Application of cotton gene GhNUP160 in regulating Verticillium wilt resistance

Abstract

The present invention discloses the application of a cotton gene GhNUP160 in regulating Verticillium wilt resistance. The gene ID of the cotton gene GhNUP160 is Gh_D11G308200.3, and its nucleotide sequence is shown in SEQ ID No. 1. Gene-silenced plants were obtained by VIGS technology. The disease index of the silenced plants increased under the stress of Verticillium dahliae, and their resistance to Verticillium wilt decreased. The results show that GhNUP160 the gene plays a role in plant disease resistance, and the present invention provides good gene resources for cotton disease resistance research.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and particularly relates to an application of a cotton gene GhNUP160 in regulating Verticillium wilt resistance. Background Art

[0002] Cotton ( Gossypium hirsutum L. ), an annual herbaceous plant or perennial shrub plant of the genus Gossypium in the family Malvaceae, is an important fiber crop in the world, providing important natural plant fibers, oil, and feed protein for people's lives. Cotton Verticillium wilt ( Verticillium wilt ) is a soil-borne vascular disease caused by Verticillium dahliae ( Verticillium dahliae Kleb. ), which can infect a variety of vegetables, fruits, and other economic crops. Verticillium wilt is also one of the most harmful and widespread plant diseases in the world's cotton-producing areas. Due to its special pathogenic mechanism, no effective control method has been developed yet, posing a serious threat to the sustainable development of cotton production.

[0003] After cotton is infected by Verticillium dahliae, it will induce a series of defense genes, including the expression of genes such as hormones, reactive oxygen species, kinases, and secondary metabolites, and then trigger a series of defense reactions, causing changes in the types and contents of resistance-related physiological and biochemical substances to play a resistance role, and realizing the resistance of host cotton to pathogens. The gene ID of the cotton gene GhNUP160 is Gh_D11G308200.3. The full length of the CDS of this gene is 4461bp, and the encoded protein is a nuclear pore complex protein, which may play a role in the transport of resistance substances produced by plants. Studying GhNUP160 the function of the gene can provide new gene resources for cotton resistance breeding. Summary of the Invention

[0004] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide a new application of a cotton gene GhNUP160 in regulating Verticillium wilt resistance, and to expand the application scope of the gene GhNUP160 in resisting Verticillium wilt.

[0005] The technical solution of the present invention is as follows:

[0006] First aspect: The present invention discloses an application of the encoded protein of the cotton gene GhNUP160 gene 、GhNUP160 or an expression cassette or recombinant plant expression vector containing 、 gene in regulating cotton Verticillium wilt resistance, and the CDS sequence of the cotton gene GhNUP160 is as shown in SEQ ID No.1. GhNUP160 Preferably, the application is to improve the cotton gene

[0007] ​GhNUP160 Expression level, thus improving the resistance of cotton to Verticillium wilt.

[0008] Cotton gene GhNUP160 Gene 、GhNUP160 Coding protein of the gene 、 Or containing GhNUP160 Application of the gene expression cassette or recombinant plant expression vector in cultivating cotton varieties resistant to Verticillium wilt.

[0009] Second aspect: The present invention also discloses a method for improving the resistance of cotton to Verticillium wilt, by increasing GhNUP160 the expression level of the gene, and the CDS sequence of the cotton gene GhNUP160 is shown in SEQ ID No.1.

[0010] The advantages and positive effects of the present invention are:

[0011] Using VIGS technology to obtain gene-silenced cotton plants, through Verticillium dahliae stress treatment, the tolerance of the silenced plants to Verticillium dahliae is significantly reduced. The above results all indicate that GhNUP160 the gene plays a positive role in the process of plants resisting Verticillium wilt. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required to be used in the embodiments. It should be understood that the following drawings only show the embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.

[0013] Figure 1 is the TRV provided by the embodiment of the present invention: GhNUP160 Silencing efficiency and expression level of the target gene in the silenced plants;

[0014] Figure 2 is the TRV provided by the embodiment of the present invention: GhNUP160 Silenced cotton plants. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0015] The methods used in the following embodiments are all conventional methods unless otherwise specified.

[0016] The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0017] Example 1 Verification using VIGS GhNUP160 Role in cotton's resistance to Verticillium dahliae stress

[0018] Total RNA was extracted from semi-wild cotton Marie Galante 1844 (from the National Wild Cotton Germplasm Repository). After removing gDNA with DNase I, it was reverse transcribed into cDNA and used as a template for amplifying genes. Specific primers were used for PCR amplification to construct a VIGS gene silencing vector. Through the forward primer VIGS-nupF: aaggttaccgaattc tctaga GACAATGGTGGGTTCGCTCC (the underlined part is the recognition site of the restriction enzyme Xba I) and the reverse primer VIGS-nupR: cgtgagctcggtacc ggatcc CGGAGATAGTTACGGTATAAAGCAAG (the underlined part is the recognition site of the restriction enzyme BamH I) for amplifying GhNUP160 the gene fragment. The VIGS fragment was ligated into the pTRV2 vector digested with Xba I and BamH I using homologous recombinase. The constructed TRV: GhNUP160 gene silencing vector was transformed into Agrobacterium tumefaciens GV3103. Using TRV:00 Agrobacterium as a negative control and TRV:PDS Agrobacterium as a positive control, after adjusting the OD 600 value of the Agrobacterium solution to 1.5, an Agrobacterium infiltration experiment on cotton leaves was carried out.

[0019] Semi-wild cotton Marie Galante 1844 was used as the VIGS injection material. The seeds of Marie Galante 1844 were planted in bottomless paper pots and placed in a greenhouse, growing under the conditions of 28 °C, 16 h light / 8 h dark. When the two cotyledons of the seedlings were flat, VIGS injection was carried out. The back of the cotyledon was gently scratched with a syringe needle, and the bacterial solution was injected into the whole cotyledon. After injection, it was cultured in the dark for 24 h, and then transferred to normal conditions for cultivation. After the plant grew three true leaves, it was treated with Verticillium dahliae stress.

[0020] Example 2 Phenotypic Identification of Gene-Silenced Cotton against Verticillium dahliae Infection

[0021] TRV:00 and TRV: GhNUP160 were subjected to Verticillium dahliae inoculation treatment. Samples were taken at 0 h, 6 h, 12 h, 24 h, and 48 h respectively to detect the silencing efficiency at 0 h and the relative expression levels at each time. The results are as Figure 1 shown. The results showed that GhNUP160 the disease resistance of cotton plants decreased after gene silencing.

[0022] The present invention compared the resistance of wild-type Marie Galante 1844 and GhNUP160 gene-silenced plants after inoculation with Verticillium dahliae. Figure 1In [description], A is the plant inoculated with Verticillium dahliae and successfully silenced for the GhNUP160 gene, and its resistance to Verticillium wilt is significantly reduced compared to the plant without gene silencing. Figure 2 In [description], B is the positive control plant treated with Verticillium dahliae, providing a reference standard for the resistance phenotype of gene-silenced plants. Figure 2 In the virus-induced gene silencing (VIGS) experiment, C is the positive control plant of the PDS gene, serving as an indicator to measure the virus vector infection efficiency and gene silencing effect. The results show that the leaves of the gene-silenced plants under Verticillium wilt stress turn yellow and begin to wilt, and it can be found that the resistance to Verticillium wilt is significantly weakened, indicating that this gene plays a positive role in the plant's resistance to Verticillium dahliae.

[0023] GhNUP160 Nucleotide sequence of the gene:

[0024]

[0025] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of cotton gene GhNUP160 in regulating Verticillium wilt resistance of cotton, wherein the cotton gene GhNUP160 has a CDS sequence shown in SEQ ID No.1, and the regulation is to reduce GhNUP160 the expression level of the gene to reduce the Verticillium wilt resistance of cotton, and the pathogen of the cotton Verticillium wilt is Verticillium dahliae ( Verticillium dahliae Kleb. ).

2. Application of cotton gene GhNUP160 in cultivating cotton varieties resistant to Verticillium wilt, where the cotton gene GhNUP160 has a CDS sequence as shown in SEQ ID No.1, and reducing the GhNUP160 expression level of the gene reduces the resistance of cotton to Verticillium wilt, and the pathogen of the cotton Verticillium wilt is Verticillium dahliae ( Verticillium dahliae Kleb. ).

Images