New application of Rab5a in preparation of heart protection medicine

Abstract

The invention provides a new application of Rab5a in preparation of a medicine for protecting the heart. The invention finds that Rab5a provides a new therapeutic target for hypertension heart injury, Rab5a overexpression can improve cardiac hypofunction and pathological change caused by hypertension, and a new choice is provided for clinical treatment of heart disease.

Description

Technical Field

[0001] The present invention belongs to the field of medical science, and particularly relates to a new use of Rab5a in the preparation of a cardiac protective drug. Background Art

[0002] Hypertensive heart disease refers to heart disease caused by long-term increased cardiac load due to hypertension, and under the combined action of excessive factors such as catecholamines and angiotensin I related to hypertension, characterized mainly by left ventricular hypertrophy and dilation. If hypertensive heart disease is not effectively controlled, it will evolve into left heart failure or even whole heart failure, and may ultimately lead to the death of the patient.

[0003] Rab5a protein (Uniprot number: P20339), Rab5a is an important member of the Rab family, is a small guanosine diphosphate (GTP)-binding protein that regulates intracellular transport pathways, and regulates the fusion of receptor endocytic vesicles with early endosomes. Existing studies have proven that Rab5a is involved in the regulation of tumors, nerves, and the immune system.

[0004] Currently, there is no research report on the correlation between Rab5a and hypertensive heart disease. Summary of the Invention

[0005] The purpose of the present invention is to provide a new use of Rab5a in the preparation of a cardiac protective drug.

[0006] The present invention provides the use of Rab5a or a Rab5a gene expression promoter in the preparation of a drug for preventing and / or treating heart disease.

[0007] Further, the heart disease is hypertensive heart disease.

[0008] Further, the Rab5a gene expression promoter includes, but is not limited to, a Rab5a gene overexpression plasmid or a Rab5a gene overexpression adeno-associated virus.

[0009] Further, the drug is a drug for preventing and / or treating cardiac injury.

[0010] Further, the drug is a drug for preventing and / or treating cardiac remodeling; the drug is a drug for preventing and treating cardiac hypertrophy.

[0011] Further, the drug is a drug for reducing cardiac inflammation.

[0012] Further, the drug is a drug for preventing and / or treating cardiac fibrosis.

[0013] The present invention also provides a composition for treating hypertension, which is a preparation made from a Rab5a gene expression promoter as the active ingredient and pharmaceutically acceptable excipients.

[0014] Furthermore, the Rab5a gene expression promoter includes, but is not limited to, an overexpressed plasmid of the Rab5a gene or an overexpressed adeno-associated virus of the Rab5a gene.

[0015] The present invention also provides a method for constructing a hypertension-induced cardiac hypertrophy and / or cardiac fibrosis model.

[0016] (1) Prepare Rab5a gene knockout mice;

[0017] (2) Then inject AngⅡ for induction to establish a hypertension-induced cardiac hypertrophy and / or cardiac fibrosis model.

[0018] The present invention for the first time explores the regulatory effect of Rab5a on cardiac injury in hypertensive mice from the perspectives of cardiac function, pathology, hypertrophy genes, fibrosis, etc., providing more ideas for the clinical prevention and treatment of hypertensive cardiac remodeling.

[0019] Through modeling, gene knockout and overexpression, the present invention for the first time proves that Rab5a knockout can further exacerbate hypertensive cardiac hypertrophy, thereby promoting the decline of cardiac function caused by AngⅡ and ultimately promoting cardiac fibrosis. Overexpression of Rab5a can improve the decline of cardiac function and pathological changes caused by hypertension. Rab5a can be used as a new therapeutic target for hypertensive heart disease.

[0020] Obviously, based on the above content of the present invention, according to the common general technical knowledge and customary means in the art, without departing from the above basic technical idea of the present invention, various other forms of modifications, substitutions or changes can be made.

[0021] The following is a further detailed description of the above content of the present invention through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. Description of the Drawings

[0022] Figure 1 Identification of Rab5a global knockout mice A. DNA identification map of Rab5a + / + type and Rab5a - / - type mice; B. Protein bands of major organs of Rab5a + / + type and Rab5a - / - type mice.

[0023] Figure 2The effect of Rab5a knockout on the cardiac function of mice in each group, that is, the effect of Rab5a knockout on the ejection fraction (EF), fractional shortening (FS) and left ventricular myocardial mass (LV) of mice in each group (Note: * P < 0.05, compared with Rab5a + / + +NS; # P < 0.05, compared with Rab5a + / + +AngⅡ group).

[0024] Figure 3 The effect of Rab5a knockout on the expression of ANP and BNP mRNA in the hearts of mice in each group (Note: * P < 0.05, compared with Rab5a + / + +NS; # P < 0.05, compared with Rab5a + / + +AngⅡ group).

[0025] Figure 4 The effect of Rab5a knockout on the heart pathology of mice in each group (Note: The black arrow indicates inflammatory cell infiltration, and the white arrow indicates myofilament lysis (400×).

[0026] Figure 5 The effect of Rab5a knockout on the cardiac fibrosis of mice in each group, and the collagen volume fraction map of mice in each group (Note: The orange or bright red staining indicated by the arrow represents type I collagen fibers, and the green staining represents type III collagen fibers (400×) *P < 0.05, compared with Rab5a + / + +NS; #P < 0.05, compared with Rab5a + / + +AngⅡ group).

[0027] Figure 6 The effect of Rab5a overexpression on the cardiac function of mice in each group, that is, the effect of Rab5a overexpression on the ejection fraction (EF) and fractional shortening (FS) of mice in each group (Note: * P < 0.05, compared with Rab5a + / + +NS; # P < 0.05, compared with Rab5a + / + +AngⅡ group).

[0028] Figure 7 The effect of Rab5a overexpression on the heart pathology of mice in each group Detailed implementation manners

[0029] The raw materials and equipment used in the present invention are all known products, and are obtained by purchasing commercially available products.

[0030] AngⅡ: Angiotensin II.

[0031] Experimental materials:

[0032] (I) Main reagents and consumables

[0033]

[0034] (II) Experimental animals

[0035] In this experiment, SPF-grade male C57BL / 6 mice weighing 20 - 25 ± 3 g were used. The experimental animals were provided by Shanghai Slac Laboratory Animal Center, and the license number for the use of experimental animals was: SYXK(Fujian)2014 - 0001. The C57BL / 6 mice with Rab5a knockout were constructed by Cyagen Biosciences Inc. and were raised and bred in the SPF-grade animal center of our school. Animal experiments were carried out in accordance with the "Guide for the Care and Use of Laboratory Animals" issued by the Ministry of Science and Technology of China in 2006 and the "Guide for the Care and Use of Laboratory Animals" issued by the National Institutes of Health of the United States. They were placed in the specific pathogen-free experimental animal center of Fujian University of Traditional Chinese Medicine and raised in an SPF-grade laboratory, with free access to food and water, sufficient ventilation and lighting in the room, the room temperature controlled at (25 ± 1)°C, the relative humidity about 60%, and a 12 h light / dark cycle. Before the experiment, the mice were allowed to adapt to these conditions for at least 7 days. The breeding environment was kept quiet without disturbance.

[0036] (III) Experimental instruments

[0037] Western-blot electrophoresis apparatus, Western-blot membrane transfer apparatus (Bio-Rad, USA); ELX800 microplate reader (BioTek, USA); horizontal shaker (Qilinbeier Instrument Manufacturing Co., Ltd., Haimen); chemiluminescence imaging system (ChemiDoc XRS, Bio-Rad, USA); constant temperature metal bath (Shanghai Peiqing); pipette (Eppendorf, Germany); electronic analytical balance (Ohaus Instruments Co., Ltd., Shanghai); small animal ultrasonic imaging system Vevo2100 (Fujifilm Investment Co., Ltd.); inhaled small animal anesthesia machine (Shenzhen Rewod Life Science and Technology Co., Ltd.); pathological slicer (Leica, Germany); paraffin embedding machine (Yaguang Medical Electronics Co., Ltd., Xiaogan, Hubei); biological tissue automatic dehydrator (Yaguang Medical Electronics Co., Ltd., Xiaogan, Hubei).

[0038] Example 1 Influence of Rab5a on the heart

[0039] I. Experimental methods

[0040] (I) Construction of mice with different Rab5a genotypes

[0041] 1. Entrust Cyagen (Guangzhou) Biosciences Inc. to prepare heritable genetically modified Rab5a mice. The genotype of the modified C57BL / 6 mice delivered by this company was: Rab5a flox / flox. The preparation process is roughly as follows: Design a targeting vector for the exon of the murine Rab5a gene, then transfect embryonic stem cells, use the positive and negative selection system to obtain positive cells, inject the positive cells into blastocysts by microinjection method, and then transplant them into C57BL / 6 surrogate female mice for breeding mice. Cross the born chimeric mice with wild-type mice, and screen to obtain heritable gene-modified Rab5a heterozygous mice (Rab5a flox / + type), inbreed the Rab5a flox / + type to obtain Rab5a flox / flox type mice.

[0042] 2. Mate Rab5a flox / flox type mice with a tool mouse expressing Cre gene throughout the body. For the obtained newborn mice, cage them separately by male and female after 21 days and conduct identification. The identification genes are: Rab5a + / - mice are Cre-positive heterozygous mice (heterozygous mice carrying the Cre gene have been obtained).

[0043] 3. Inbreed Rab5a + / - mice. For the obtained newborn mice, cage them separately by male and female after 21 days and conduct identification. The identification genes are: Rab5a + / - mice are heterozygous mice (only one chromosome is knocked out), Rab5a + / + mice are wild-type mice, and Rab5a - / - mice are homozygous mice with the gene knocked out throughout the body.

[0044] 4. Rab5a flox / flox , Rab5a + / - , Rab5a - / - , Rab5a + / + male and female mice are all raised in the Animal Experiment Center of Fujian University of Traditional Chinese Medicine.

[0045] Take three Rab5a+ / + and three Rab5a- / - type mice each. After anesthetizing the mice with 2% sodium pentobarbital (0.225 mL / 100 g), decapitate the mice to death, quickly remove blood vessels, kidneys, hearts, livers and brain tissues, extract their DNA, conduct PCR and agarose gel electrophoresis to further determine the genotypes of the mice, and at the same time use Western blot to detect the expression of Rab5a for further identification.

[0046] (II) Establish a mouse model of Ang II-induced hypertensive heart disease

[0047] 1. Grouping

[0048] Take 8-10-week-old Rab5a + / +and Rab5a - / - Twelve mice of each type were divided into four groups, with 6 mice in each group:

[0049] Rab5a + / + + normal saline (Rab5a + / + + NS group);

[0050] Rab5a - / - + normal saline (Rab5a - / - + NS group);

[0051] Rab5a + / + + AngⅡ group;

[0052] Rab5a - / - + AngⅡ group.

[0053] 2. Model establishment

[0054] (1) Weigh all the mice one day in advance and take the average value. Prepare AngⅡ at a dose of 500 ng / kg / min. Stand the Alzet osmotic pump upright, draw 220 μL of the prepared AngⅡ with the accompanying needle, inject the AngⅡ into the pump, slowly lift the needle while injecting until a little liquid overflows from the pump port, then stop injecting, and insert the pump cap into the pump. Draw an equal volume of normal saline into the pump and operate as described above.

[0055] (2) Anesthetize the mice with 2% pentobarbital sodium. After the mice are anesthetized, make an incision between the two scapulas on the right side of the back of the mice, free the subcutaneous tissue with forceps until it reaches the subcutaneous area on the left side of the neck, implant the pre - loaded micro - pump under the subcutaneous tissue on the opposite side of the incision, and suture the skin incision with needles and threads.

[0056] (3) After the operation, place the mice on a plate covered with bedding and keep them warm with a heat lamp. Observe the vital signs of the mice at all times until the mice wake up from anesthesia, and then put them back into the breeding cage.

[0057] (III) Construction of AngII - hypertensive mice overexpressing Rab5a (Rab5a OV)

[0058] 1. The virus (AAV-CMV-Rab5a) was injected into C57BL / 6 mice by the tail vein injection method to obtain mice with overexpressed Rab5a. The empty virus (AAV-CMV) was injected into C57BL / 6 mice by the same tail vein injection method as a control. The mice were housed in the SPF-class animal room on the second floor of the Animal Experiment Center of Fujian University of Traditional Chinese Medicine. The temperature of the animal room was 20.8 - 24.3 °C, the temperature difference during the day was <4 °C, the relative humidity was 47.2 - 67.2%, the air change rate was ≥15 times / h, and there was a 12h light / 12h dark light-dark cycle. The experimental animals could eat and drink freely, and food and water were added at any time. The bedding was changed every 2 - 3 days. The animal experiment was approved by the Animal Management and Use Committee of Fujian University of Traditional Chinese Medicine and agreed by the Ethics Committee. All experimental operation procedures were carried out strictly in accordance with the "Guiding Opinions on the Humane Treatment of Laboratory Animals" in China.

[0059] Among them, for AAV-CMV-Rab5a, the inserted overexpressed Rab5a gene fragment sequence is as shown in SEQ ID NO.1:

[0060] atggctaatcgaggagcaacaagacccaacgggccaaatactggaaataaaatatgccagttcaaactggtccttctaggagagtctgctgttggcaaatcaagcctggttcttcgctttgtgaaaggccaatttcatgaatttcaagagagtaccattggggctgcctttctaacccaaactgtgtgtcttgatgacacaacagtaaaatttgaaatatgggatacagctggtcaagaacggtatcatagcttagcaccaatgtactaccgaggagcacaagcagccatagttgtgtatgatatcacaaatgaggaatcctttgcgagagcaaaaaactgggttaaagaacttcaaaggcaagcaagtcctaatattgtgatagctttgtcaggaaacaaagctgacttagcaaataaaagagctgttgacttccaggaagcacagtcctatgcagatgacaacagcttattatttatggagacatcagctaagacatcaatgaatgtaaatgaaatatttatggcaatagctaaaaagctgccaaagaatgaaccacagaatcctggtgcaaactcagccagaggacgaggagtagaccttactgagcctgcacagccagccagaagccagtgttgtagtaactga

[0061] 2. Grouping: Twelve 8 - 10 - week - old AAV - CMV and AAV - CMV - Rab5a mice were taken, and the mice were divided into four groups, with 6 mice in each group:

[0062] WT + NS group: AAV - CMV+Saline,

[0063] WT + AngⅡ group: AAV - CMV+AngⅡ,

[0064] Rab5a OV + NS group: AAV - CMV - Rab5a (overexpression, OV)+Saline, Rab5a OV + AngⅡ group: AAV - CMV - Rab5a+AngⅡ.

[0065] (4) Cardiac function and pathological detection of mice in different groups

[0066] 1. Evaluation of mouse cardiac function by small animal ultrasound

[0067] On the 28th day after surgery, the cardiac function of mice was evaluated using a small animal ultrasound system. The steps were as follows: The experimental mice were anesthetized with 2% isoflurane, and the anesthetic dose was adjusted to make the breathing stable and the heart rate maintained at about 300 beats / min. The four limbs of the mice were fixed with adhesive tape. The chest hair of the mice was removed with a depilatory and then a coupling agent was applied. A mouse ultrasound probe (400MS) was selected, and at the left ventricular long-axis section, two-dimensional ultrasound images of the left ventricular long axis were obtained, and the following parameters were measured with M-mode ultrasound: ejection fraction (EF), fractional shortening (FS), and left ventricular myocardial mass (LV mass), etc.

[0068] 2. Pathological detection

[0069] 1) Animal sampling

[0070] On the 29th day after surgery, animal sampling was performed. Each group of mice was anesthetized with sodium pentobarbital (2%, 0.225 mL / 100 g). After the mice were anesthetized, blood was collected from the orbital cavity. After the blood was left standing at room temperature for 0.5 h, it was centrifuged at 5000 rpm for 20 min, and then the upper serum was aspirated into a 1.5 mL centrifuge tube, mixed well, aliquoted, and stored in a -80 °C ultra-low temperature refrigerator for Bioplex detection.

[0071] The heart was quickly separated, rinsed with normal saline and gently blotted dry with filter paper. The two auricles were excised, and then the heart was photographed and weighed (Heart weight, HW). The heart was horizontally transected into three parts. The basal and apical parts were placed in a -80 °C ultra-low temperature refrigerator for qPCR and Western blot detection; the middle part was placed in 4% paraformaldehyde fixative for HE and Sirius red staining.

[0072] 2) Detection of pathological changes in the mouse heart by HE staining

[0073] The heart was fixed in 4% paraformaldehyde for 24 h. After fixation, it was washed 3 times with ddH2O, 5 min each time. The heart was placed in an embedding cassette and dehydrated through a gradient of alcohol, cleared with xylene, and then immersed in paraffin.

[0074] 3) Evaluation of mouse cardiac fibrosis by Sirius red staining

[0075] The degree of myocardial fibrosis in mice was evaluated by measuring the collagen volume fraction (CVF%). The heart tissues were fixed, dehydrated, embedded, sectioned (4 μm thick), dewaxed, dehydrated, and then stained with Sirius red staining solution for 1 h, rinsed with running water, and counterstained with hematoxylin for 8 min; rinsed with running water for 10 min, dehydrated, cleared, and mounted. Then, the samples were observed and photographed under a polarized light microscope. Five random fields of view were selected for each section during photography. Using Image J image analysis software, the myocardial collagen volume fraction (CVF%) was calculated, where CVF% = collagen area / total field area × 100%, and note that the collagen area does not include the perivascular collagen area.

[0076] (IV) Data organization and statistical analysis

[0077] All data were statistically analyzed using SPSS 26.0 software, and the experimental results were expressed as "mean ± standard deviation". The t-test was used for comparison between two groups; for comparison among multiple groups, one-way analysis of variance (ANOVA) was used when the data conformed to a normal distribution and homogeneous variance. If the data did not conform to a normal distribution, the rank sum test was used. A P < 0.05 was considered statistically significant.

[0078] II. Experimental results

[0079] (1) Successfully constructed Rab5a knockout mice

[0080] First, gene knockout mice were used, and PCR amplification technology was used to identify the knockout mice. The results are shown in Figure 1 A. For Rab5a + / + homozygous mice, the gene product had only a single band of 168 bp, and for Rab5a - / - homozygous mice, the gene product had only a single band of 361 bp. For heterozygous mice, the gene product had double bands of 168 bp and 361 bp.

[0081] In the present invention, Western blot technology was also used to detect the expression of Rab5a in - / - mice and the expression of Rab5a in the kidneys, heart, brain, and liver of + / + mice. The results are shown in Figure 1 B: The Rab5a protein was normally expressed in + / + mice, while Rab5a protein was not expressed in - / - mice.

[0082] The above results confirmed that Rab5a knockout mice - / - had been successfully obtained and could be used for subsequent studies.

[0083] (2) Rab5a knockout exacerbates Ang II-induced cardiac dysfunction in mice

[0084] The parameters such as EF, FS and LV mass of mice were measured by a small animal ultrasound instrument to evaluate the effect of Rab5a knockout on the cardiac function of AngⅡ-induced mice.

[0085] The results were as Figure 2 shown:

[0086] 1. There were no significant differences in the EF and FS values between the Rab5a + / + +NS group and the Rab5a - / - +NS group (P>0.05).

[0087] 2. Compared with the control group, after 4 weeks of AngⅡmodeling, the EF and FS of the Rab5a + / + +AngⅡ group were significantly decreased (P<0.05), indicating that AngⅡmodeling for 28 days caused damage to the hearts of mice, indicating that the cardiac dysfunction model was successfully established.

[0088] 3. Compared with the Rab5a + / + +AngⅡ group, the EF and FS of Rab5a knockout mice were further decreased after AngⅡmodeling, indicating that Rab5a knockout exacerbated the cardiac dysfunction induced by AngⅡ in mice.

[0089] At the same time, through the analysis of LV mass, it was also found that Rab5a knockout significantly increased the left ventricular weight of AngⅡ-induced mice, indicating that Rab5a knockout could further exacerbate the cardiac hypertrophy phenomenon induced by AngⅡ in mice.

[0090] The experimental results showed that Rab5a knockout exacerbated the cardiac dysfunction induced by AngⅡ in mice, and at the same time, Rab5a knockout could further exacerbate the cardiac hypertrophy phenomenon induced by AngⅡ in mice.

[0091] (3) Rab5a knockout promotes cardiac hypertrophy induced by AngⅡ in mice

[0092] After 28 days of AngⅡ intervention, the hearts of mice in each group were taken, and the effect of Rab5a knockout on cardiac hypertrophy induced by AngⅡ in mice was evaluated by detecting the expression of myocardial hypertrophy genes ANP and BNP mRNA. The results were as Figure 3 shown: Compared with the Rab5a + / + +NS group, the expression of ANP and BNP mRNA in the cardiac tissues of the Rab5a + / + +AngⅡ group was significantly up-regulated (P<0.05). And Rab5a knockout could further promote the expression of ANP and BNP mRNA in the cardiac tissues of AngⅡ-induced mice (P<0.05). It indicated that Rab5a knockout could indeed further promote cardiac hypertrophy induced by AngⅡ.

[0093] Experimental results showed that knocking out Rab5a promoted Ang II-induced cardiac hypertrophy, as demonstrated herein.

[0094] (IV) Knocking out Rab5a exacerbated the cardiac pathological changes induced by Ang II in mice

[0095] The effect of knocking out Rab5a on the cardiac pathology induced by Ang II in mice was evaluated by HE staining. The results were as Figure 4 shown: In the Rab5a + / + +NS group and the Rab5a - / - +NS group, the orientation of cardiomyocytes was regular and the size of cardiomyocytes was normal. However, in the Rab5a + / + +Ang II group, the local orientation of cardiomyocytes was disordered and there was obvious infiltration of inflammatory cells. The cardiomyocytes in the Rab5a - / - +Ang II group were more disordered than those in the Rab5a + / + +Ang II group, the infiltration of inflammatory cells in the myocardial interstitium was more significant, and at the same time, the nuclei of cardiomyocytes were enlarged, and some even showed dissolution of myofilaments. This indicated that knocking out Rab5a significantly exacerbated the cardiac pathological changes induced by Ang II in mice, further aggravating the cardiac injury.

[0096] Experimental results showed that knocking out Rab5a significantly exacerbated the cardiac pathological changes induced by Ang II in mice, further aggravating the cardiac injury.

[0097] (V) Knocking out Rab5a exacerbated the cardiac fibrosis induced by Ang II in mice

[0098] Long-term hypertension leads to overactivation of the reactive oxygen species system in cardiac tissue, infiltration of inflammatory cells, and abnormal increase in the levels of inflammatory factors, which stimulate the increased synthesis of cardiac collagen fibers and ultimately lead to myocardial fibrosis. The effect of knocking out Rab5a on the cardiac fibrosis induced by Ang II in mice was evaluated by Sirius red staining, and the collagen volume fraction (CVF) was measured using Image J software.

[0099] The results were as Figure 5 shown: In terms of cardiac collagen deposition, there was no significant difference between the Rab5a + / + +NS group and the Rab5a - / - +NS group (P>0.05). After modeling with Ang II for 28 days, the myocardial CVF in the Rab5a + / + +Ang II group was significantly higher than that in the Rab5a + / + +NS group (P<0.05), while the myocardial CVF in the Rab5a - / - +Ang II group was higher than that in the Rab5a + / +The +AngⅡ group increased significantly (P<0.05). This indicates that Rab5a knockout exacerbated AngⅡ-induced myocardial fibrosis in mice.

[0100] The experimental results showed that Rab5a knockout exacerbated AngⅡ-induced myocardial fibrosis in mice.

[0101] (VI) Effect of Rab5a overexpression on AngⅡ-induced cardiac function in mice

[0102] The effect of tail vein injection of AAV-CMV-Rab5a on cardiac function in rats was evaluated by small animal ultrasound, as Figure 6 shown. Compared with the WT+NS group, the EF value in the WT+AngII group was significantly decreased; while the EF value in the AngII+Rab5a OV group was significantly increased compared with the WT+AngII group, with significant difference (P<0.05). The above results showed that tail vein injection of AAV-CMV-Rab5a had a protective effect on AngII-induced cardiac injury.

[0103] (VII) Effect of Rab5a overexpression on AngⅡ-induced cardiac pathological morphology in mice

[0104] The pathological changes of cardiac tissues in rats of each group were compared by HE staining, as Figure 7 shown. Compared with the WT+NS group, cardiomyocyte hypertrophy, disordered arrangement, and inflammatory infiltration were observed in the WT+AngII group, while the cardiac tissues in the AngII+Rab5a OV group could relieve the pathological changes of cardiac tissues caused by hypertension.

[0105] The present invention firstly explored the regulatory effect of Rab5a on cardiac injury in hypertensive mice from the perspectives of cardiac function, pathology, hypertrophy genes, fibrosis, etc., providing more ideas for the clinical prevention and treatment of hypertensive cardiac remodeling.

[0106] Through modeling, gene knockout and overexpression, the present invention firstly demonstrated that Rab5a knockout could further exacerbate hypertensive cardiac hypertrophy, thereby promoting the decline of cardiac function caused by AngⅡ, and ultimately promoting cardiac fibrosis. Rab5a overexpression could further improve the decline of cardiac function and pathological changes caused by hypertension. The present invention found that Rab5a provides a new therapeutic target for hypertensive cardiac injury.

Claims

1. Use of Rab5a or a Rab5a gene expression promoter in the preparation of a medicament for preventing and / or treating heart diseases.

2. The use according to claim 1, wherein, the Rab5a gene expression promoter includes but is not limited to a Rab5a gene overexpression plasmid or a Rab5a gene overexpression adeno-associated virus; the nucleotide sequence of the Rab5a gene overexpression is as shown in SEQ ID NO.

1.

3. The use according to claim 1 or 2, wherein, the heart disease is hypertensive heart disease.

4. The use according to claim 1 or 2, wherein, the medicament is a medicament for preventing and / or treating heart injury.

5. The use according to any one of claims 1-4, wherein, the medicament is a medicament for preventing and / or treating cardiac remodeling; the medicament is a medicament for preventing and treating cardiac hypertrophy.

6. The use according to any one of claims 1-4, wherein, the medicament is a medicament for reducing heart inflammation.

7. The use according to any one of claims 1-4, wherein, the medicament is a medicament for preventing and / or treating cardiac fibrosis.

8. A composition for treating hypertension, wherein, it is a preparation prepared with a Rab5a gene expression factor promoter as an active ingredient and pharmaceutically acceptable excipients.

9. The composition according to claim 8, wherein: the Rab5a gene expression promoter includes but is not limited to a Rab5a gene overexpression plasmid or a Rab5a gene overexpression adeno-associated virus.

10. A method for constructing a hypertensive cardiac hypertrophy and / or cardiac fibrosis model, wherein, (1) Prepare Rab5a gene knockout mice; (2) Then inject AngⅡ for induction to establish a hypertensive cardiac hypertrophy and / or cardiac fibrosis model.

Images