SNP (Single Nucleotide Polymorphism) molecular marker for identifying pork color and intramuscular fat content, primer and application of SNP molecular marker

Abstract

The invention relates to the technical field of pig breeding, in particular to an SNP molecular marker for identifying pork color and intramuscular fat content, a primer and application of the SNP molecular marker, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, N at the 140th site of the molecular marker is an SNP site, and the polymorphism is C or G; the pork color and intramuscular fat content of the pig with the site of GG genotype are higher than those of the pig with the site of CC genotype and CG genotype. The method can be applied to continuous breeding of the pig and early breeding in production.

Description

Technical Field

[0001] The present invention relates to the technical field of pig breeding, and specifically relates to SNP molecular markers, primers for identifying pork meat color and intramuscular fat content, and their applications. Background Art

[0002] In the past few decades, pig breeding enterprises have focused on growth-related qualities such as growth rate, lean meat percentage, and feed conversion rate, mainly meeting consumers' demands in terms of quantity. However, there is often a negative correlation between pig growth quality and pork quality. While improving growth quality, the meat quality will inevitably decline. However, people are more pursuing the taste and flavor of the meat. Therefore, the improvement of meat quality has also become the key research work of each breeding enterprise.

[0003] Currently, traditional breeding methods mainly rely on phenotypic selection, such as intuitive traits like body weight and body shape. Their limitations are slow genetic progress, long breeding cycles, and difficulty in early prediction of complex traits such as meat quality, reproductive performance, and disease resistance, resulting in low breeding efficiency. And it is difficult to accurately identify superior individuals at an early stage, relying on the accumulation of multi-generation phenotypic data, which significantly increases the time and economic costs.

[0004] With the development of disciplines such as genomics, molecular biology, and bioinformatics, the wide application of high-throughput sequencing technology, genotyping technology, and gene editing technology, as well as the implementation and completion of the whole-genome sequencing and haplotype project of pigs, have greatly promoted the identification of genes with great breeding value in pigs. SNP markers refer to the polymorphisms of DNA sequences caused by single nucleotide variations in the genome. They have characteristics such as a large number, high accuracy, and high polymorphism. In breeding practice, SNPs can be used to locate certain excellent genes, determine the association between markers and specific qualities in combination with phenotypes, and molecular markers can also be verified in populations and applied in molecular breeding. However, further exploration and research are still needed to develop corresponding SNP molecular markers for the two phenotypes of pork meat color brightness and intramuscular fat content. Summary of the Invention

[0005] The purpose of the present invention is to provide SNP molecular markers, primers for identifying pork meat color and intramuscular fat content, and their applications to solve the above technical problems.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The present invention provides a SNP molecular marker for identifying pork meat color and intramuscular fat content. Its nucleotide sequence is as shown in SEQ ID NO.1. The N at the 140th position of this sequence is the SNP site, and the polymorphism is C or G. The meat color and intramuscular fat content of pigs with the GG genotype at this site are both higher than those of pigs with the CC genotype and CG genotype at this site.

[0008] Based on the collection of the longissimus dorsi muscle of Songlei black pigs, the present invention conducts an analysis of meat quality traits, detects the polymorphism of the second exon of the FSD2 gene by direct sequencing method, analyzes the correlation between the existing polymorphic sites and meat quality traits, obtains molecular markers related to the meat quality of Songlei black pigs, and applies them to the continuous breeding of Songlei black pigs and early seed selection in production.

[0009] The present invention also provides a pair of specific primers for amplifying the above SNP molecular markers, including an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3.

[0010] The present invention also provides a kit for detecting pork meat color and intramuscular fat content, and the kit includes the above specific primers.

[0011] Furthermore, the kit also includes 2×Premix buffer.

[0012] The present invention also provides the application of the SNP molecular marker, the specific primer or the kit in identifying pork meat color and intramuscular fat content.

[0013] The present invention also provides the application of the SNP molecular marker, the specific primer or the kit in pig breeding or assisting pig breeding, and the assisting pig breeding is to breed pigs with high meat color and intramuscular fat content.

[0014] The present invention also provides a method for identifying pork meat color and intramuscular fat content, including the following steps:

[0015] S1. Extract the genomic DNA of the pig to be tested;

[0016] S2. Using the genomic DNA of the pig to be tested as a template, amplify with the above specific primers to obtain an amplification product;

[0017] S3. Identify the genotype at the 140th position of the amplification product, and judge the pork meat color and intramuscular fat content according to the genotype;

[0018] S4. The judgment method is: the meat color and intramuscular fat content of pigs with the GG genotype at the 140th SNP site of the amplification product are higher than those of pigs with the CC genotype and CG genotype at this site.

[0019] Furthermore, the reaction system for amplification is: 0.4 - 0.6 μL of each of the upstream and downstream primers, 0.4 - 0.6 μL of the genomic DNA of the pig to be tested, 9 - 11 μL of 2×Premix buffer, and 10 - 12 μL of water;

[0020] The reaction procedure is as follows:

[0021] (1) Pre-denaturation at 94 - 98°C for 4 - 6 min;

[0022] (2) Denaturation at 94 - 97°C for 25 - 35 s;

[0023] (3) Annealing at 55 - 65°C for 25 - 35 s;

[0024] (4) Extension at 70 - 74°C for 45 - 60 s;

[0025] (5) Repeat steps (2) - (4) for 25 - 35 cycles;

[0026] (6) Extension at 70 - 74°C for 4 - 6 min.

[0027] The present invention has the following beneficial effects:

[0028] For breeding pigs, unfavorable genotype individuals can be eliminated through genotype detection to improve the overall meat quality of the offspring population; for piglets, the meat quality after fattening can be predicted at birth, and beneficial genotypes can be used for high-quality pork production, which has the advantages of high breeding efficiency, saving time and cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0030] Figure 1 It is the sequencing map of different genotypes of SNP loci of porcine FSD2 gene. Among them, A is the sequencing map of GG genotype, B is the sequencing map of CG genotype, and D is the sequencing map of CC genotype. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The following will describe the specific embodiments of the present invention in detail, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0032] Example 1: Development of SNP molecular markers for identifying pork color and intramuscular fat content.

[0033] I. Experimental setup.

[0034] The experimental pig breed in this application is Songlei black pig, and the samples are from Jilin Xinghui Qipan Agricultural Science and Technology Co., Ltd. 158 Songlei black pigs weighing about 100 kg were selected for slaughter. The longissimus dorsi muscle was collected 24 hours after slaughter, and the thawing water loss rate was measured by determining the water loss of the longissimus dorsi muscle before and after thawing. The initial moisture was measured by the 65°C drying method. The meat color and pH value were measured using a meat colorimeter and a pH meter. The pressurized water loss rate was measured by the pressurized weight method. The intramuscular fat content and shear force were measured by the extraction method and the cutting method. Blood was collected to extract DNA, specific primers were designed, and the entire sequence of the second exon of FSD2 was obtained by PCR. The SNP sites were detected by direct sequencing, and the SPSS 26.0 software was used to analyze the correlation between the SNP sites and the meat quality traits of Songlei black pigs.

[0035] The genomic DNA of pigs was extracted by first cutting the tissue into small pieces with a sterilized ophthalmic scissors, homogenizing it, and then using a genomic DNA kit (DP304) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0036] II. SNP molecular marker research and development.

[0037] 1. Primer design and synthesis.

[0038] Primers were designed according to the sequence of the second exon of the pig FSD2 (Ensembl ID: ENSSSCT00000002022.5) gene in Ensemble, and the sequences were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. The primer sequence information is shown in Table 1.

[0039] Table 1: Primer sequences of the pig FSD2 gene

[0040]

[0041] 2. PCR amplification.

[0042] PCR amplification was performed on the mixed genomic DNA of 60 Songlei black pigs using the above primers. The PCR reaction system: 0.5 μL of each upstream and downstream primer, 0.5 μL of the mixed genomic DNA, 10 μL of 2×Premix buffer, and 11 μL of water were added. The PCR running program was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 50 s for a total of 30 cycles; 72°C for 5 min. The SNP molecular marker sequence information is as shown in SEQ ID NO.1:

[0043] SEQ ID NO.1: AAATTGTGGATGAGTTGAGCCCAATCTAATAACCATCT AGTGCACTGACCTCAGAAATGGGGTTTTCTGTTCTAGGACCCAGGATATCTATTAATAACTGTCCAAAAAGAAACCTTCCTGTGCAGAGGGGCTGCCCCGANCATCCAGAGCCACGATGGAAGAGGAAGCAGGTGAGGCCCCGGGGCTGGGCAGGCCCGCTGCTCCTAAGGATTTCCACTTTTATCACGTGGATCTGTACGACTCTGAAGACAGACTGCAGATCTTCCCGGAAGGAAACGCTCGGATGCGAAGAGAGGTAGTCCAGGCTGAAATGACCAACGAACCAAGAGCAGCCGTGAAAGGGAAGGCTCCGAGAGACCTTGAAGAAGAAGTGGATGAACTTGTCCATCTTTACGGACTTGAAGATGATCATGAATTAGGCGATGCATTCGTTGACGAAAGCATGCCCAGAATAGAGGTTTCAGAGTATCCTCCTTATGGGATGACGGGGAGAGAAGCAGCCAGGGAGCAGAGAGACTGGAGACTTAGCGGGGAGGAGGCTAATGCAGAGGACCTGGGCTTGGGGGGCTGGGGCTCGGCGGACCAGTGCCAGGACTTGCGGGAAGCCTATAGGTATACCCATGGCCGTGCCAGTGAGGAGTATGAATGCTACGTCATCCCAGAGGAGGAAGACGAGGATGAAGCTGCGGATGTCTTCTGTGTCACCTGCAAAACACCAGTCAGAGCTTTGGAGGTTTCTGATGAACACAAGGAACATGAGGTAACCCCACTCCATAAAGCACTGGAAAGCGCCAAGGTAA。

[0044] 3. Detection of polymorphisms in the porcine FSD2 gene.

[0045] Use SeqMan in DNASTAR to align the sequences in the Ensemble database with the sequenced nucleotide sequences to screen for polymorphic sites. Perform PCR amplification on the fragments containing polymorphic sites. The reaction system and procedure are as shown above. After amplification, sequence the PCR products. The sequencing results of the SeqMan alignment are as Figure 1As shown, one SNP locus was found at 140 bp of the PCR product sequencing results, and three genotypes, namely GG, CG, and CC, all existed.

[0046] III. Verification of the association analysis between SNP molecular markers and pork quality.

[0047] 1. Genotype frequency and gene frequency

[0048] The genotype frequency and gene frequency of this SNP locus were analyzed, and the results are shown in Table 2. GG and G were the dominant allele genotypes and the dominant allele, respectively. Chi-square test indicated that the above SNP locus was in Hardy-Weinberg equilibrium (P>0.05).

[0049] Table 2 Analysis of genotype frequency and gene frequency

[0050]

[0051] 2. Association analysis between SNP locus and meat quality

[0052] The meat quality traits of 158 Songlei black pigs weighing about 100 kg were statistically analyzed, and the T-TEST was used to analyze the significant differences in meat quality traits among different genotype groups. As shown in Table 3, the polymorphism of the SNP molecular marker locus was related to lightness, yellowness, and intramuscular fat content. The lightness of individuals with the GG genotype was significantly higher than that of the CC genotype, the yellowness was significantly lower than that of the CC genotype, and the intramuscular fat content was extremely significantly higher than that of the CC genotype. Selecting GG-type black pig individuals can improve meat color and increase intramuscular fat content, which can be used for early breeding selection to accelerate the breeding process of breeding pigs.

[0053] Table 3: Verification of the association analysis between SNP locus and meat quality

[0054]

[0055]

[0056] Note: Different lowercase letters represent significant differences (P<0.05), and different uppercase letters represent extremely significant differences (P<0.01).

[0057] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concepts.

[0058] Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and deformations.

Claims

1. A SNP molecular marker for identifying meat color and intramuscular fat content of pigs, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1. The N at position 140 of the molecular marker is a SNP site with a polymorphism of C or G. The meat color and intramuscular fat content of pigs with the GG genotype at this site are higher than those of pigs with the CC genotype and CG genotype at this site.

2. A specific primer for amplifying the SNP molecular marker according to claim 1, characterized in that: It includes an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.

3.

3. A kit for detecting pork color and intramuscular fat content, characterized in that: The kit comprises the specific primer according to claim 2.

4. The kit according to claim 3, characterized in that The kit also includes 2×Premix buffer.

5. Use of the SNP molecular marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in identifying pork color and intramuscular fat content.

6. Use of the SNP molecular marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in pig breeding or assisted pig breeding, characterized in that: The assisted pig breeding is to breed pigs with high meat color and intramuscular fat content.

7. A method for identifying pork color and intramuscular fat content, characterized in that: The following steps are involved: S1, extracting the pig genomic DNA to be tested; S2, using the porcine genomic DNA as a template, and using the specific primers according to claim 2 to perform amplification to obtain an amplified product; S3, identifying the genotype of position 140 of the amplified product, and determining the pork color and intramuscular fat content according to the genotype; S4. The judgment method is: when the SNP site at position 140 of the amplification product is the GG genotype, the meat color and intramuscular fat content of the pigs are higher than those of the pigs with the CC genotype and CG genotype at the site.

8. The method for identifying pork color and intramuscular fat content according to claim 7, characterized in that: The amplification reaction system is: 0.4-0.6 μL of upstream and downstream primers, 0.4-0.6 μL of pig genomic DNA to be tested, 9-11 μL of 2×Premix buffer, and 10-12 μL of water; the reaction procedure is as follows: (1) Pre-denaturation at 94-98°C for 4-6 min; (2) Denaturation at 94-97°C for 25-35 seconds; (3) Annealing at 55-65°C for 25-35 seconds; (4) 70-74°C for 45-60 seconds; (5) Repeat (2) to (4) for 25 to 35 cycles; (6) Extend at 70 to 74°C for 4 to 6 min.

Images