Method for cultivating salt-resistant and drought-resistant composite stress plant by knocking out GmNARK

Abstract

The invention discloses a method for cultivating a salt-tolerant and drought-tolerant composite stress plant by knocking out GmNARK, which comprises a kit, the kit is used for operating specific molecular biology of a target gene, and the method specifically comprises the following steps: (1) determining the target gene: the target gene comprises: a. A soybean source gene with a gene number of Glyma. 12G040000, b. A plant source gene with a gene number of GmNARK, c. A plant source gene with a gene number of GmNARK, c. A plant source gene with a gene number of GmNARK, and d. A plant source gene with a gene number of GmNARK; b. A gene having the same or corresponding biological functions as the gene a, and also comprising a known gene or a newly identified unknown gene; and (2) carrying out specific molecular biological operation, namely increasing or reducing the expression quantity of the target gene. According to the method for cultivating the salt-resistant and drought-resistant composite stress plant by knocking out the Glyma. 12G040000, the transgenic plant is obtained by transforming a receptor soybean plant by using the constructed knockout vector, and the biomass of the soybean under the drought-resistant and salt-resistant composite stress can be remarkably promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a method for cultivating plants resistant to salt and drought combined stress by knocking out GmNARK. Background Art

[0002] Soybean is an important oil and grain cash crop and a major source of plant protein. However, the current soybean production in China only accounts for a small part of the world's total output, far from meeting the domestic demand for soybeans. Drought and salt are two major abiotic stresses that inhibit plant growth and reduce yields. Due to global climate change, in many places, especially in arid or semi-arid regions, drought and salt stresses are becoming increasingly severe. Arid or semi-arid regions account for nearly half of the earth's land area, and if there is irrigation water, the crop yields in these regions are very high. It is reported that 20%-50% of the irrigated arable land is affected by salt.

[0003] It is predicted that by 2050, about half of the world's arable land will be salinized, and most of these regions are arid or semi-arid regions with little precipitation and large transpiration. In coastal, arid and semi-arid regions, after the soil moisture evaporates, the salt accumulates in the soil, resulting in the coexistence of drought and salt, causing a combined stress of drought and salt. Cultivating drought- and salt-tolerant soybean varieties and making use of this part of the arable land can greatly increase China's soybean production and alleviate China's dependence on imported soybeans.

[0004] Analyzing the mechanism of regulating soybean salt tolerance at the molecular level lays an important foundation for more reasonable and efficient utilization of saline-alkali soil in production. Although genes such as GmCHX1, GmCDF1, and GsERD15B have been reported to be involved in regulating soybean salt tolerance, the gene expression regulating drought and salt combined stress is relatively rare. Therefore, exploring genes for soybean salt and drought combined stress can provide data support for more fully utilizing saline-alkali soil in production.

[0005] Therefore, the key to the technical solution of the present invention is to provide a new method for cultivating salt- and drought-tolerant plants by down-regulating the expression of GmNARK to solve the above technical problems. Summary of the Invention

[0006] In view of this, the present invention provides a method for cultivating plants resistant to salt and drought combined stress by knocking out GmNARK.

[0007] To solve the above technical problems, the present invention adopts the following technical solutions:

[0008] A method for cultivating plants resistant to salt and drought combined stress by knocking out GmNARK, including: a kit, which operates on the specific molecular biology of the target gene, and specifically includes the following steps:

[0009] (1) Determine the target gene:

[0010] The target gene includes:

[0011] a. A soybean-derived gene with the gene number Glyma.12G040000;

[0012] b. Genes having equivalent or corresponding biological functions to gene a, including known genes or newly identified unknown genes;

[0013] (2) Perform specific molecular biology operations:

[0014] Including increasing or decreasing the expression level of the target gene.

[0015] Preferably, the kit contains the necessary genetic engineering components for reducing the expression level of the target gene or silencing the target gene.

[0016] Preferably, the necessary genetic engineering components are selected from one or any combination of template DNA, primers, enzymes, recombinant expression vectors, buffer solutions, and infection vectors.

[0017] Preferably, the recombinant expression vector is a knockout vector containing the Guide RNA site of the target gene, and the knockout vector uses pBSE401 as the backbone vector.

[0018] Preferably, the method for a crop to tolerate salt is to reduce the expression of the target gene in the crop through genetic engineering operations, or knockout the target gene in the crop genome, and obtain transgenic plants with increased survival rate and above-ground biomass under drought conditions compared with the wild control.

[0019] Preferably, the method for reducing or knocking out the expression of the target gene in the crop is specifically as follows:

[0020] (a) Construct a knockout vector containing the Guide RNA site of the target gene;

[0021] (b) Use the knockout vector to construct a transformant, then use the transformant to infect the target plant, screen positive plants, and obtain transgenic plants with increased survival rate and biomass under salt and combined salt and drought stress conditions compared with the wild control.

[0022] Preferably, the method for improving the resistance of the crop to combined salt and drought stress is to reduce the expression of the target gene in the crop through genetic engineering operations, or knockout the target gene in the crop genome, and obtain transgenic plants with increased survival rate and biomass under combined drought and salt stress conditions compared with the wild control.

[0023] Preferably, the transformant is obtained by transforming Agrobacterium tumefaciens EHA101 with the knockout vector.

[0024] Preferably, the transgenic plants are obtained by the method of stable soybean transgenic mediated by Agrobacterium EHA101. Positive plants are screened to obtain transgenic plants with increased survival rate and biomass under salt and combined salt and drought stress compared with the wild control.

[0025] Preferably, the crop is soybean.

[0026] The present invention has achieved the following technical effects compared with the prior art:

[0027] The method for cultivating plants resistant to combined salt and drought stress by knocking out Glyma.12G040000 provided by the present invention obtains transgenic plants by transforming receptor soybean plants with the constructed knockout vector, and can significantly promote the biomass of soybean under combined drought and salt stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a schematic diagram of Bragg and Gmnark of the present invention under normal growth (CK), 20-day salt treatment condition and 20-day salt and drought treatment condition;

[0029] Figure 2 It is a survival rate diagram of Bragg and Gmnark of the present invention under 20-day salt and drought treatment condition;

[0030] Figure 3 It is a survival rate diagram of Bragg and Gmnark of the present invention under 20-day salt treatment condition. DETAILED DESCRIPTION OF THE INVENTION

[0031] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0032] As Figures 1-3 shown, the present invention discloses a method for cultivating plants resistant to combined salt and drought stress by knocking out GmNARK, including: a kit, which operates on the specific molecular biology of the target gene, and specifically includes the following steps:

[0033] (1) Determine the target gene:

[0034] The target gene includes:

[0035] a. A soybean-derived gene with the gene number Glyma.12G040000;

[0036] b. Genes with equivalent or corresponding biological functions to the a gene also include known genes or newly identified unknown genes;

[0037] (2) Perform specific molecular biology operations:

[0038] Include increasing or decreasing the expression level of the target gene.

[0039] The kit contains the necessary genetic engineering components for reducing the expression level of the target gene or silencing the target gene; the necessary genetic engineering components are selected from one or any combination of template DNA, primers, enzymes, recombinant expression vectors, buffer solutions, and infection vectors.

[0040] The recombinant expression vector is a knockout vector containing the Guide RNA site of the target gene, and the knockout vector uses pBSE401 as the backbone vector.

[0041] The method for crop salt tolerance is to reduce the expression of the target gene in the crop through genetic engineering operations or knockout the target gene in the crop genome to obtain transgenic plants with increased survival rate and aboveground biomass under drought conditions compared with the wild control.

[0042] The method for reducing or knocking out the expression of the target gene in the crop is as follows:

[0043] (a) Construct a knockout vector containing the Guide RNA site of the target gene;

[0044] (b) Use the knockout vector to construct a transformant, then use the transformant to infect the target plant, screen positive plants, and obtain transgenic plants with increased survival rate and biomass under salt and combined salt and drought stress compared with the wild control.

[0045] The method for improving the resistance of crops to combined salt and drought stress is to reduce the expression of the target gene in the crop through genetic engineering operations or knockout the target gene in the crop genome to obtain transgenic plants with increased survival rate and biomass under combined drought and salt stress compared with the wild control.

[0046] The transformant is obtained by transforming Agrobacterium tumefaciens EHA101 with the knockout vector.

[0047] The transgenic plants are obtained by the Agrobacterium tumefaciens EHA101-mediated stable soybean transgenic method, screen positive plants, and obtain transgenic plants with increased survival rate and biomass under salt and combined salt and drought stress compared with the wild control.

[0048] The crop is soybean.

[0049] Example 1:

[0050] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0051] Gene naming: The constructed knockout vector can mutate the Glyma.12G040000 gene in soybean.

[0052] Example 2:

[0053] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0054] Design of target site adapter primers:

[0055] Using the CRISPR-Cas9 technology to implement the knockout of the Glyma.12G040000 gene, the primer structures are as follows

[0056] DT1-BsF: ATATATGGTCTCGATTGCTGAGATTTCCGGCGAATCGTT;

[0057] DT1-F0: TGCTGAGATTTCCGGCGAATCGTTTTAGAGCTAGAAATAGC;

[0058] DT2-R0:

[0059] AACGGAAAGAGTGAGAATCCCCCAATCTCTTAGTCGACTCTAC;

[0060] DT2-BsR: ATTATTGGTCTCGAAACGGAAAGAGTGAGAATCCCCCAA;

[0061] Specifically, determine the gDNA sequence of the Glyma.12G040000 gene, perform sgRNA search, predict available target sites, and select the sgRNA with the highest score and located in the exon region of the gene for primer design according to the score of sgRNA and the position and probability of off-target. Replace the 19-nt N in the primers F0 / BsF with a 19-nt (removing 1 base at the 5' end and 3 bases of the NGG PAM region) target sequence (sgRNA-1); replace the 19-nt N in -R0 / BsR with the inverted complementary sequence of another 19-nt (removing 1 base at the 5' end and 3 bases of the NGG PAM region) target (sgRNA-2).

[0062] Example 3:

[0063] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0064] PCR amplification: Using pCBC-DT1T2 diluted 100 times as the template for four-prime PCR amplification, -BsF / -BsR are at normal primer concentrations; -F0 / -R0 are diluted 20 times;

[0065] Normal PCR program: 95 °C for 4 min, 30 cycles: 95 °C for 30 s, 55 °C for 50 s, 68 °C for 50 s, 68 °C for 10 min, 5 μL loading, running electrophoresis at 626 bp. As shown in Table 1, it is the schematic table of PCR amplification of the present invention;

[0066] Table 1: Schematic table of PCR amplification

[0067]

[0068] Example 4:

[0069] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0070] Gel electrophoresis detection, specifically as follows:

[0071] (1) Prepare 1% agarose electrophoresis gel: Weigh agarose and place it in a conical flask, add an appropriate amount of TEA buffer in proportion, heat in a microwave oven for 1 - 2 min until the gel boils and no agarose particles are visible, shake several times during this period, and add EB (add 10 μL per 100 mL of solution) after cooling, pour into the gel plate and insert a comb;

[0072] (2) Loading: Take 3 μL of the PCR product and add 0.5 μL of 6x Loading Buffer into agarose gel at an appropriate concentration, and run electrophoresis for 15 min;

[0073] (3) View the exposed gel image and judge whether the fragment is amplified successfully according to the size of the amplified fragment;

[0074] (4) Purify the PCR product using the gel extraction kit from Sangon Biotech (Shanghai) Co., Ltd.

[0075] Example 5:

[0076] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0077] Purification of the PCR product, specifically as follows:

[0078] (1) Add 5 volumes of Buffer B3 to the PCR reaction solution, mix well and transfer to a collection tube;

[0079] (2) Centrifuge at 8000 rpm for 30 sec and pour out the liquid in the collection tube;

[0080] (3) Add 500 μL Wash Solution, centrifuge at 9000 rpm for 30 sec, and pour out the liquid in the collection tube.

[0081] (4) Repeat step (3) once.

[0082] (5) Centrifuge the empty column at 9000 rpm for 1 min.

[0083] (6) Place the adsorption column into a clean 1.5 mL centrifuge tube, add 25 μL Elution buffer to the center of the adsorption column membrane, let it stand at room temperature for 2 min and then centrifuge for 1 min. Store the DNA solution in the tube at -20°C.

[0084] Example 6:

[0085] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0086] Establish the following restriction-ligation system as shown in Table 2, which is a schematic table of the restriction-ligation system; reaction conditions: 37°C for 20 s, 50 cycles: 37°C for 4 min, 16°C for 5 min; 50°C for 5 min, 80°C for 5 min.

[0087] Table 2: Schematic table of the restriction-ligation system

[0088]

[0089]

[0090] Example 7:

[0091] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0092] Transform the restriction-ligation product into E. coli DH5α competent cells as follows:

[0093] (1) Take 20 μL of DH5α competent cells (produced by TransGen Biotech) in a sterile Eppendorf tube, add 10 μL of the ligation product, flick the tube wall gently to mix, and place it on ice for 30 min.

[0094] (2) After dry bath at 42°C for 90 sec, immediately insert it on ice to cool for 2 min, then add 1 mL of LB liquid medium, and oscillate at low speed (150 rpm) at 37°C for 40 min.

[0095] (3) Take 100 - 200 μL of the bacterial culture solution and evenly spread it on a plate containing 50 mg / mL kanamycin antibiotic, and culture it overnight at 37°C.

[0096] Example 8:

[0097] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0098] Screening of positive recombinant clones, specifically as follows:

[0099] Pick monoclonal colonies grown on the transformed LB solid plate (added with corresponding antibiotics) and cultured overnight, and perform colony PCR identification with vector primers U626-IDF and U626-IDR primers. Configure the colony PCR reaction system as shown in Table 3, which is a schematic table for configuring the colony PCR reaction system;

[0100] Table 3: Schematic table for configuring the colony PCR reaction system

[0101]

[0102]

[0103] Number the plate with a marker pen, pick monoclonal colonies with a sterile 10 μL pipette tip, then put them into the system and pipette and mix well, and perform PCR reaction. The reaction procedure is shown in Table 4, which is a schematic table for the PCR reaction.

[0104] Table 4: Schematic table for the PCR reaction

[0105]

[0106] Electrophorese the PCR product on an agarose gel, and the positive recombinant clone with the inserted fragment is the one that can amplify the target fragment.

[0107] Example 9:

[0108] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0109] DNA sequencing of the inserted fragment in the positive clone strain, specifically as follows:

[0110] (1) Select 2 - 3 single colonies of recombinant clones that are positive in colony PCR, culture the single colonies in LB liquid medium containing kanamycin resistance in a shaker at 37°C, and culture overnight at 200 rpm;

[0111] (2) In a sterile laminar flow hood, aspirate 500 μL of the cultured bacterial solution into a sterile EP tube, add an equal volume of 30% sterile glycerol, and store it at -80 °C. Additionally, aspirate 500 μL of the bacterial solution into a sterile 1.5 mL EP tube and send the bacterial solution to a biological company for sequencing.

[0112] Example 10:

[0113] A method for cultivating salt- and drought-tolerant composite stress plants by knocking out GmNARK, comprising:

[0114] Plasmid extraction of correctly sequenced clones: Compare the sequenced sequence with the gene sequence in the database, and perform plasmid extraction on the correctly sequenced clones. The plasmid extraction kit from Sangon Biotech is used. The specific experimental method is as follows:

[0115] (1) Pick a single colony growing on the LB solid medium and inoculate it into 2 mL of LB (containing Spe antibiotic) liquid medium. Incubate it at 37 °C with shaking overnight (about 12 - 16 h);

[0116] (2) Take 2 mL of the culture into an EP tube, centrifuge at 8000 rpm for 2 min, collect the bacterial cells, discard the supernatant, invert the centrifuge tube to allow the liquid to drain as much as possible;

[0117] (3) Add 250 μL of Buffer P1 to the bacterial cell pellet, and pipette or vortex to completely suspend the bacterial cells;

[0118] (4) Add 250 μL of Buffer P2, immediately gently invert the centrifuge tube 5 - 10 times to mix (do not shake vigorously), and let it stand at room temperature for 2 - 4 min until the bacterial solution in the centrifuge tube becomes clear;

[0119] (5) Add 350 μL of Buffer P3, immediately gently invert the centrifuge tube 5 - 10 times to mix it well;

[0120] (6) Transfer the liquid in the EP tube to a centrifuge, centrifuge at 12000 rpm for 5 min, then carefully transfer all the supernatant to the adsorption column, centrifuge at 12000 rpm for 30 sec, discard the liquid in the collection tube, and place the adsorption column into the same collection tube;

[0121] (7) Add 500 μL of deproteinization solution Buffer DW1 to the adsorption column, centrifuge at 9000 rpm for 30 sec, discard the liquid in the collection tube, and place the adsorption column into the same collection tube;

[0122] (8) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9000 rpm for 30 sec, discard the liquid in the collection tube, place the adsorption column into the same collection tube, and repeat this step once;

[0123] (9) Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 9000 rpm for 1 min.

[0124] (10) Add 50 μL of Elution Buffer to the center of the adsorption membrane. After standing at room temperature for 2 min, centrifuge at 9000 rpm for 1 min.

[0125] (11) Place the obtained plasmid DNA solution at -20 °C for storage or use in subsequent experiments.

[0126] Example 11:

[0127] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0128] Preparation of competent Agrobacterium cells, specifically as follows:

[0129] (1) Inoculate a single colony of Agrobacterium EHA101 with good growth into 5 mL of LB liquid medium and culture it overnight with shaking at 28 °C for activation.

[0130] (2) Inoculate the overnight-activated bacterial solution at a ratio of 1:100 into 100 mL of LB liquid medium and culture it with shaking at 28 °C for 1.5 - 3 h until the OD600 is about 0.4.

[0131] (3) After cooling on ice, transfer the bacterial solution to a 50 mL centrifuge tube and centrifuge to collect the bacterial cells (4000 rpm, 8 min, 4 °C).

[0132] (4) Discard the supernatant, add 20 mL of ice-cold 80 mM MgCl 2 -20 mM CaCl 2 solution, gently suspend the bacterial cells and make them evenly dispersed, then centrifuge at 4000 rpm, 8 min, 4 °C to collect the bacterial cells.

[0133] (5) Discard the supernatant, and then suspend the bacterial cells with 20 mL of pre-cooled calcium chloride solution 80 mM MgCl 2 -20 mM CaCl 2 solution, centrifuge at 4000 rpm, 8 min, 4 °C to collect the bacterial cells;

[0134] (6) Discard the supernatant, add 1.2 mL of pre-cooled 0.1 M CaCl 2 solution and 1.2 mL of 30% glycerol to the bacterial cells, mix well, and then directly store 100 μL in each tube at -80 °C for standby after quick freezing in liquid nitrogen or directly use it in subsequent experiments.

[0135] Example 12:

[0136] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0137] Transforming the plasmid into Agrobacterium tumefaciens EHA101, and using the liquid nitrogen freeze-thaw method to transform Agrobacterium tumefaciens. The specific operation is as follows:

[0138] (1) Take out 100 μL of Agrobacterium tumefaciens EHA101 competent cells stored at -80 °C, add 5 - 10 μL of plasmid DNA after melting, flick the tube wall gently to mix evenly, and place it on ice for 30 min;

[0139] (2) Put the centrifuge tube containing the competent cells into liquid nitrogen for 5 min, then transfer the centrifuge tube to a 37 °C metal bath for heat shock for 5 min. After adding 1 mL of LB (without resistance) liquid medium, place it in a 28 °C shaker and shake at a low speed (150 rpm) for 3 - 4 h;

[0140] (3) Place the cultured bacterial liquid in a centrifuge, centrifuge at 4500 rpm for 5 min, discard the supernatant, add 100 μL of LB liquid medium, suspend the bacterial cells and then coat them on a YEP plate medium (containing 50 mg / mL of Kan and Rif antibiotics);

[0141] (4) Place the plate at 28 °C and culture until single colonies grow out;

[0142] (5) Perform PCR amplification identification on the single colonies on the resistant plate to detect whether the plasmid has been transferred into Agrobacterium tumefaciens;

[0143] (6) Select positive colonies, culture them overnight at 200 rpm, add 30% glycerol and the bacterial liquid in a ratio of 1:1 for bacterial preservation, which is used for stable transgenic transformation of soybeans.

[0144] Example 13:

[0145] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, comprising:

[0146] Creation of stable transgenic soybean mutants, specifically as follows:

[0147] (1) Activate the strain and verify its growth activity: Streak and activate the strain (with resistance to Rif and Kana) on a YEP solid medium. After the colonies grow out, inoculate the single colonies into 5 mL of YEP liquid medium (with resistance to Rif and Kana), and culture them in a shaker at 28 °C and 200 rpm until OD600 is about 1.0;

[0148] (2) Verify the strain. Take 500 μL of the bacterial liquid and coat it on the same resistant medium to verify the growth activity of the bacteria. It is better if confluent bacterial lawns can grow out in 16 h;

[0149] (3) Disinfection: Select healthy soybean seeds with intact and plump seed coats, free from pests and diseases. Soak them briefly in a 75% ethanol solution for 30 s. After drying with absorbent paper, place them in a petri dish and put the petri dish in a vacuum desiccator. Disinfect them with chlorine gas generated from commercial bleaching water and concentrated hydrochloric acid for 12 - 16 h. After disinfection, blow them in a laminar flow hood until there is no obvious smell of chlorine, then seal and store for later use.

[0150] (4) Germination, inoculation plate: In this experiment, beans germinated by soaking in distilled water for 1 day were used for infection and transformation. The specific steps for soybean germination are as follows: Put 100 sterilized soybeans in a sterile 12 - cm glass round dish, add 100 mL of sterilized water (usually around 4 pm), soak the beans to two - thirds of their height, and replenish water if it is lacking during the process. On the same day, culture the infection strain. Take out the glycerol bacteria stored in a - 80°C refrigerator, suck 500 μL and spread it evenly on a 12 - cm - diameter YEP solid medium. Spread the bacterial liquid evenly, dry it, and then place it in a 28°C bacterial incubator to grow for about 16 h.

[0151] (5) Transformation and infection (it is advisable to start at 8 am): Use a disposable scalpel sterilized by high - temperature to scrape the bacterial lawn, resuspend the cells in a triangular flask with liquid CCM until OD600 = 0.7 - 0.8. Use a scalpel to cut off the radicle and longitudinally cut along the hypocotyl to divide the soybean into two parts, generating two explants (hypocotyl length ≤ 3 mm), each with a growing point. Immerse the explants in the bacterial liquid resuspended in CCM for infection (30 - 40 per 50 mL), and place them on a horizontal shaker at room temperature with a speed of 80 - 100 rpm for infection.

[0152] (6) Transfer to CCM medium: On the second day after transformation and infection, pour out the bacterial liquid in the triangular flask, place the bean halves upside - down on a sterilized filter paper to suck out the bacterial liquid, peel off the seed coat, and place the inner side of the cotyledons upward on a CCM solid medium with a layer of filter paper (put 40 - 50 explants in one dish), seal it, and culture it in a dark incubator for 3 - 5 days.

[0153] (7) Transfer to SIM medium: Cut off the swollen hypocotyl, leaving a length of about 0.5 cm. Insert the explants with the wound facing down and the cotyledon plane tilted about 45° into the S1 bud induction medium. Place about 18 explants in each tissue culture box and culture them in a light incubator (24°C, 18 h light / 6 h dark) for 14 days before sub - culturing.

[0154] (8) Transfer to the second SIM medium: Cut off the black substance on the surface of the explant wound, cut off half of the grown buds to stop their growth, and insert the cut explants with the inner side facing down at 45° into the SIM medium. Put 18 explants in one dish and place them on the culture rack for 2 weeks.

[0155] (9) Transfer to SEM medium: Cut off the black substance on the wound surface of the explant, cut off half of the grown buds to stop their growth, cut off half of the cotyledons, insert the two wound surfaces into the SEM medium so that the buds can grow upward, place 12 explants in one dish, and transfer them to a photothermal incubator with more stringent temperature control for 2 weeks. The temperature of the photothermal incubator is 24 °C, and the light cycle is 16 h light and 8 h darkness;

[0156] (10) Continue to transfer to SEM medium: Cut off the black substance on the two wound surfaces of the explant, remove the yellowing and withering leaves, insert the two wound surfaces into the SEM medium so that the buds can grow upward, place 12 explants in one dish, and place them in the photothermal incubator for growth. Subsequently, transfer the medium every 2 weeks. Generally, it is difficult to obtain new seedlings after subculturing on the SEM medium for 7 to 8 times, or the positive rate of seedling emergence is low, so no further subculturing is carried out;

[0157] (11) Transfer to rooting medium: During the process of transferring to the SEM medium (usually the second or third time), seedlings start to emerge. When the seedlings grow to more than 3 cm in length, they can be cut off from the explant with a sterile scalpel (ensuring a smooth wound) and inserted into the rooting medium for rooting. New roots can grow in 7 - 14 days, and the seedlings are transferred to vermiculite for continued growth;

[0158] (12) Positive identification of transgenic seedlings: Take a small amount of leaves from the transgenic seedlings for DNA extraction, and use the PCR amplification method to detect the Bar gene and the editing situation.

[0159] Example 14:

[0160] A method for cultivating salt - and drought - tolerant composite stress plants by knocking out GmNARK, including:

[0161] Positive identification of transgenic seedlings, specifically as follows:

[0162] (1) Take leaf materials in the normal growth state, extract DNA using the CTAB method, and then first detect the Bar gene to determine Bar - gene - positive single plants. Prepare a 10 - μL system as shown in Table 5, which is a schematic table for preparing 10 μL;

[0163] Table 5: Schematic table for preparing 10 μL

[0164]

[0165] (2) Amplify the target fragment according to the following PCR reaction system. In the reaction, the annealing temperature of 54 - 58 °C is determined according to the Tm value of the primer, and the extension time of 1 min - 3 min is determined according to the length of the target fragment, usually 1 kb / min. As shown in Table 6, which is a schematic table of the PCR reaction system;

[0166] Table 6: Schematic Table of PCR Reaction System

[0167]

[0168]

[0169] (3) After determining the Bar gene-positive single plants, use the primer of the target sequence for PCR amplification. After amplifying the target band, send the sample to a biological company for detection; the amplification method is the same as the above PCR amplification process for detecting the Bar gene, the system becomes 30 μL, and the number of cycles becomes 30.

[0170] Example 15:

[0171] A method for cultivating plants resistant to combined stress of salt and drought by knocking out GmNARK, including:

[0172] Detection of drought and salt stress resistance, specifically as follows:

[0173] Plant the control soybean variety Bragg and the positive transgenic mutant Gmnark in the greenhouse at the same time. After germination for 14 days, conduct 100 mM NaCl treatment, and then do not water until the phenotype appears; for the single NaCl treatment, conduct 100 mM NaCl treatment at 14 days, and then alternately treat with water and NaCl until the phenotype appears. Count the survival rate and above-ground fresh weight of the soybeans.

[0174] By using the constructed knockout vector to transform the receptor soybean plants to obtain transgenic plants, it can significantly promote the biomass of soybeans under salt, drought, and combined salt stress.

[0175] In the above embodiments, the descriptions of each embodiment have their own focuses. For the parts not detailed or recorded in a certain embodiment, reference can be made to the relevant descriptions of other embodiments. The above is only a preferred embodiment of the present invention, and it does not limit the technical scope of the present invention. Therefore, any minor modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK, characterized in that: include: A kit for performing a specific molecular biology operation on a target gene, specifically comprising the following steps: (1) Determine the target gene: The target genes include: a. soybean-derived gene with gene number Glyma.12G040000; b. Genes with the same or corresponding biological functions as gene a, including known genes or newly identified unknown genes; (2) Perform specific molecular biology operations: This includes increasing or decreasing the expression level of the target gene.

2. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 1, characterized in that: The kit comprises necessary genetic engineering components for reducing the expression level of the target gene or silencing the target gene.

3. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 2, characterized in that: The necessary genetic engineering group is selected from: one or any combination of template DNA, primers, enzymes, recombinant expression vectors, buffer solutions and infection media.

4. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 3, characterized in that: The recombinant expression vector is a knockout vector containing a target gene Guide RNA site, and the knockout vector uses pBSE401 as a backbone vector.

5. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 1, characterized in that: The method for making crops salt-tolerant is to reduce the expression of target genes in crops through genetic engineering, or to knock out target genes in crop genomes, so as to obtain transgenic plants with increased survival rate and aboveground biomass under drought conditions compared with wild controls.

6. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 5, characterized in that: The method for reducing or knocking out the expression of a target gene in a crop is specifically as follows: (a) Construct a knockout vector containing the guide RNA site of the target gene; (b) using the knockout vector to construct a transformant, and then using the transformant to infect target plants, screening positive plants, and obtaining transgenic plants with increased survival rate and biomass under salt or salt and drought combined stress compared with wild controls.

7. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 1, characterized in that: The method for improving the resistance of crops to the combined stress of salt and drought is to reduce the expression of target genes in crops through genetic engineering operations, or to knock out target genes in the crop genome, so as to obtain transgenic plants with increased survival rate and biomass under the combined stress of drought and salt compared with wild controls.

8. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 6, characterized in that: The transformant is obtained by transforming Agrobacterium EHA101 with the knockout vector.

9. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 7 or 8, characterized in that: The transgenic plants are obtained by a soybean stable transgenic method mediated by Agrobacterium EHA101, and positive plants are screened to obtain transgenic plants with increased survival rate and biomass under salt and salt and drought combined adversity compared with wild controls.

10. The method for cultivating plants tolerant to combined salt and drought stress by knocking out GmNARK according to claim 1, characterized in that: The crop is soybean.

Images