Application of Sigma1R protein or coding gene thereof as target spot for treating chronic obstructive pulmonary disease
By using Sigma1R as a new target for the treatment of COPD, inhibiting its expression can significantly reduce cell programmed death, alleviate lung function and lung tissue damage, solve the problem of lack of precise intervention in existing COPD treatment methods, and provide new treatment strategies and drug basis.
Patent Information
- Application Number
- CN202510183005.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-19
- Publication Date
- 2025-05-30
AI Technical Summary
The existing COPD treatment methods lack precise interventions to target the nature of the disease, especially the limited targeted regulation of key molecules and pathogenic mechanisms, resulting in poor efficacy and significant side effects.
By exploring the expression of Sigma1R protein or its encoding gene in COPD and its impact on cell programmed death, Sigma1R is provided as a new target for the treatment of COPD, and substances that inhibit Sigma1R protein activity or reduce its encoding gene expression as therapeutic drugs.
Inhibition of Sigma1R expression can significantly reduce cell programmed death, alleviate lung function and lung tissue damage, and provide new therapeutic targets and drug basis for the treatment of COPD.
Smart Images

Figure CN120060465A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical technologies, and particularly to the application of Sigma1R protein or its encoding gene as a therapeutic target for chronic obstructive pulmonary disease. Background Art
[0002] Chronic obstructive pulmonary disease (COPD) is a chronic respiratory disease characterized by a persistent airway inflammatory response to harmful particles or gases, and has become the fifth largest public health burden and the third leading cause of death globally. The pathogenesis of COPD is complex and involves factors such as smoking, environmental pollution, and genetic susceptibility. Existing treatment methods include drug therapy and non-drug therapy. Drug therapy includes the use of bronchodilators, glucocorticoids, etc.; non-drug therapy includes pulmonary rehabilitation, lung transplantation, or oxygen therapy and mechanical ventilation, etc. Although these therapies can partially relieve symptoms and improve quality of life, they cannot cure the disease and are also difficult to reverse lung damage. Current COPD treatment methods mainly focus on symptomatic treatment, lacking precise intervention targeting the essence of the disease, especially limited targeted regulation of key molecules and pathogenic mechanisms in COPD. In addition, the efficacy of most drugs varies significantly among different patients, and the control over disease progression and end-stage complications is insufficient. Therefore, it is urgent to explore new treatment strategies.
[0003] Gene-targeted therapy is a cutting-edge direction in COPD research in recent years, which solves the limitations of existing therapies by precisely regulating the expression of disease-related genes. Compared with traditional treatment methods, gene-targeted therapy has the following significant advantages: 1) Precision of targeted therapy: The core of targeted therapy lies in identifying key pathogenic genes and molecular pathways of COPD and intervening in the disease process from the root. 2) Improving efficacy and reducing side effects: Traditional treatments often affect multiple physiological processes and may bring systemic side effects. Targeted therapy based on pathogenic genes can precisely act on diseased cells, reduce the impact on normal cells and tissues, improve efficacy while reducing adverse reactions. 3) Realization of personalized medicine: Gene-targeted therapy provides personalized treatment plans based on the genetic background and molecular characteristics of patients, which is more suitable for diseases with high heterogeneity such as COPD. 4) Reducing drug side effects: Traditional drugs often need to be used for a long time with significant side effects, while gene-targeted therapy can obtain long-term efficacy through short-term intervention, significantly reducing the incidence of side effects. 5) Potential disease repair ability: Some gene-targeted strategies can not only delay disease progression but also may achieve partial functional recovery through inducing tissue regeneration or repair.
[0004] Sigma1R is a receptor protein with chaperone activity encoded by the Sigma1R gene. Currently, it is believed that Sigma1R is generally located on the mitochondria-associated membranes (MAM) and is widely distributed in the central nervous system and other tissues. As a multifunctional receptor, Sigma1R shows extensive application potential in the fields of neuroprotection, pain regulation, bone metabolism, etc. There is currently no report on the application of Sigma1R in the treatment of chronic obstructive diseases. Summary of the Invention
[0005] (1) Technical problems to be solved
[0006] The purpose of the present invention is to overcome the limitations and deficiencies of existing treatment strategies and provide an application of Sigma1R protein or its encoding gene as a therapeutic target for COPD. The present invention explores the expression of Sigma1R in COPD and its impact on the progression of COPD disease involving programmed cell death. The results show that the expression of Sigma1R is significantly increased in COPD patients, rat models, and cell models. By reducing its expression, programmed cell death can be significantly reduced, and lung function and lung tissue damage can be significantly alleviated, providing a new therapeutic target for the treatment of COPD and a basis for the preparation of drugs for the treatment of COPD.
[0007] (2) Technical solutions
[0008] To achieve the above objectives, the present invention is achieved through the following technical solutions:
[0009] In the first aspect, the present invention provides an application of Sigma1R protein or its encoding gene as a therapeutic target for chronic obstructive pulmonary disease.
[0010] Specifically, through Pearson correlation analysis, we found that there was a statistically significant correlation between the mRNA expression of Sigma1R and the mRNA expressions of COPD biomarkers MMP1, MMP2, and MMP8 in the COPD lung gene expression dataset (GSE69818), indicating that Sigma1R plays an important role in the progression of COPD disease. Further, a COPD model rat was established by the method of cigarette smoke combined with repeated bacterial infection, and it was further verified that the expression of Sigma1R in the COPD model rat was significantly higher than that in healthy rats. It was also found that the high expression of Sigma1R induced the occurrence of autophagy, necroptosis, and pyroptosis, thereby causing lung tissue damage and weakened lung function. Based on the above research content, Sigma1R protein or its encoding gene has great potential as a new therapeutic target for COPD.
[0011] In a second aspect, the present invention provides the use of a substance that inhibits the activity of Sigma1R protein or reduces the expression of its encoding gene in the preparation of a medicament for treating chronic obstructive pulmonary disease.
[0012] Specifically, the substance that inhibits the activity of Sigma1R protein or reduces the expression of its encoding gene includes small interfering RNAs that specifically interfere with the expression of the Sigma1R encoding gene, or small molecule compounds that specifically inhibit Sigma1R protein or its encoding gene, or antibodies or aptamers that specifically bind to Sigma1R protein, or glycoside active substances in traditional Chinese medicine extracts.
[0013] Specifically, the small interfering RNAs that specifically interfere with the expression of the Sigma1R encoding gene include shRNA, siRNA, dsRNA, miRNA.
[0014] Specifically, the nucleotide sequence of shRNA is SEQ ID NO.1 or SEQ ID NO.2, specifically:
[0015] shSigma1R#1: TGCAGTGGGTGTTCGTGAATG SEQ ID NO.1
[0016] shSigma1R#2: TACGCAGAGCTTCGTCTTCCA SEQ ID NO.2
[0017] Specifically, the small molecule compound that specifically inhibits Sigma1R protein or its encoding gene is any one of BD1047, BD1063, and S1RA.
[0018] Specifically, the glycoside active substances in traditional Chinese medicine extracts include any one of icariin, ginsenoside Rh1, baicalin, astragaloside IV, and hesperidin.
[0019] Specifically, we established a COPD rat model by the method of cigarette smoke combined with repeated bacterial infection. The COPD rat model was respectively administered with the Sigma1R small molecule inhibitor BD1047 and icariin. Compared with healthy rats, both BD1047 and icariin achieved specific inhibition of Sigma1R, improved the lung function of COPD rats. The experimental results proved that inhibiting the expression of Sigma1R can reverse the COPD process involving smoke-induced autophagy, necroptosis, and pyroptosis, so as to achieve the purpose of treating COPD. Based on the above research content, the substance that inhibits the activity of Sigma1R protein or reduces the expression of its encoding gene can be used as a new drug for treating chronic obstructive pulmonary disease.
[0020] (III) Beneficial effects
[0021] The present invention for the first time discovers a statistically significant correlation between the mRNA expression of Sigma1R and the mRNA expressions of COPD biomarkers MMP1, MMP2, and MMP8, indicating that Sigma1R plays an important role in the progression of COPD. We established a COPD model rat by the method of cigarette smoke combined with repeated bacterial infection, and further verified that the expression of Sigma1R in the COPD model rat was significantly increased compared with that in healthy rats, which was consistent with the data analysis results, indicating that Sigma1R has the potential to be a new therapeutic target for COPD.
[0022] In animal experiments, we further found that high expression of Sigma1R induced the occurrence of autophagy, necroptosis, and pyroptosis, thereby causing lung tissue damage and weakened lung function; for this reason, we administered the Sigma1R small molecule inhibitor BD1047 and icariin to the COPD rat model respectively, and found that either the Sigma1R inhibitor or ICA could significantly improve the lung function of the COPD model rat. Compared with healthy rats, the expression levels of Sigma1R, autophagy, and necroptosis-related proteins (Beclin-1, ATG5, P-RIP3, and p-MLKL) in the lung tissue of the COPD model rat were significantly increased, and the changes in the expression levels of the above proteins could be reversed after treatment with ICA or BD1047. Cell experiments further verified the above conclusions. After CSE induced A549 cells, the expressions of Sigma1R, autophagy, and necroptosis-related proteins in A549 cells were significantly increased. After inhibiting the expression of Sigma1R, the COPD process involving autophagy, necroptosis, and pyroptosis induced by smoke could be reversed, so as to achieve the purpose of treating COPD.
[0023] All in all, we demonstrated that regulating programmed cell death mediated by targeting Sigma1R could be a new therapy for COPD. Sigma1R can be used as a new therapeutic target for COPD, and substances that inhibit the protein activity of Sigma1R or reduce the expression of its coding gene can be developed and studied as new drugs for the treatment of chronic obstructive pulmonary disease. Brief Description of the Drawings
[0024] Figure 1 It is the correlation between the mRNA expression of Sigma1R and MMP1, MMP2, and MMP8 in the GEO dataset of COPD lung tissue.
[0025] Figure 2 It is the lung function parameters [TV(a), MV(b), PEF(c), FVC(d), FEV0.3(e), and FEV0.3 / FVC(f)], HE staining of lung tissue (g), average alveolar number (h), and mean linear intercept graph (i) of each group of rats; compared with the model group, *P<0.05.
[0026] Figure 3 To detect the expression levels of Sigma1R, autophagy, and necroptosis-related proteins (Beclin-1, ATG5, P-RIP3, and p-MLKL) in the lung tissues of rats in each group by WB method; compared with the model group, *P<0.05.
[0027] Figure 4 To detect the expression and distribution of Sigma1R and RIP3 in the lung tissues of rats in each group by immunohistochemistry; compared with the model group, *P<0.05.
[0028] Figure 5 It is a diagram showing the effect of ICA on the expression levels of Sigma1R, autophagy, and necroptosis-related proteins in a cell model induced by smoke.
[0029] Figure 6 It is a diagram showing the effect of BD1047 on the expression levels of Sigma1R, autophagy, necroptosis, and pyroptosis-related proteins in a cell model induced by smoke.
[0030] Figure 7 It is a diagram showing the effect of BD1047 on the expression levels of Sigma1R, autophagy, and necroptosis-related proteins in a cell model induced by smoke and an autophagy activator.
[0031] Figure 8 It is an immunofluorescence staining diagram (A) and a transmission electron microscopy diagram (B) of cells induced by smoke treated with ICA and BD1047. Detailed implementation manners
[0032] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are some, rather than all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0033] Example 1
[0034] Based on the Pearson correlation analysis of the GSE69818 dataset in the GEO database, the differential expression of Sigma1R protein or its coding gene in chronic obstructive pulmonary disease was studied.
[0035] 1 Dataset acquisition
[0036] (1) Access the official website of the GEO database (Gene Expression Omnibus) provided by the National Center for Biotechnology Information (NCBI) of the United States and enter the GEO database.
[0037] (2) Enter the dataset number "GSE69818" in the search box to retrieve relevant data.
[0038] (3) Download the expression matrix file (such as Series Matrix File(s)) and annotation file on the dataset page for subsequent analysis.
[0039] 2 Data preprocessing
[0040] (1) Use R language or Python script to import the downloaded expression matrix file.
[0041] (2) According to the annotation file provided by GEO, map the probe ID to the corresponding gene name. For probes that are repeatedly mapped to the same gene, take their average or maximum value as the representative value.
[0042] (3) If the expression matrix data has not been normalized, perform standardization processing, such as logarithmic transformation (log2transformation) or Z-score normalization, to reduce the impact of technical biases.
[0043] 3 Target gene and feature selection
[0044] (1) Determine the position of the Sigma1R gene in the expression matrix and extract its expression value.
[0045] (2) According to the experimental purpose, select the candidate genes MMP1, MMP2, and MMP8 related to COPD and extract their corresponding expression data.
[0046] 4 Pearson correlation analysis
[0047] (1) Calculate the Pearson correlation coefficient between the expression value of the target gene (Sigma1R) and the expression value of each candidate gene. The formula for the correlation coefficient is:
[0048]
[0049] (2) Calculate the P-value simultaneously for evaluating the significance of the correlation.
[0050] (3) Use the Benjamini-Hochberg method for multiple testing correction to control the false discovery rate (FDR).
[0051] (4) Plot a scatter plot of the expression values of Sigma1R and significantly correlated genes to verify the correlation relationship.
[0052] 5 Results
[0053] Such as Figure 1As shown, there is a statistically significant correlation between the mRNA expression of Sigma1R and the mRNA expression of COPD biomarkers MMP1, MMP2, and MMP8. The results suggest that Sigma1R may play an important role in the progression of COPD.
[0054] Example 2
[0055] Effects of Sigma1R small molecule inhibitor BD1047 and icariin on a COPD rat model
[0056] 1 Model establishment and grouping treatment
[0057] Forty-eight SPF-grade SD rats, weighing 250 ± 20 g, all male, were selected. They were adaptively fed for 1 week before the experiment. Subsequently, the rats were randomly divided into a normal group (Normal group), a COPD model group (model group), an icariin (ICA) group (3.9 mg / kg / d), and a BD1047 group (54 mg / kg / d), with 12 rats in each group. Except for the Normal group, the other groups were established with a COPD rat model by using a method of cigarette smoke combined with repeated bacterial infection. The specific method was as follows: From week 1 to week 8, the rats were intranasally instilled with Klebsiella pneumoniae (6 × 10 8 CFU / mL, 0.1 mL / rat) once every 5 days, and at the same time, they were exposed to cigarette smoke (3000 ± 500 ppm) twice a day for 40 min each time. The normal group was only given normal saline. Starting from week 9, the normal group and the model group rats were intragastrically administered normal saline, and the ICA group and the BD1047 group rats were intragastrically administered ICA and BD1047 suspension. Each group was continuously administered for 8 weeks.
[0058] 2 Detection indexes
[0059] 2.1 Pulmonary function detection
[0060] After 16 weeks, first, the animal WBP pulmonary function detection system was opened to detect ventilation. After normal ventilation, the mice were placed in a mouse plethysmograph box, and the respiratory frequency (frequency, f), tidal volume (Tidal volume, TVb), minute ventilation volume (Minute volume, MVb), peak expiratory flow (Peak expiratory flow, PEF), and expiratory flow at 50% (Expiratory flow 50, EF50) were measured under the active state of the mice.
[0061] 2.2 Western blot
[0062] The expression levels of related proteins of Sigma1R, Beclin-1, ATG5, P-RIP3, and p-MLKL in the rat lung tissue were detected by Western blot.
[0063] 2.3 Histopathological staining of lung tissue
[0064] After the administration was completed, the rats were anesthetized with 3% sodium pentobarbital. The skin of the neck was incised, and the blood vessels and muscles were bluntly separated with hemostatic forceps to expose the trachea. A surgical thread was passed under the trachea, and an inverted "T" - shaped incision was made below the cricoid cartilage with ophthalmic scissors. The tracheal intubation was inserted into the trachea with the bevel facing upward, and the right bronchus was ligated. The left lung was perfused with 10% paraformaldehyde for 20 min and then fixed for 72 h, and the formaldehyde fixative was changed every 24 h. After the tissue was completely fixed, tissue blocks with a thickness of about 3 mm were cut for paraffin embedding. The embedded wax blocks were fixed on a microtome to cut thin slices with a thickness of 4 μm, placed in warm water, and after the slices were flattened, they were placed on glass slides coated with polylysine and baked in an oven at 60 °C for 3 h, and then HE staining and immunohistochemical staining were performed respectively.
[0065] 2.4 Detection of mRNA content by real - time quantitative PCR
[0066] RNA was extracted from lung tissue and reverse - transcribed into cDNA. Subsequently, an amplification reaction was carried out using a real - time fluorescence quantitative PCR instrument, and the relative expression level of mRNA was calculated according to the formula. The reverse - transcription system is shown in Table 1, and the gene primers used are shown in Table 2.
[0067] Table 1
[0068]
[0069] Table 2
[0070]
[0071]
[0072] 3 Statistical analysis
[0073] IBM SPSS Statistics 26.0 statistical software was used. One - Way ANOVA was used for comparison of data between groups. For data that conformed to normal distribution and had homogeneous variances, the Least Significant Difference (LSD) method was used, and for data with heterogeneous variances, Dunnett’s T3 test was used. The significance level was taken as α = 0.05. Data were statistically described as mean ± standard deviation.
[0074] 4 Results
[0075] 4.1 Effects of ICA and Sigma1R inhibitor BD1047 on lung function in a COPD rat model
[0076] The results are as Figure 2As shown in a-f, compared with the Normal group, the lung function of the rats in the Model group was significantly impaired, and the lung function parameters TV, MV, PEF, FVC, FEV0.3, and FEV0.3 / FVC all decreased significantly, with a significant difference (P<0.05); compared with the Model group, ICA and the Sigma1R inhibitor BD1047 significantly improved the impaired lung function parameters of the COPD rats, and the lung function parameters TV, MV, PEF, FVC, FEV0.3, and FEV0.3 / FVC all increased significantly, with a significant difference (P<0.05).
[0077] HE staining showed that compared with the Normal group, the number of alveoli in the rats of the Model group increased, and the alveolar diameter increased ( Figure 2 g-i); compared with the Model group, after treatment with ICA or the Sigma1R inhibitor in the rats, the number of alveoli decreased significantly, and the alveolar diameter decreased significantly, with a significant difference (P<0.05).
[0078] 4.2 Expression of Sigma1R, autophagy, and necroptosis-related proteins in the lung tissue of COPD rats
[0079] As Figure 3 shown, compared with the Normal group, the expression levels of Sigma1R, autophagy, and necroptosis-related proteins (Beclin-1, ATG5, P-RIP3, and p-MLKL) in the lung tissue of the rats in the Model group were significantly increased, with a significant difference (P<0.05). Compared with the Model group, after treatment with ICA or BD1047 in the COPD model rats, the changes in protein expression levels could be reversed, and the expression levels of Sigma1R, autophagy, and necroptosis-related proteins (Beclin-1, ATG5, P-RIP3, and p-MLKL) were significantly decreased, with a significant difference (P<0.05).
[0080] To determine whether the therapeutic effects of ICA and BD1047 on COPD rats were related to Sigma1R and necroptosis, we performed immunohistochemical staining. The results showed that compared with the Normal group, the expressions of Sigma1R and RIP3 on the alveoli of the rats in the Model group were both significantly increased; compared with the Model group, the expressions of Sigma1R and RIP3 in the ICA group and the BD1047 group were significantly decreased ( Figure 4 ).
[0081] 5 Conclusion
[0082] The above results indicate that both Sigma1R inhibitors and ICA can significantly improve the lung function of rats with COPD models. Compared with healthy rats, the expression levels of Sigma1R, autophagy, and necroptosis-related proteins (Beclin-1, ATG5, P-RIP3, and p-MLKL) in the lung tissues of rats with COPD models were significantly increased, and the changes in the expression levels of the above proteins could be reversed after treatment with ICA or BD1047.
[0083] Example 3
[0084] Mechanism of Sigma1R in smoke-induced human lung adenocarcinoma cells (A549)
[0085] 1 Cell culture and treatment
[0086] Human lung adenocarcinoma cells (A549) were cultured in RPMI 1640 medium containing 10% FBS, penicillin (10 U / mL), and streptomycin (50 μg / mL), and placed in an incubator at 37°C with 5% humidified CO 2 and 95% air for growth. Cells between passages 3 and 7 (P3-7) were stored in liquid nitrogen. For each experiment, a vial of P3-7 A549 was thawed, plated, and passaged at confluence; human lung adenocarcinoma cells between P10 and P15 were used. For all experiments, cells were starved in serum-free medium for 9 hours before treatment with cigarette smoke extract (CSE). In experiments involving pharmacological reagents, A549 cells were pretreated with medium containing the corresponding reagents (50 μg / mL ICA, 5 mM 3-MA, 100 nM rapamycin, 1 μM BD1047, 1 μM PRE-084) for 3 hours and then induced with CSE as described above.
[0087] 2 Western blot
[0088] The expression levels of Sigma1R, Beclin-1, ATG-5, RIP3, p-RIP3, MLKL, p-MLKL, and GAPDH-related proteins in A549 cells treated with different reagents were detected by Western blot.
[0089] As Figure 5 shown in A, after CSE induction of A549 cells, the expression of Sigma1R, autophagy, and necroptosis-related proteins (Beclin-1, ATG5, P-RIP3, and p-MLKL) in A549 cells was significantly increased; after treatment of CSE-induced A549 cells with ICA, ICA could significantly reduce the expression of Sigma1R, autophagy, and necroptosis-related proteins in CSE-induced A549 cells. As Figure 5As shown in Figure B, ICA decreased the expression of Sigma1R, autophagy-related proteins, and necroptosis-related proteins in CSE-induced A549 cells, while the Sigma1R agonist PRE-084 reversed the therapeutic effect of ICA.
[0090] Figure 6 The results also showed that BD1047 could inhibit the expression of Sigma1R in CSE-induced A549 cells, thereby inhibiting the expression of autophagy-, necroptosis-, and pyroptosis-related proteins.
[0091] In addition, before smoke treatment, we induced autophagy in A549 cells with the autophagy agonist rapamycin and then treated the A549 cells with BD1047. The results showed that rapamycin treatment increased the expression of autophagy- and necroptosis-related proteins, while BD1047 could reverse this effect. These results indicated that inhibiting autophagy involving Sigma1R could reverse the occurrence of necroptosis induced by smoke. The results are as Figure 7 shown.
[0092] 3 Immunocytochemistry and transmission electron microscopy
[0093] A549 cells were divided into a blank group (Control), a smoke-induced model group (CES), an ICA treatment group (CSE + ICA), and a BD1047 treatment group (CSE + BD1047). The specific methods are described in "1 Cell culture and treatment". Subsequently, the cells in each group were subjected to immunofluorescence staining and transmission electron microscopy.
[0094] As Figure 8 shown in Figure A, compared with the Control group, the expression of p-RIP3 and LC3B in CSE-induced A549 cells was significantly increased; compared with the CSE group, both CSE + ICA and CSE + BD1047 could reduce the expression of p-RIP3 and LC3B in A549 cells.
[0095] As Figure 8 shown in Figure B, compared with the Control group, the abundance of autophagolysosomes and swollen mitochondria in the CSE group of cells was significantly increased, the mitochondrial cristae were disrupted, and cytoplasmic vacuolization occurred; after treatment with ICA or BD1047, the above phenomena in the CSE + ICA and CSE + BD1047 groups of cells were significantly alleviated.
[0096] 4 Conclusion
[0097] According to the above results, after CSE induced A549 cells, the expression of Sigma1R, autophagy and necroptosis-related proteins (Beclin-1, ATG5, P-RIP3 and p-MLKL) in A549 cells was significantly increased. After inhibiting the expression of Sigma1R, the COPD process involving autophagy, necroptosis and pyroptosis induced by smoke can be reversed, so as to achieve the purpose of treating COPD.
[0098] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. Application of Sigma1R protein or its encoding gene as a target for the treatment of chronic obstructive pulmonary disease.
2. Use of substances that inhibit the activity of Sigma1R protein or reduce the expression of its encoding gene in the preparation of drugs for the treatment of chronic obstructive pulmonary disease.
3. Use of the substance for inhibiting the activity of Sigma1R protein or reducing the expression of its encoding gene according to claim 2 in the preparation of a drug for treating chronic obstructive pulmonary disease, characterized in that: The substance that inhibits the activity of Sigma1R protein or reduces the expression of its encoding gene includes small molecule interfering RNA that specifically interferes with the expression of Sigma1R encoding gene, or small molecule compounds that specifically inhibit Sigma1R protein or its encoding gene, or antibodies or embryos that specifically bind to Sigma1R protein, or glycoside active substances of traditional Chinese medicine extracts.
4. The substance for inhibiting the activity of Sigma1R protein or reducing the expression of its encoding gene according to claim 3, characterized in that: The small interfering RNA that specifically interferes with the expression of the Sigma1R encoding gene includes any one or more of shRNA, siRNA, dsRNA, and miRNA.
5. The substance for inhibiting the activity of Sigma1R protein or reducing the expression of its encoding gene according to claim 3, characterized in that: The nucleotide sequence of shRNA is SEQ ID NO.1 or SEQ ID NO.2, specifically: shSigma1R#1:TGCAGTGGGTGTTCGTGAATG SEQ ID NO.1shSigma1R#2:TACGCAGAGCTTCGTCTTCCA SEQ ID NO.
2.
6. The substance for inhibiting the activity of Sigma1R protein or reducing the expression of its encoding gene according to claim 3, characterized in that: The small molecule compound that specifically inhibits Sigma1R protein or its encoding gene is any one of BD1047, BD1063, and S1RA.
7. The substance for inhibiting the activity of Sigma1R protein or reducing the expression of its encoding gene according to claim 3, characterized in that: The glycoside active substances in the Chinese herbal medicine extract include any one of icariin, ginsenoside Rh1, baicalin, astragaloside I and hesperidin.
Citation Information
Patent Citations
Application of baicalin in preparing medicament for preventing and treating chronic obstructive pulmonary disease
CN102335187A
Use of icarlin in preparation of drug for preventing and treating chronic obstructive pulmonary diseases
CN102335188A
Traditional Chinese medicine component prescription for treating chronic obstructive pulmonary disease and application thereof
CN108904513A
Application of hesperidin in preparation of medicine for treating chronic obstructive pulmonary disease
CN115990179A