A molecular marker for identifying feed utilization traits in ducks based on the SIRT4 gene, its identification method and application

By developing molecular markers based on the SIRT4 gene, and using specific amplification and enzyme digestion to detect the molecular marker types in ducks, the problem of identifying feed utilization traits in ducks has been solved. This has enabled simple and efficient early selection and breeding methods, improving feed efficiency and the sustainability of duck farming.

CN120060483BActive Publication Date: 2025-12-02ANHUI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510153178.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-12
Publication Date
2025-12-02
Estimated Expiration
2045-02-12

AI Technical Summary

Technical Problem

In the poultry sector, especially in ducks, existing research is insufficient on the fatty acid metabolism regulation and lipid deposition mechanisms of the SIRT4 gene. There is a lack of in-depth exploration of its variation and expression patterns on feed conversion rate in broiler ducks, which affects the understanding and improvement of broiler duck growth, development and feed efficiency.

Method used

This study develops molecular markers based on the SIRT4 gene, designs specific amplification primers and restriction endonuclease digestion, and uses agarose gel electrophoresis to detect the molecular marker types in ducks, thereby identifying duck feed utilization traits and providing a simple, rapid, and low-cost breeding method.

Benefits of technology

This approach enables early selection and marker-assisted breeding of duck feed utilization traits, improving breeding efficiency, reducing breeding costs, and promoting the sustainable development of the poultry farming industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060483B_ABST
    Figure CN120060483B_ABST
Patent Text Reader

Abstract

This invention relates to a molecular marker for identifying duck feed utilization traits based on the SIRT4 gene, its identification method, and its application, belonging to the field of molecular marker technology. The nucleotide sequence of this molecular marker is shown in SEQ ID NO.1, wherein the 601st base of the nucleotide sequence is C or T. Based on the study of the relationship between the SIRT4 gene and duck feed utilization traits, this invention developed a molecular marker. By identifying the type of this molecular marker present in the duck genome, selection of duck feed utilization traits can be performed, establishing a breeding method for early selection of poultry feed utilization. This provides a new molecular marker-assisted breeding method for detecting duck growth traits. This method is simple, rapid, low-cost, and does not require special instruments, making it suitable for the needs of molecular marker-assisted breeding experiments.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker for identifying duck feed utilization traits based on the SIRT4 gene, its identification method, and its application. Background Technology

[0002] Residual Feed Intake (RFI) is defined as the difference between the actual feed intake and the expected feed intake of an animal given a certain body weight and weight gain. Therefore, the larger the RFI value, the lower the relative feed efficiency. In recent years, more and more breeders have begun to use RFI as the main indicator for measuring feed efficiency, and this trend has become more and more obvious with the development of the times. This is because using RFI for breeding can not only take into account daily weight gain and metabolic weight, but also has a relatively weak impact on important economic traits such as market weight. Moreover, the heritability of RFI is between 0.2 and 0.4 (Chen C, Su Z, Li Y, et al. Estimation of the genetic parameters of traits relevant to feed efficiency: result from broiler lines divergent for high or low abdominal fat content[J]. Poult Sci, 2021, 100(2): 461-466; Zhang Y, Guo ZB, Xie M, et al. Genetic parameters for residual feed intake in a random population of Pekin duck[J].Asian-Australas J Anim Sci, 2017, 30(2): 167-170.), belongs to the trait of medium heritability, so RFI can be used as a measure of feed efficiency in breeding.

[0003] SIRT4, a member of the sirtuin family, is a key factor in adipogenesis, regulating the proliferation and differentiation of preadipocytes (HO L, TITUS AS, BANERJEE KK, et al. SIRT4 regulates ATP homeostasis and mediates a retrograde signaling via AMPK[J]. Aging (Albany NY), 2013, 5(11): 835-49; LAURENT G, DE BOER VC, FINLEY LW, et al. SIRT4 represses peroxisome proliferator-activated receptorα activity to suppress hepatic fat oxidation[J]. Mol Cell Biol, 2013, 33(22): 4552-61.). Recent studies have found that SIRT4 is a key regulator of lipid homeostasis, inhibiting fatty acid oxidation and promoting lipid synthesis, indicating that SIRT4 can regulate the balance between lipid oxidation and synthesis.SIRT4 overexpression increases lipogenesis and decreases fatty acid oxidation, while SIRT4 knockdown has the opposite effect on lipid synthesis and catabolism in mouse adipocytes and myocytes (LI Y, ZHOU Y, WANG F, et al. SIRT4 is the last puzzle of mitochondrial sirtuins[J]. Bioorg Med Chem, 2018, 26(14):3861-5; PARIK S, TEWARY S, AYYUB C, et al. Loss of mitochondrial SIRT4 shortens lifespan and leads to a decline in physical activity[J]. J Biosci, 2018, 43(2):243-7.). Therefore, SIRT4 coordinates lipid homeostasis by promoting lipid synthesis and inhibiting lipid catabolism (DOLINSKY V W. The role of sirtuins in mitochondrial function and doxorubicin-induced cardiac dysfunction[J]. Biol Chem,2017,398(9):955-74;HERSHBERGER KA,MARTIN AS,HIRSCHEY M D.Role of NAD(+)and mitochondrial sirtuins in cardiac and renal diseases[J].Nat Rev Nephrol,2017,13(4):213-25.).The study found that SIRT4 mRNA expression was high in bovine subcutaneous fat; SIRT4 expression increased before day 7 of differentiation and then decreased with bovine adipocyte differentiation; in addition, SIRT4 knockdown significantly inhibited the expression of marker genes that promote bovine adipocyte differentiation. These results suggest that SIRT4 may play an important role in regulating the development of bovine adipose tissue (AHUJA N, SCHWER B, CAROBBIO S, et al. Regulation of insulin secretion by SIRT4, a mitochondrial ADP-ribosyltransferase[J]. J Biol Chem, 2007, 282(46):33583-92; HAIGIS MC, MOSTOSLAVSKY R, HAIGIS KM, et al. SIRT4 inhibits glutamate dehydrogenase and opposes the effects of calorie restriction in pancreatic beta cells[J]. Cell, 2006, 126(5):941-54.).

[0004] Based on the existing findings, it can be inferred that the SIRT4 gene may be an important candidate gene for regulating duck feed efficiency. However, current research on the SIRT4 gene mainly focuses on mice, fish, and humans, with insufficient research in the poultry field, especially on ducks. Existing research largely revolves around fatty acid metabolism regulation and lipid deposition mechanisms in the body. Therefore, it is crucial to explore the specific impact of SIRT4 gene variation and expression patterns on feed conversion ratio in broiler ducks and to reveal the underlying molecular mechanisms. This will not only help us to more comprehensively understand the key role of the SIRT4 gene in the growth, development, and feed utilization of broiler ducks, but also provide a strong theoretical basis for improving feed efficiency in broiler ducks, helping to reduce the cost of broiler duck farming and promoting the sustainable development of the poultry industry. Based on the above, this invention proposes a molecular marker for identifying duck feed utilization traits based on the SIRT4 gene, along with its identification method and application. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker for identifying duck feed utilization traits based on the SIRT4 gene, as well as its identification method and application, in order to solve the above-mentioned problems.

[0006] The present invention achieves the above objectives through the following technical solutions:

[0007] This invention provides a molecular marker for identifying duck feed utilization traits based on the SIRT4 gene. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the 601st base of the nucleotide sequence is C or T.

[0008] This invention also provides the application of molecular markers in identifying duck feed utilization traits.

[0009] As a further optimization of the present invention, if the molecular marker type of the duck to be tested is TT, the duck has the best feed utilization trait; if the molecular marker type of the duck to be tested is CT, the duck has a moderate feed utilization trait; and if the molecular marker type of the duck to be tested is CC, the duck has a poor feed utilization trait.

[0010] The present invention also provides a method for identifying duck feed utilization traits using the above-mentioned molecular markers, comprising the following steps:

[0011] (1) Extract total DNA from the blood of the medial metatarsal vein of the duck to be tested;

[0012] (2) Design specific amplification primers with molecular marker nucleotide sequences as target sequences, use total DNA as template, and perform PCR amplification using specific amplification primers to obtain amplification products;

[0013] (3) Sequencing and genotyping of the amplification products to obtain the molecular marker type of the duck to be tested;

[0014] (4) Determine the duck feed utilization trait based on the molecular marker type.

[0015] As a further optimization of the present invention, the sequence of the specific amplification primers is as follows:

[0016] SEQ ID NO.2: Forward primer: TACCTGCCCTGTGTTTCTGTT;

[0017] SEQ ID NO.3: Reverse primer:ACCCTGACTGAGACACGAGA.

[0018] As a further optimization of the present invention, the method for genotyping detection is to obtain enzyme digestion products by digesting the amplification products, detect the enzyme digestion products by agarose gel electrophoresis, and perform genotyping based on the images. If the enzyme digestion product contains 1 band, it is TT type; if it contains 2 bands, it is CC type; and if it contains 3 bands, it is CT type.

[0019] As a further optimization of the present invention, the amplification product is digested with PspXⅠ restriction endonuclease.

[0020] The beneficial effects of this invention are as follows:

[0021] This invention is based on the study of the relationship between the SIRT4 gene and duck feed utilization traits. A molecular marker was developed, and by identifying the type of this molecular marker present in the duck genome, selection of duck feed utilization traits can be carried out. This establishes a breeding method for early selection of poultry feed utilization, and provides a new molecular marker-assisted breeding method for detecting duck growth traits. This method is simple, rapid, low-cost, and does not require special instruments, making it suitable for the needs of molecular marker-assisted breeding experiments. Attached Figure Description

[0022] Figure 1 Agarose gel electrophoresis images of PCR amplification products from a portion of the samples;

[0023] Figure 2 Agarose gel electrophoresis image of the enzyme digestion products obtained by enzyme digestion of PCR amplification products from a portion of the samples;

[0024] Figure 3 This is the genotype verification sequencing result for the C7966571T site (site 601 in SEQ ID NO.1) in the duck SIRT4 gene. Detailed Implementation

[0025] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0026] 1. Materials

[0027] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0028] 2. Method

[0029] 2.1 Primer Design

[0030] The DNA sequence corresponding to the SIRT4 gene (Gene ID: NC_051787.1) shown in SEQ ID NO.1 was found in the duck genome database. Using the partial DNA sequence of the SIRT4 gene (the sequence consisting of the molecular marker site and its upstream and downstream bases) as a template, specific amplification primers were designed. The specific amplification primer sequences are as follows:

[0031] SEQ ID NO.2: Forward primer: TACCTGCCCTGTGTTTCTGTT;

[0032] SEQ ID NO.3: Reverse primer:ACCCTGACTGAGACACGAGA.

[0033] The amplifiable region of the primer is 590 bp in length, and the amplified sequence is shown in SEQ ID NO.4, which contains a molecular marker of the C / T mutation at the C7966571T site (the 601st site in SEQ ID NO.1).

[0034] 2.2 Extraction of total DNA from blood

[0035] Forty-five Qiangying ducks were selected, and blood was collected from the medial metatarsal vein. Total DNA was extracted from the blood. The total DNA was extracted from the blood samples from the medial metatarsal vein using a blood DNA extraction kit produced by Tiangen Biotech Co., Ltd. The extraction steps were performed according to the kit instructions.

[0036] 2.3 PCR amplification

[0037] Using Mix produced by Shanghai Yisheng Biotechnology Co., Ltd., PCR amplification of the target fragment of the SIRT4 gene was performed using pre-synthesized sequencing-specific primers. The PCR amplification system is shown in Table 1.

[0038] Table 1 PCR amplification system

[0039] Components Dosage DNA template 1μL Forward primer 1μL Reveres primer 1μL Mix 10μL <![CDATA[ddH2O]]> 7μL total 20μL

[0040] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; first step denaturation at 95℃ for 45 s; second step annealing at 64.8℃ for 45 s (annealing temperature is set according to the primers); third step extension at 72℃ for 30 s, with the second and third steps repeated 31 times for a total of 32 cycles; and a final extension at 72℃ for 10 min.

[0041] 2.4 Detection and sequencing of PCR amplification products

[0042] PCR amplification products were detected using 2% agarose gel electrophoresis, such as... Figure 1 As shown, after imaging with a gel imaging system, a band of approximately 590 bp in length was obtained, which is consistent with the predicted length, indicating that the target fragment was obtained. The PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. (Nanjing), and the sequence is shown in SEQ ID NO.4, which is consistent with the predicted result.

[0043] 2.5 Genotyping

[0044] 2.5.1 Prepare the enzyme digestion system as shown in Table 2. The enzyme digestion conditions are 37℃ water bath for 1 hour. Use Psp XⅠ restriction endonuclease from Beijing Biolabs Technology Co., Ltd. to digest the PCR amplification product.

[0045] Table 2 Enzyme digestion system

[0046] Components Dosage PCR amplification products 0.4μL PspXⅠ 0.4 μL (5 U / μL) buffer 2μL <![CDATA[ddH2O]]> 7.2μL total 10μL

[0047] 2.5.2 Detection was performed using 1.5% mass ratio low-voltage agarose gel electrophoresis to obtain results such as... Figure 2 The results shown are partial; among them, if the enzyme digestion product contains 1 band, it is of the TT type; contains 2 bands, it is of the CC type; and contains 3 bands, it is of the CT type.

[0048] 2.6 Enzyme digestion and sequencing verification

[0049] Statistical analysis of the agarose gel electrophoresis images of gene restriction enzyme genotyping yielded three genotypes: TT, CT, and CC. One individual was selected from each of these three genotypes for sequencing alignment. The sequencing alignment results are shown below. Figure 3 As shown in the sequencing results, C mutated to T, and the arrows indicate the mutation locations, which is consistent with the enzyme digestion typing results.

[0050] 2.7 Effect Verification

[0051] To determine the association between the C / T polymorphism at the C7966571T locus of the duck SIRT4 gene and important phenotypic traits in ducks, 475 Qiangying ducks from section 2.2 were used as experimental materials. Feed intake (ADFI), average daily gain (ADG), and metabolite weight gain (MBW) were recorded from 21 to 42 days of age. 0.75 ), feed conversion ratio (FCR), and residual feed intake (RFI) were determined. The 2.5 genotyping method was used to genotype 475 Qiangying ducks, and the results are shown in Table 3.

[0052] Table 3. Genotype detection results for individuals with different phenotypes

[0053]

[0054] Experimental conclusion: The chi-square test results showed that the genotypes of the experimental duck population were in Hardy-Weinberg equilibrium (P>0.05).

[0055] 2.8 Statistical Analysis

[0056] The association between the three genotypes and the duck feed utilization trait was analyzed using the least squares method in SAS 9.4 software. The association analysis results between different genotypes and each trait are shown in Table 4.

[0057] Table 4. Association analysis between duck SIRT4 genotype and duck feed utilization rate trait.

[0058]

[0059] Note: Different lowercase letters in the same row indicate significant differences (P < 0.05), and different uppercase letters in the same row indicate extremely significant differences (P < 0.01).

[0060] Experimental conclusions: As shown in Table 4, for the SIRT4 gene C7966571T locus, the feed conversion ratio (FCR) of CC genotype individuals was significantly higher than that of TT genotype individuals. The FCR, age-dependent feed intake (ADFI), and residual feed intake (RFI) of CC genotype individuals were extremely significantly higher than those of TT genotype individuals. There were no significant differences among the three genotypes in terms of average daily gain (ADG) and metabolite weight gain (MBW 0.75). Therefore, it can be concluded that the TT genotype individuals had the best feed utilization trait, the CT genotype individuals had a moderate feed utilization trait, and the CC genotype individuals had a poor feed utilization trait. In other words, the TT genotype is the favorable genotype.

[0061] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of a molecular marker in identifying duck feed utilization traits, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the 601st base of the nucleotide sequence is C or T; The ducks in question are Qiangying ducks. If the molecular marker type of the Qiangying duck to be tested is TT, the feed utilization trait of this Qiangying duck is the best; if the molecular marker type of the Qiangying duck to be tested is CT, the feed utilization trait of this Qiangying duck is moderate; if the molecular marker type of the Qiangying duck to be tested is CC, the feed utilization trait of this Qiangying duck is poor.

2. A method for identifying duck feed utilization traits using molecular markers as described in claim 1, characterized in that, Includes the following steps: (1) Extract total DNA from the blood of the medial metatarsal vein of the Qiangying duck to be tested; (2) Design specific amplification primers using the nucleotide sequence of the molecular marker as the target sequence, and use the total DNA as a template to perform PCR amplification using the specific amplification primers to obtain the amplification product; (3) Genotyping the amplification products to obtain the molecular marker type of the Qiangying duck to be tested; (4) Determine the feed utilization rate of Qiangying ducks based on the molecular marker type.

3. The method according to claim 2, characterized in that, The sequence of the specific amplification primers is as follows: SEQ ID NO.2: Forward primer: TACCTGCCCTGTGTTTCTGTT; SEQ ID NO.3: Reverse primer:ACCCTGACTGAGACACGAGA.

4. The method according to claim 2, characterized in that, The genotyping detection method involves obtaining enzyme digestion products through enzyme digestion amplification, detecting the enzyme digestion products using agarose gel electrophoresis, and performing genotyping based on the images. If the enzyme digestion products: If it contains one stripe, it is of type TT; If it contains two stripes, it is of type CC; If it contains 3 bands, it is a CT type.

5. The method according to claim 4, characterized in that, The amplified product was digested with PspXⅠ restriction endonuclease.

Citation Information

Patent Citations

  • Molecular marker for identifying duck feed utilization rate character based on ELOVL2 gene as well as identification method and application thereof

    CN116574812A

  • Molecular marker for identifying trait of efficiency of duck feed utilization based on neuropeptide gene NPY, method and use thereof

    US20230357867A1