean plant type and yield
CN111440231A
Application of BnaSVP gene in regulation and control of rape flowering stages and preparation method of rape mutant materials with different flowering stages
CN112608930A
Application of GmTPS2 protein and coding gene thereof in improvement of soybean plant type and yield traits
CN117947091A