Anti-pollution LAMP colorimetric detection system as well as application and detection method thereof

Abstract

The invention belongs to the field of molecular biology and biomedical engineering, and particularly relates to an anti-pollution LAMP colorimetric detection system as well as application and a detection method thereof. The anti-pollution LAMP colorimetric detection system comprises a1)-a5) as follows; a1) a mixed solution of five deoxynucleotides containing dATP, dGTP, dCTP and dTTP and dUTP in different concentration ratios; a2) a Zst enzyme, a thermosensitive UDG enzyme and a buffer solution; a3) a magnesium ion indicator; (a4) 20 * EvaGreen, MgSO4 and ribozyme-free water; and a5) LAMP mixed primers of a sample to be detected. According to the method, the effect of preventing aerosol pollution of the LAMP product is achieved, and the rapid and on-site detection capability of a nucleic acid target is improved.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biology and biomedical engineering, and specifically relates to an anti-pollution LAMP colorimetric detection system, its application and detection method. Background Art

[0002] Isothermal nucleic acid amplification technology is an amplification technology that does not require temperature cycling operations. This technology overcomes the disadvantage of PCR that requires complex temperature cycling equipment, and with the assistance of a simple and inexpensive water bath or metal bath, it can achieve rapid amplification of target genes at a constant temperature. Compared with PCR technology, isothermal amplification technology makes molecular diagnosis more convenient, greatly improves the detection speed and sensitivity of various pathogens, and is more suitable for on-site detection.

[0003] Among them, loop-mediated isothermal amplification (LAMP) is a major isothermal nucleic acid amplification technology. The LAMP technology relies on 4 primers (2 outer primers and 2 inner primers) that recognize 6 specific fragments of conserved sequence DNA and a strand displacement DNA polymerase (such as Bst DNA polymerase). These primers bind to specific regions of the target DNA and, under the action of the strand displacement DNA polymerase, initiate DNA synthesis. This process is carried out under isothermal conditions (usually 60 - 65 °C), avoiding the need for temperature cycling in traditional PCR technology.

[0004] LAMP has very high amplification efficiency and sensitivity, and extremely trace template contamination can cause false positive results, and aerosol contamination is the main reason. Currently, there is a method to eliminate false positives in fluorescence LAMP reactions using the UDG enzyme degradation method. Its main principle is as follows: The UDG enzyme can cut the phosphodiester bond connected to it at the site of uracil deoxyribonucleotide on the synthesized nucleic acid chain, so that the entire nucleic acid chain will break at all uracil bases. Replace the raw material deoxythymidine triphosphate (dTTP) in the nucleic acid amplification system with deoxyuridine triphosphate (dUTP) to introduce uracil bases. The amplicon with uracil cannot become a template for subsequent amplification reactions after being treated with the UDG enzyme, while normal nucleotide chains are not affected. Then, inactivate the UDG enzyme by means of heat denaturation, etc., to avoid the influence of the enzyme on subsequent amplification reactions.

[0005] However, the above method of using UDG enzyme degradation to eliminate false positives in LAMP reactions is only applicable to fluorescence-based LAMP detection. Fluorescence detection requires specialized fluorescence detectors or real-time fluorescence quantitative PCR instruments, which are complex to operate, costly, and the detection results are not intuitive, making it unfavorable for on-site detection.

[0006] The products of LAMP reactions can also be detected through color changes produced by metal ion indicators. Metal ion indicators produce color by binding to Mg 2+ and the change in Mg 2+ concentration during LAMP reactions is the basis for colorimetric detection. Since LAMP reactions rely on strand displacement DNA polymerases (such as Bst DNA polymerase), the utilization efficiency of this enzyme for dUTP is relatively low. Introducing dUTP and UDG enzyme may significantly reduce the amplification efficiency of LAMP reactions and may also interfere with the Mg 2+ concentration or the pH value of the reaction system, thus affecting the accuracy and stability of colorimetric results. Therefore, there are few applications of using UDG enzyme degradation to eliminate false positives in LAMP reactions in colorimetric reactions. Summary of the Invention

[0007] To solve the above problems, the present invention provides an anti-pollution LAMP colorimetric detection system, its application, and detection method.

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] An anti-pollution LAMP colorimetric detection system, including the following a1)-a4);

[0010] a1) A mixture of five deoxynucleotides containing dATP, dGTP, dCTP, and different concentration ratios of dTTP and dUTP;

[0011] a2) Zst enzyme, thermosensitive UDG enzyme, and buffer;

[0012] a3) Magnesium ion indicator;

[0013] a4) 20×EvaGreen, MgSO 4 , nuclease-free water;

[0014] a5) LAMP mixed primers for the sample to be detected.

[0015] The components of the anti-pollution LAMP colorimetric detection system are as follows: for each system, 2 - 10 μL of buffer, LAMP mixed primers (10×), 10 - 20 mM of the mixture of five deoxynucleotides, thermosensitive UDG enzyme, Zst enzyme, 20×EvaGreen (20× in water), MgSO 4(100 mM), NF Water, target to be measured.

[0016] The buffer solution is prepared by fully mixing 2 - 10 μL of KOH (1 M), 10 - 12 μL of (NH 4 ) 2 SO 4 (1 M), 20 - 30 μL of KCl (2 M), 1 - 5 μL of Tween 20, and 250 - 300 μL of ddH 2 O.

[0017] The different concentration ratios of dTTP and dUTP are 10 - 0.1:0 - 10.

[0018] Furthermore, the different concentration ratios of dTTP and dUTP are 10:0.1, 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, 9:1, 0:10.

[0019] The magnesium ion indicator is Eriochrome Black T, and the usage amount is 0.5 - 2 μL (1 - 1.5 mM).

[0020] An application of the anti - pollution LAMP colorimetric detection system as described above, the application of the system in anti - pollution LAMP colorimetric detection.

[0021] A method for detecting nucleic acid by the anti - pollution LAMP colorimetric detection system as described above. Configure the anti - pollution LAMP colorimetric detection system as shown, add the sample to be detected into it, incubate at 20 - 37 °C for 5 - 20 min to eliminate residual pollution, then perform amplification at a constant temperature of 65 °C, and at the same time, a color change is presented by the indication of the system, and the Hue value is obtained by calculation, thereby realizing the detection of nucleic acid by the anti - pollution LAMP colorimetric method.

[0022] The nucleic acid sample to be detected is amplified in the anti - pollution LAMP colorimetric detection system. The magnesium ion indicator in the system indicates the change of Mg2 + . Incubate at 20 - 37 °C for 5 - 20 min to eliminate residual pollution. Then, at a constant temperature of 65 °C, the sample is amplified by the action of the enzyme in the system, and the fluorescent indicator in the system can be embedded on the amplified DNA. Whether the sample nucleic acid is amplified is judged by the fluorescence signal on the qPCR instrument, and then the Hue value in the tube is extracted and calculated to realize the quantitative detection of the sample.

[0023] A method for detecting Rotavirus A using an anti-pollution LAMP colorimetric detection system. Configure the anti-pollution LAMP colorimetric detection system as shown, add the sample to be detected, incubate at 20 - 37°C for 5 - 20 min to eliminate residual pollution, then perform amplification at a constant temperature of 65°C, and at the same time, a color change is presented by the action indicated in the system, and the Hue value is obtained by calculation, thereby realizing the detection of nucleic acid by the anti-pollution LAMP colorimetric method.

[0024] Advantages and effects of the present invention

[0025] In the anti-pollution LAMP colorimetric detection system of the present invention, after using Zst enzyme and Homemade Buffer and adding thermosensitive UDG enzyme, all dTTPs in the traditional system are replaced by dUTP, and rapid and highly sensitive isothermal amplification can still be achieved, and color change can be realized. Compared with the current LAMP colorimetric system, aerosol pollution and false positive results that are prone to occur in the LAMP reaction are significantly reduced, the use range of the UDG-dUTP anti-pollution system is expanded, and when using different ratios of dTTP and dUTP, slightly reducing the ratio of dUTP can improve the reaction efficiency and sensitivity. Generally speaking, the present invention has the advantages of high-efficiency anti-aerosol pollution, simple and convenient operation, rapid visual inspection by the naked eye, low cost, and suitability for on-site instant detection. Brief description of the drawings

[0026] Figure 1 It is the schematic diagram of the anti-pollution LAMP colorimetric detection method.

[0027] Figure 2 It is the fluorescence curve graph, colorimetric result graph, and Hue value of detecting Rotavirus A of the present invention.

[0028] Figure 3 It is the fluorescence curve graph and gel electrophoresis graph of eliminating aerosol pollution of the present invention.

[0029] Figure 4 It is the specificity result graph of detecting Rotavirus A of the present invention.

[0030] Figure 5 It is the sensitivity result graph of detecting Rotavirus A of the present invention.

[0031] Figure 6 It is the result graph of improving efficiency and sensitivity by using different T / U ratios of the present invention.

[0032] Figure 7 It is the result graph of improving the sensitivity of the reaction of the present invention..

[0033] Figure 8 It is the colorimetric result graph of detecting different types of targets of the present invention. Detailed implementation manners

[0034] The specific implementation process of the technical solution of the invention will be described in detail in combination with the accompanying drawings and embodiments, provided that those of ordinary skill in the art can implement it.

[0035] The Zst enzyme used in the present invention improves the polymerization ability for dUTP. In combination with the self-made buffer, it can improve the efficiency of LAMP after introducing dUTP and UDG enzyme, and enhance the stability of the results. Developing an anti-pollution LAMP colorimetric detection system is of great significance and can greatly improve the ability of low-cost on-site instant detection.

[0036] The present invention utilizes the change of Mg2+ in the LAMP reaction system and the color change generated by the metal ion indicator for detection. In combination with the UDG-dUTP anti-pollution system, it can realize the LAMP colorimetric detection for preventing aerosol pollution, and has the advantages of simple and convenient operation, rapid visual inspection by the naked eye, low cost, and suitability for on-site instant detection, etc.

[0037] Experimental example 1

[0038] This example is the colorimetric verification detection of the Rotavirus A target, specifically as follows:

[0039] As Figure 1 shown, first, prepare the reagents required for the experiment. Dissolve the dry powder of the primer chain synthesized from Rotavirus A in nuclease-free water, and respectively prepare 6 primers (F3, B3, FIP, BIP, LoopF, LoopB) with a concentration of 100 μM. The primer sequences are as shown in Table 1 below. Subsequently, mix 4 μL of F3, 4 μL of B3, 16 μL of FIP, 16 μL of BIP, 8 μL of LoopF, and 8 μL of LoopB, and add nuclease-free water to make up to 100 μL of Primer Mix; secondly, prepare an alkaline Buffer (Homemade Buffer) suitable for the Mg 2+ environment. Weigh the solid powder to prepare 1M (NH4) 2 SO 4 、2M KCL、1M KOH、Tween 20、H 2 O, and mix the above reagents according to Table 2 to prepare the self-made buffer, and adjust the pH value of the self-made buffer to 8.8; finally, configure the anti-pollution LAMP colorimetric detection reaction system as shown in Table 3.

[0040] Prepare all the reagents required for the anti-contamination LAMP colorimetric detection system except the Rotavirus A target according to the volume, shake and centrifuge to mix the reagents thoroughly, and evenly distribute 13.5μL into each tube. At this time, the color is bright purple-red. First, add 1.5μL of nuclease-free water to the negative tube as a control to balance to 15μL, then shake and centrifuge and cover the tube tightly. After adding 1.5μL of Rotavirus A target to the positive tube as the experimental group, cover the tube tightly and shake and centrifuge to mix the reagents thoroughly. Incubate on a metal plate at 25℃ for 10 minutes, then place in a qPCR instrument for reaction, set the temperature to 65℃ and incubate for 60 minutes. As shown in the attached Figure 2 As shown, after the reaction starts, the target DNA in the positive tube is gradually amplified under the action of the polymerase. The qPCR instrument shows that the fluorescence curve amplification appears at about 15 minutes, indicating that the nucleic acid amplification has begun. The negative tube has not been amplified because no target has been added, and the fluorescence signal is a horizontal line. After the amplification is completed, the color in the positive tube changes from the previous purple-red to sky blue. The color after the reaction is photographed with a smartphone and the Hue value is recorded. The Hue difference between the colors in the positive and negative tubes after the reaction is about 50°.

[0041] Table 1. LAMP primers for Rotavirus A, HPV-16 and HIV-1

[0042]

[0043] Table 2. Preparation of Homemade Buffer

[0044] Buffer Volume <![CDATA[1M(NH 4 ) 2 SO 4 > 10 μL 2M KCL 25 μL 1M KOH 8 μL Tween 20 1 μL <![CDATA[H 2 O]]> 280 μL

[0045] Table 3. LAMP reaction system

[0046]

[0047]

[0048] Example 2

[0049] This example is aerosol pollution elimination detection, specifically:

[0050] The pure dUTP anti-pollution LAMP colorimetric detection system of the present invention is compared with the traditional pure dTTP LAMP system. Figure 1As shown in the figure, first, prepare all the reagents required for the experiment. Dissolve the dry powder of the primer strands synthesized from Rotavirus A in nuclease-free water to prepare 6 primers (F3, B3, FIP, BIP, LoopF, LoopB) with a concentration of 100 μM each. The primer sequences are shown in Table 1 below. Subsequently, mix 4 μL of F3, 4 μL of B3, 16 μL of FIP, 16 μL of BIP, 8 μL of LoopF, and 8 μL of LoopB, and add nuclease-free water to make up to 100 μL of Primer Mix. Secondly, prepare an alkaline Buffer suitable for the Mg 2+ environment. Weigh the solid powder to prepare 1 M (NH4) 2 SO 4 , 2 M KCl, 1 M KOH, Tween 20, H 2 O. Mix the above reagents according to Table 2 to prepare a self-made buffer, and adjust the pH value of the self-made buffer to 8.8. Finally, configure the anti-pollution LAMP colorimetric detection reaction system as shown in Table 3.

[0051] In the reaction components dNTPs (10 mM) of the pure dUTP anti-pollution LAMP colorimetric detection system, the concentration ratio of dTTP to dUTP is 0:10, while in the reaction components dNTPs (10 mM) of the traditional pure dTTP LAMP system, the concentration ratio of dTTP to dUTP is 10:0. According to the volume, prepare all the reagents required in the anti-pollution LAMP colorimetric detection system except for the Rotavirus A target. Vortex and centrifuge to mix the reagents evenly, and distribute 13.5 μL into each tube for standby. First, add 1.5 μL of nuclease-free water to the negative tube as a control to make it up to 15 μL, then vortex and centrifuge and tighten the tube cap. To simulate the formation of aerosol contamination, amplify with the Rotavirus A target at 10 3 in their respective LAMP systems, and then dilute the product 10 5 times. Use the diluted solution as the positive target and add it to the next round of their respective LAMP reactions. Tighten the tube cap and vortex and centrifuge to mix the reagents evenly. Incubate on a 25°C metal for 10 min, and then place it in a qPCR instrument for reaction, setting the temperature to 65°C for 60 min. As shown in the appendix Figure 3 , in the traditional pure dTTP LAMP system, both the group with UDG enzyme added and the group without UDG enzyme added produced signals. In the pure dUTP anti-pollution LAMP colorimetric detection system, the reaction group without UDG enzyme added produced signals, while the group with UDG enzyme added did not produce signals, proving that the traditional LAMP reaction cannot eliminate residual target contamination, and the present invention achieves the elimination of residual target contamination. After the reaction, verify the amplified product by agarose gel electrophoresis, and the result is consistent with the fluorescence curve Figure 1 .

[0052] Example 3

[0053] This example is for the specific detection of the Rotavirus A target, specifically as follows:

[0054] As Figure 1 shown, first, prepare the reagents required for the experiment. Dissolve the dry powder of the primer strands synthesized from Rotavirus A in nuclease-free water, and respectively prepare 6 primers (F3, B3, FIP, BIP, LoopF, LoopB) with a concentration of 100 μM. The primer sequences are as shown in Table 1 below. Subsequently, mix 4 μL of F3, 4 μL of B3, 16 μL of FIP, 16 μL of BIP, 8 μL of LoopF, and 8 μL of LoopB, and add nuclease-free water to make up to 100 μL of Primer Mix. Secondly, prepare an alkaline Buffer suitable for the Mg 2+ environment. Weigh the solid powder to prepare 1 M (NH4) 2 SO 4 4, 2 M KCl, 1 M KOH, Tween 20, H 2 2O, and mix the above reagents according to Table 2 to prepare a self-made buffer. Adjust the pH value of the self-made buffer to 8.8. Finally, configure the anti-pollution LAMP colorimetric detection reaction system as shown in Table 3.

[0055] According to the recorded volumes, prepare all the reagents required in the anti-pollution LAMP colorimetric detection system except the target. Shake and centrifuge to fully mix the reagents evenly. First, add 1.5 μL of nuclease-free water to the negative tube as a control to make up to 15 μL, and then shake and centrifuge and tighten the tube cap. The positive tubes, as the experimental groups, add 1.5 μL of different enterovirus targets, namely Rotavirus A, Norovirus, and Adenovirus, tighten the tube caps, and shake and centrifuge to fully mix the reagents evenly. Incubate on a metal at 25 °C for 10 min, and then place it in a qPCR instrument for reaction, setting the temperature to 65 °C for 60 min.

[0056] As attached Figure 4 shown, only the target gene of Rotavirus A is amplified, resulting in color and Hue value changes, indicating good specificity of the present invention.

[0057] Example 4

[0058] This example is for the sensitivity detection of the Rotavirus A target, specifically as follows:

[0059] Test the Rotavirus A target at 10 4 、10 3 、10 2 、10 1 、10 0The detection sensitivity at a concentration of copies / μL was detected according to the method described in Example 1, and different concentrations of samples were prepared as follows.

[0060] First, dilute the target, quantify the concentration of the target with Nanodrop, with the unit of ng / μL. Secondly, convert the copy number of the original solution concentration, with the unit of copies / μL. Take 100 μL of the original solution and add it to 900 μL of nuclease-free water for dilution. Then take 100 μL of the diluted solution and add it to 900 μL of nuclease-free water. Similarly, dilute it successively to 10 4 、10 3 、10 2 、10 1 、10 0 copies / μL concentration.

[0061] As Figure 1 shown, first prepare the reagents required for the experiment. Dissolve the dry powder of the primer strand synthesized by Rotavirus A in nuclease-free water to prepare 6 primers (F3, B3, FIP, BIP, LoopF, LoopB) with a concentration of 100 μM respectively. The primer sequences are shown in Table 1 below. Then mix 4 μL of F3, 4 μL of B3, 16 μL of FIP, 16 μL of BIP, 8 μL of LoopF, and 8 μL of LoopB, and add nuclease-free water to make up to 100 μL of Primer Mix. Secondly, prepare an alkaline Buffer suitable for the Mg 2+ environment. Weigh the solid powder to prepare 1M (NH4) 2 SO 4 、2M KCL, 1M KOH, Tween 20, H 2 O. Mix the above reagents according to Table 2 to prepare a self-made buffer, and adjust the pH value of the self-made buffer to 8.8. Finally, configure the anti-pollution LAMP colorimetric detection reaction system as shown in Table 3.

[0062] According to the volumes described above, prepare all the reagents required in the anti-pollution LAMP colorimetric detection system except for the Rotavirus A target. Shake and centrifuge to mix the reagents evenly. Divide 13.5 μL into each tube on average. At this time, the color shows a bright purplish red. First, add 1.5 μL of nuclease-free water to the negative tube as a control to make it up to 15 μL, and then shake and centrifuge and tighten the tube cap. As the experimental group, add 1.5 μL of Rotavirus A target at each concentration to the positive tube, then tighten the tube cap and shake and centrifuge to mix the reagents evenly. Incubate on a 25 °C metal for 10 min, and then put it into a qPCR instrument for reaction, and set the temperature to 65 °C for incubation for 60 min. Record the changes in fluorescence value, color, and Hue value. As shown in the appendix Figure 5 shown, compared with the negative control, the color of the Rotavirus A positive group changed, and the detection limit was as low as 102 copies / μL indicates that the target gene has been detected.

[0063] Example 5

[0064] In this example, different T / U ratios were used to improve the reaction efficiency and sensitivity. Specifically, five kinds of deoxynucleotide mixtures dNTPs (10 mM) containing different concentration ratios of dTTP and dUTP were prepared, as Figure 1 shown. First, the reagents required for the experiment were prepared. The dry powder of the primer chain synthesized from Rotavirus A was dissolved in nuclease-free water to prepare 6 primers (F3, B3, FIP, BIP, LoopF, LoopB) with a concentration of 100 μM respectively. The primer sequences are shown in Table 1 below. Subsequently, 4 μL of F3, 4 μL of B3, 16 μL of FIP, 16 μL of BIP, 8 μL of LoopF, and 8 μL of LoopB were mixed, and nuclease-free water was added to make up to 100 μL of Primer Mix. Secondly, an alkaline buffer suitable for the Mg 2+ environment was prepared. Solid powder was weighed to prepare 1 M (NH4) 2 SO 4 , 2 M KCl, 1 M KOH, Tween 20, H 2 O. The above reagents were mixed according to Table 2 to prepare a self-made buffer, and the pH value of the self-made buffer was adjusted to 8.8. Finally, a contamination-proof LAMP colorimetric detection reaction system was prepared as shown in Table 3.

[0065] All the reagents required in the contamination-proof LAMP colorimetric detection system except the Rotavirus A target were prepared according to the volume, and the reagents were mixed and centrifuged thoroughly to make them evenly mixed. 13.5 μL of each was evenly distributed into the tubes. At this time, the color showed a bright purple-red. First, 1.5 μL of nuclease-free water was added to the negative tube as a control to make it up to 15 μL, and then it was centrifuged and shaken and the tube cap was tightened. The positive tube, as the experimental group, was added with 1.5 μL of Rotavirus A target, and then the tube cap was tightened and centrifuged and shaken to make the reagents mix evenly. It was incubated on a metal at 25 °C for 10 min, and then put into a qPCR instrument for reaction, and the temperature was set to 65 °C for incubation for 60 min. As shown in the appendix Figure 6 When the ratio of dTTP to dUTP was 4:6, the detection limit was as low as 10 1 copies / μL. When the ratio of dTTP to dUTP was 0:10, the detection limit was as low as 10 2 copies / μL, indicating that appropriately reducing the proportion of dUTP can improve the reaction efficiency and sensitivity.

[0066] Example 6

[0067] This example demonstrates that the present invention can improve the sensitivity of the reaction. Specifically:

[0068] Four groups of experiments were designed:

[0069] 1. Bst 2.0 Warmstart enzyme and homemade buffer

[0070] 2. Zst enzyme and commercial buffer (Isothermal Amplification Buffer)

[0071] 3. Bst 2.0 Warmstart enzyme and commercial buffer (Isothermal Amplification Buffer)

[0072] 4. Zst enzyme and homemade buffer

[0073] The reaction system is shown in Table 4. According to the detection method of Example 1, record the changes in color and Hue value. As shown in the appendix Figure 7 As shown, when the ratio of dTTP to dUTP is 0:10, the detection limit of the present invention (Group 4) is as low as 10 2 copies / μL, and the detection limits of those without using the components of the present invention (Groups 1, 2, and 3) are 10 3 copies / μL.

[0074] Table 4. LAMP reaction systems of different groups

[0075]

[0076]

[0077] Example 7

[0078] This example is to detect different types of targets (HPV-16, HIV-1), specifically:

[0079] As Figure 1 shown, first prepare the reagents required for the experiment. Dissolve the dry powder of the primer strands synthesized from HPV-16 and HIV-1 in nuclease-free water, and separately prepare 6 primers (F3, B3, FIP, BIP, LoopF, LoopB) with a concentration of 100 μM. The primer sequences are shown in Table 5 below. Subsequently, mix 4 μL of F3, 4 μL of B3, 16 μL of FIP, 16 μL of BIP, 8 μL of LoopF, and 8 μL of LoopB, and add nuclease-free water to make up to 100 μL of Primer Mix. Secondly, prepare an alkaline buffer suitable for the Mg 2+ environment, weigh the solid powder to prepare 1 M (NH4) 2 SO 4, 2M KCL, 1M KOH, Tween 20, H 2 O. Mix the above reagents according to Table 2 to prepare a self-made buffer, adjust the pH value of the self-made buffer to 8.8, and finally configure the anti-pollution LAMP colorimetric detection reaction system as shown in Table 3.

[0080] Prepare all the reagents required in the anti-pollution LAMP colorimetric detection system according to the volume, except for the HPV-16 and HIV-1 targets. Shake and centrifuge to fully mix the reagents evenly, and distribute 13.5 μL per tube into the tubes on average. At this time, the color shows a bright purplish red. First, add 1.5 μL of nuclease-free water to the negative tube as a control to balance to 15 μL, and then cover the tube cap after shaking and centrifuging. As the experimental group, add 1.5 μL of the HPV-16 or HIV-1 target to the positive tube, cover the tube cap, and shake and centrifuge to fully mix the reagents evenly. Incubate on a 25°C metal for 10 min, and then put it into a qPCR instrument for reaction, and set the temperature to 65°C for incubation for 60 min. As Figure 8 shown, amplification occurred in both the target (HPV-16, HIV-1) positive groups, resulting in color and Hue value changes. The present invention has good generality and can detect different targets.

[0081] Table 5. LAMP primers for HPV-16 and HIV-1

[0082] Name Primer HPV-16F3 GCAACCAGAGACAACTGAT HPV-16B3 ACACAATTCCTAGTGTGCC HPV-16FIP CTCTGTCCGGTTCTGCTTGTCATGACAGCTCAGAGGAGG HPV-16BIP TGCAAGTGTGACTCTACGCTTCAGGTCTTCCAAAGTACGAATG HPV-16Loop F GCTGGACCATCTATTTCATCCT HPV-16Loop B GCGTACAAAGCACACACG HIV-1F3 ATTATCAGAAGGAGCCACC HIV-1B3 CATCCTATTTGTTCCTGAAGG HIV-1FIP CAGCTTCCTCATTGATGGTTTCTTTTTAACACCATGCTAAACACAGT HIV-1BIP TGTTGCACCAGGCCAGATAATTTTGTACTGGTAGTTCCTGCTATG HIV-1Loop F TTTAACATTTGCATGGCTGCTTGAT HIV-1Loop B GAGATCCAAGGGGAAGTGA

Claims

1. A pollution-proof LAMP colorimetric detection system, characterized in that: The anti-pollution LAMP colorimetric detection system comprises the following a1)-a5); a1) a mixture of five deoxynucleotides containing dATP, dGTP, dCTP and different concentration ratios of dTTP and dUTP; a2) Zst enzyme, thermosensitive UDG enzyme and buffer; a3) magnesium ion indicator; a4) 20×EvaGreen, MgSO4, nuclease-free water; a5) Mixed primers for LAMP of samples to be tested.

2. The anti-pollution LAMP colorimetric detection system according to claim 1, characterized in that: The anti-pollution LAMP colorimetric detection system comprises 2-10 μL buffer, LAMP mixed primers (10×), 10-20 mM mixed solution of five deoxynucleotides, thermosensitive UDG enzyme, Zst enzyme, 20×EvaGreen (20×in water), MgSO4 (100 mM), NF Water, and the target to be detected.

3. The anti-pollution LAMP colorimetric detection system according to claim 1 or 2, characterized in that: The buffer solution is prepared by thoroughly mixing 2-10 μL KOH (1 M), 10-12 μL (NH 4 ) 2 SO 4 (1 M), 20-30 μL KCl (2 M), 1-5 μL Tween 20 and 250-300 μL ddH 2 O.

4. The anti-pollution LAMP colorimetric detection system according to claim 1 or 2, characterized in that: The different concentration ratios of dTTP and dUTP are 10-0.1:0-10.

5. The anti-pollution LAMP colorimetric detection system according to claim 1 or 2, characterized in that: The magnesium ion indicator is chrome black T, and the usage amount is 0.5-2 μL (1-1.5 mM).

6. An application of the anti-pollution LAMP colorimetric detection system according to claim 1, characterized in that: The system is used in anti-pollution LAMP colorimetric detection.

7. A method for detecting nucleic acid using the anti-pollution LAMP colorimetric detection system according to claim 1, characterized in that: Configure the anti-pollution LAMP colorimetric detection system as shown in requirement 1, add the sample to be tested, incubate at 20-37°C for 5-20 minutes to eliminate residual contamination, then amplify at a constant temperature of 65°C, while the color changes due to the action of the indicator in the system, and obtain the Hue value by calculation, thereby realizing the detection of nucleic acid using the anti-pollution LAMP colorimetric method.

8. The method for detecting nucleic acid using the anti-pollution LAMP colorimetric detection system according to claim 7, characterized in that: The nucleic acid sample to be detected is amplified in an anti-pollution LAMP colorimetric detection system, and the magnesium ion indicator in the system indicates Mg2 + The sample is amplified by the enzyme in the system at a constant temperature of 65°C, and the fluorescent indicator in the system can be embedded in the amplified DNA. The fluorescent signal is used on the qPCR instrument to determine whether the sample nucleic acid is amplified, and then the Hue value in the extraction tube is calculated to achieve quantitative detection of the sample.

9. A method for detecting Rotavirus A using a pollution-free LAMP colorimetric detection system, characterized in that: According to the anti-pollution LAMP colorimetric detection system configured as shown in claim 1, the sample to be detected is added thereto and incubated at 20-37°C for 5-20 minutes to eliminate residual contamination, and then amplified at a constant temperature of 65°C, while the color change is presented by the action of the indicator in the system, and the Hue value is obtained by calculation, thereby realizing the detection of nucleic acid using the anti-pollution LAMP colorimetric method.

Images