Primer composition for nontuberculous mycobacterium identification, mycobacterium tuberculosis complex identification and drug resistance gene detection and application thereof

Abstract

The invention discloses a primer composition for nontuberculous mycobacterium identification, mycobacterium tuberculosis complex identification and drug resistance gene detection and application of the primer composition. The method comprises the following steps: simultaneously amplifying a plurality of target areas on genome DNA through a multiplex PCR technology to obtain amplicons, then adding second-generation sequencing linkers to two sides of the amplicons through a PCR mode to obtain an amplicon library, carrying out second-generation sequencing to obtain sequence information of the target areas, and determining the sequence information of the target areas according to the sequence information of the target areas. Therefore, the mycobacterium tuberculosis complex group and the nontuberculous mycobacterium are identified, and the drug-resistant gene is detected. After hundreds of SNP and InDel loci are amplified, a sequencing platform is used for detection, and deep data analysis based on a bioinformatics method is carried out. Based on multi-parameter primer design, the identification capability of mycobacterium tuberculosis complex groups and nontuberculous mycobacteria is greatly improved, meanwhile, the detection range of drug-resistant sites is widened, and missing detection of drug-resistant genes is avoided.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection technology, and specifically relates to a primer composition for identifying nontuberculous mycobacteria, identifying Mycobacterium tuberculosis complex and detecting drug-resistant genes, and its application in guiding Mycobacterium tuberculosis complex screening, nontuberculous mycobacteria screening and tuberculosis drug resistance detection. Background Art

[0002] Mycobacterium tuberculosis (MTB) can invade many organs, most commonly affecting the lungs and forming pulmonary tuberculosis. Tuberculosis is a contagious disease. Patients excreting the bacteria are a significant source of infection. The fundamental pathological features of the disease are exudates, caseous necrosis, and other proliferative tissue reactions, which may form cavities. Clinically, the disease often presents as a chronic course, manifested by cough, hemoptysis, low-grade fever, weight loss, and fatigue. With timely diagnosis and appropriate treatment, most cases are clinically reversible.

[0003] Nontuberculous mycobacteria (NTM) are widespread environmental mycobacteria. Recent studies indicate that NTM incidence is significantly higher. In the United States, experts in the field estimate that pulmonary NTM is at least 10 times more common than MTB, with at least 150,000 cases annually. Most NTM cases involve Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii. Advances in species identification have led to a continuous increase in the number of NTM species. By the end of 2015, the number of confirmed NTM species and subgroups had reached 173. NTM can present with both the manifestations of tuberculosis and its own unique characteristics, making diagnosis difficult. Specimen identification is required for definitive diagnosis, and NTM is often misdiagnosed as tuberculosis. Because NTM are resistant to most antibiotics and first-line anti-TB drugs, treatment is often suboptimal. Often, even after one year of anti-TB treatment, NTM continues to shed bacteria, requiring species identification for diagnosis. Consequently, there is a high clinical need for NTM species identification.

[0004] Next-generation sequencing (NGS) technology can obtain nucleic acid sequences from test samples quickly and at a low cost. In the field of pathogen detection, NGS technology can rapidly identify microorganisms and detect drug-resistant genes based on their specific sequences, making it a powerful research technology in microbiology research.

[0005] Using NGS technology to detect Mycobacterium tuberculosis-infected samples and obtain nucleic acid sequence information of M. tuberculosis-specific fragments helps accelerate detection and improve detection accuracy, advancing research on the epidemiology of M. tuberculosis. Traditional methods for identifying M. tuberculosis include smear microscopy and microbial culture. However, microscopy is expensive, has low sensitivity, and microbial culture is time-consuming. With the development of polymerase chain reaction (PCR) and next-generation sequencing (NGS) technologies, PCR has also been gradually adopted for the detection of M. tuberculosis. Compared with traditional detection technologies, PCR technology has the advantages of speed and accuracy. By analyzing specific fragments of M. tuberculosis, such as long restriction fragments, spacer oligonucleotides, and variable repeat sequences, it can identify and type M. tuberculosis complex and detect mutation sites associated with drug resistance genes, thereby achieving the identification of M. tuberculosis complex and the detection of drug resistance mutations. In recent years, some patents have emerged for the identification of Mycobacterium tuberculosis and the detection of drug-resistance gene sites for some drugs. For example, Chinese Patent 201210184401.8 discloses a non-fluorescent DNA microarray detection method and kit for multidrug-resistant Mycobacterium tuberculosis, including PCR forward and reverse amplification primers and oligonucleotide probe sequences for nucleic acid fragments of the main drug-resistance genes of Mycobacterium tuberculosis, which can detect mutations at sites 511, 516, 526, 531 and 533 of the rpoB gene, site 315 of the katG gene, and site -15 of the inhA gene, and can quickly detect mutations in the main drug-resistance genes of Mycobacterium tuberculosis, including rifampicin and isoniazid. Chinese patent 201410093113.0 discloses a method for extracting Mycobacterium tuberculosis DNA and a kit for detecting its multidrug resistance. The method involves extracting DNA to be tested from clinical samples, using fluorescent real-time quantitative PCR to determine Mycobacterium tuberculosis infection, identify drug resistance and the type of drug-resistant strain that is infected, and determine the number of pathogens infected. It can detect 29 drug-resistant gene sites for rifampicin, isoniazid, and ethambutol. The method is simple and quick to use, and the results are accurate and reliable. Chinese patent 201911415507.2 discloses a Mycobacterium tuberculosis resistance detection kit and a Mycobacterium tuberculosis resistance detection method, including sequencing primers for Mycobacterium tuberculosis resistance genes (one or more of rpoB, katG, inhA-promoter, inhAstructural, furA, embB, ubiA, pncA, rpsA, gyrA, gyrB, eis, rpsL, rrs, tlyA, rplC and rrl genes); Mycobacterium tuberculosis nucleic acid detection reagents (primer pair 1 for IS6110, primer pair 2 for IS6110 and probe primer for IS6110); and drug resistance detection.It has excellent sensitivity, specificity, and accuracy, and can simultaneously detect mutations at 48 sites of 17 common anti-tuberculosis drug-resistant genes and deletions of a gene spacer fragment, which can more accurately and comprehensively guide the use of tuberculosis drugs. Chinese patent 202010104800.3 discloses a rapid detection kit and preparation method for Mycobacterium tuberculosis complex, including identification reagents (including ten pairs of primers), a method for preparing the rapid detection kit (including primers and probes, kit procedures, specificity and sensitivity experiments, repeated experiments, target gene pools, and specificity detection kits); it detects and identifies Mycobacterium tuberculosis.

[0006] Although the above patents have carried out the identification of Mycobacterium tuberculosis and the detection of drug resistance gene sites of some drugs, they have not reached the level of replacing traditional drug sensitivity tests. They are prone to insufficient identification capabilities of Mycobacterium tuberculosis and non-tuberculosis mycobacteria and missed detection of drug resistance gene sites.

[0007] Therefore, there is an urgent need to provide a drug resistance gene detection primer composition or kit with high detection accuracy, sensitivity and specificity for the identification of Mycobacterium tuberculosis and non-tuberculosis mycobacteria and for increasing drug resistance gene sites. Summary of the Invention

[0008] The present invention aims to provide a primer combination or kit for the identification of non-tuberculous mycobacteria, identification of mycobacterium tuberculosis complex and drug resistance gene detection, by using multiplex PCR technology and high-throughput second-generation sequencing technology to carry out identification of mycobacterium tuberculosis complex (MTBC), 24 kinds of non-tuberculous mycobacteria (NTM) and detection of mycobacterium tuberculosis resistance genes. The method aims to amplify multiple target regions on genomic DNA by multiplex PCR technology to obtain amplicons, then add second-generation sequencing adapters to both sides of the amplicon by PCR to obtain an amplicon library, perform second-generation sequencing, obtain sequence information of the target region, thereby carrying out identification of mycobacterium tuberculosis complex, non-tuberculous mycobacteria and detection of drug resistance genes. After amplifying hundreds of SNPs and InDel sites, this method uses a sequencing platform to carry out detection and data depth analysis based on bioinformatics methods. Based on multi-parameter primer design, the identification ability of mycobacterium tuberculosis complex and NTM is greatly improved, and the detection range of drug resistance sites is expanded to avoid missed detection of drug resistance genes.

[0009] To achieve the above objectives, the present invention adopts the following technical solutions:

[0010] In a first aspect, the present invention provides a primer composition for identifying non-tuberculous mycobacteria, Mycobacterium tuberculosis complex, and detecting drug-resistant genes. The primer composition is shown in Table 1 below:

[0011] Table 1. Primer composition

[0012]

[0013]

[0014]

[0015] Some of the primer sequences in Table 1 involve degenerate bases Y (C / T), S (G / C), B (G / T / C), and R (A / G).

[0016] Preferably, the non-tuberculosis mycobacteria are specifically: Mycobacterium abscessus, Mycobacterium asiatica, Mycobacterium avium, Mycobacterium dieldii, Mycobacterium gastricum, Mycobacterium gordonii, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium marineum, Mycobacterium suis, Mycobacterium scrofula, Mycobacterium schrenkiana, Mycobacterium stuartii, Mycobacterium ulcerans, Mycobacterium vaccae, Mycobacterium toadense, Mycobacterium chelonae, Mycobacterium minor, Mycobacterium fortuitum, Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium achromatosis, and Mycobacterium terrestris.

[0017] Preferably, the first-line commonly used drugs for Mycobacterium tuberculosis detected by the drug-resistant gene detection specifically include: rifampicin (RIF), isoniazid (INH), ethambutol (EMB), pyrazinamide (PZA), and streptomycin (Sm).

[0018] Preferably, the second-line commonly used drugs for Mycobacterium tuberculosis detected by the drug-resistant gene detection specifically include: moxifloxacin (MFX), levofloxacin (LFX), amikacin (AK), kanamycin (Km), ethionamide (Eto), clofazimin (Cfz), bedaquiline, caperomycin (Cm), fluoroquinolones, linezolid (Lzd) and other drugs.

[0019] Specifically, the primer combination is used to detect the following Mycobacterium tuberculosis resistance gene sites:

[0020] (1) Rifampicin, including 1 drug resistance gene and 24 polymorphic sites, namely:

[0021] 1) 24 loci of the rpoB gene: V170F, L430P, Q432K, Q432L, Q432P, 1296_ins_3_a_attc, D435F, D435Y, D435V, S441Q, S441L, 1328_ins_3_t_tgac, H445C, H445D, H445N, H445S, H445Y, H445L, H445R, S450F, S450L, S450W, L452P, I491F;

[0022] (2) Isoniazid, including 11 polymorphic sites of 5 drug-resistant genes, namely:

[0023] 1) Two loci in the inhA gene: inhA g-154a and inhA c-777t;

[0024] 2) 2 loci of the ndh gene: V18A, R13C;

[0025] 3) 3 sites in the KatG gene: W328L, S315N, and S315T;

[0026] 4) 2 sites of kasA gene: G269S, G312S;

[0027] 5) 2 loci of the ahpC gene: L3L, Y13Y;

[0028] (3) Ethambutol, including 14 polymorphic sites of 2 drug-resistant genes, namely:

[0029] 1) embA gene 1 site: c.-12C>T;

[0030] 2) 13 loci in the embB gene: M306V, M306L, M306I, Y319C, Y319S, D328Y, D354A, G406C, G406S, G406A, G406D, Q497K, Q497R;

[0031] (4) Streptomycin, including 3 resistance genes and 13 polymorphic sites, namely:

[0032] 1) 3 sites in the rrs gene: g878a, aa514c, c517t;

[0033] 2) 7 loci of Gid gene: gid_A134E, gid_Q125X, 352_del_1_gc_g, gid_P75R, gid_G69D, 103_del_1_gc_g, L16R;

[0034] 3) 3 sites of rpsL gene: K43R, K88M, K88R;

[0035] (5) Moxifloxacin, including 2 drug resistance genes and 9 polymorphic sites, namely:

[0036] 1) 8 sites in the gyrA gene: G88C, A90V, S91P, D94Y, D94H, D94N, D94G, D94A;

[0037] 2) gyrB gene 1 site: E501D;

[0038] (6) Levofloxacin, including 1 drug resistance gene and 8 polymorphic sites, namely:

[0039] 1) 8 sites in the gyrA gene: G88C, A90V, S91P, D94Y, D94H, D94N, D94G, D94A;

[0040] (7) Amikacin, including 2 resistance genes and 2 polymorphic sites, namely:

[0041] 1) rrs gene 1 site: A1401G;

[0042] 2) eis gene 1 site: c.-14G>A;

[0043] (8) Kanamycin, including 2 drug resistance genes and 6 polymorphic sites, namely:

[0044] 1) Five sites in the eis gene: eis_-7_del_1_cg_c, c.-10C>T, c.-12G>A, c.-14G>A, c.-37C>A;

[0045] 2) rrs gene 1 locus: g1484t, A1401G;

[0046] (9) Pyrazinamide, including 2 drug resistance genes and 112 polymorphic sites, namely:

[0047] 1) rpsA gene 2 locus: T5A, A438del;

[0048] 2) 110 loci of the pncA gene: L182S, V180G, V180F, T177P, M175V, 518_ins_1_t_tc, 518_ins_1_t_tc, L172P, S164P, T160P, L159R, 465_ins_1_c_ca, V155G, R154G, 457_ins_1_t_tg, L151S, A146V, A146T, A143G, T142M, T142A, Q14 1P,Q141X,V139A,V139G,C138R,T135P,A134V,I133T,395_del_9_ccgaccacat_c,G132A,G132S,392_ins_1_ a_ac,392_ins_2_a_acc,390_del_4_cacat_c,389_del_9_acatcgacct_a,V130G,V128G,V125F,Q122X,L120P ,W119C,318_del_1_ga_g,G105V,Y103X,Y103C,Y103H,A102P,G97D,G97C,G97R,G97S,K96R,K96T,K96E,F94 L,F94C,F94L,I90S,L85P,L85R,T76P,H71P,H71R,H71Y,P69L,W68C,W68G,W68R,S67P,D63A,P62L,S59P,F58 L,H57R,H57D,H57Y,P54L,H51Q,H51R,H51D,D49A,D49G,T47A,Y34D,I31S,L27P,G24D,C14R,D12E,D12A,D12 G,D12N,Q10P,Q10R,D8G,D8N,V7A,V7G,V7L,I6T,L4S,L4W,M1T,-4_del_1_tc_t,a-11c,a-11g,V138A,A128S;

[0049] (10) Ethionamide, including 4 drug-resistant genes and 10 polymorphic sites, namely:

[0050] 1) ethA gene 4 sites: L397R, R207G, 111_del_1_ct_c, M1R;

[0051] 2) ndh gene two sites: V18A, R13C;

[0052] 3) 1 locus of inhA gene: inhA_c-777t;

[0053] 4) 3 sites of the inhA gene: I21V, I21T, and S94A;

[0054] (11) Clofazimine, including two polymorphic sites of one drug resistance gene, namely:

[0055] 1) Two loci in the Rv0678 gene: G193 del, C466T;

[0056] (12) Bedaquiline, including two polymorphic sites of one drug resistance gene, namely:

[0057] 1) Two sites in the atpE gene: A63P and I66M;

[0058] (13) Capreomycin, including 6 polymorphic sites of 2 drug-resistant genes, namely:

[0059] 1) 3 loci in the rrs gene: c1402t, g1484t, and A1401G;

[0060] 2) 3 sites of tlyA gene: L74P, E75X / g223t, N236K;

[0061] (14) Fluoroquinolones, including 7 polymorphic sites of 2 drug resistance genes, namely:

[0062] 1) Four loci in the gyrB gene: D461H, N499D, T500N, and A504V;

[0063] 2) Three sites in the gyrA gene: A90V, D94Y, and D94G;

[0064] (15) Linezolid, including 1 polymorphic site of 1 drug resistance gene, namely:

[0065] 1) One site of rplC gene: C154R.

[0066] In a second aspect, the present invention provides the use of the primer composition described in the first aspect in preparing a kit for detecting Mycobacterium tuberculosis or non-tuberculous mycobacteria and / or a kit for guiding the identification of Mycobacterium tuberculosis or non-tuberculous mycobacteria species and the detection of Mycobacterium tuberculosis drug resistance and / or a kit for guiding the use of Mycobacterium tuberculosis drugs, wherein the use is for non-disease diagnosis and treatment purposes.

[0067] In a third aspect, the present invention provides a kit for detecting drug resistance of Mycobacterium tuberculosis and / or a kit for guiding the identification of Mycobacterium tuberculosis or non-tuberculosis mycobacteria and drug use, wherein the kit comprises the primer composition described in the first aspect.

[0068] Specifically, the kit further includes an amplification reaction solution, a 5' end sequencing adapter, a 3' end sequencing adapter, and an internal standard.

[0069] In a fourth aspect, the present invention provides use of the primer composition described in the first aspect or the kit described in the third aspect in the identification of Mycobacterium tuberculosis or non-tuberculosis mycobacterium species and the detection of drug resistance genes, wherein the use is for non-disease diagnosis and treatment purposes.

[0070] In a fifth aspect, the present invention provides a method for identifying Mycobacterium tuberculosis or non-tuberculosis mycobacterium species and detecting Mycobacterium tuberculosis resistance genes, wherein the method is a non-disease diagnosis and treatment method, and the method comprises using the primer composition described in the first aspect or the kit described in the third aspect to detect species-specific fragments and drug resistance gene sites in the genome of the sample to be tested.

[0071] Specifically, the method comprises the following steps:

[0072] (1) DNA extraction from samples;

[0073] (2) performing multiplex PCR amplification on the DNA extracted in step (1) using the primer composition described in the first aspect or the kit described in the third aspect, and constructing a next-generation sequencing library;

[0074] (3) High-throughput sequencing of the sequencing library was performed using a second-generation sequencing platform to determine whether the sample was infected with Mycobacterium tuberculosis or 24 non-tuberculous mycobacteria, as well as the infected strains and specific genotypes of drug-resistant gene loci. Based on the genotype, the sample was identified as Mycobacterium tuberculosis or non-tuberculous mycobacteria, and the drug resistance of Mycobacterium tuberculosis complex was identified and tested.

[0075] Beneficial effects of the present invention

[0076] 1. The primer set contained in the primer composition or kit of the present invention can amplify 24 common clinical non-tuberculous mycobacteria and Mycobacterium tuberculosis complex. Detection using the primer composition or kit of the present invention can identify whether the test sample is infected with Mycobacterium tuberculosis complex or 24 common NTM infections, and can also identify the specific species of NTM, thereby meeting clinical diagnostic needs.

[0077] 2. The primer combination or kit described in the present invention is used to detect drug-resistant genes of Mycobacterium tuberculosis. The sample does not need to be isolated and cultured, and the interference of the host and other microorganisms is shielded. More types of Mycobacterium tuberculosis drugs and drug-resistant gene sites (a total of 31 genes and 226 sites) can be detected at one time, which greatly reduces the missed detection rate. The drug-resistant gene site sequence coverage is high, and the detection accuracy, sensitivity and specificity are better. At the same time, a high-throughput multi-sample detection system is used, which can be applied to drug resistance detection of large sample sizes, reducing the detection cost.

[0078] 3. The present invention can be widely used in scientific research, identification of Mycobacterium tuberculosis complex and non-tuberculosis mycobacteria in drug efficacy research, and clinical medication guidance for drug resistance of Mycobacterium tuberculosis complex.

[0079] 4. The kit provided in this application has a short sample detection cycle. Compared with the clinical gold standard phenotypic drug sensitivity test, the primer combination described in the present invention has a short detection cycle, which can be as fast as 2 days from sample acquisition to data processing. DETAILED DESCRIPTION

[0080] The technical solutions of the present invention will be described in further detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are encompassed within the scope of protection that the present invention is intended to protect.

[0081] Unless otherwise noted, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0082] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0083] Example 1: A primer combination and kit for identifying Mycobacterium tuberculosis complex, 24 NTM species, and detecting drug resistance genes in Mycobacterium tuberculosis

[0084] 1. The primer composition used in this example includes the specific primer sequences shown in Table 1. In addition, depending on the sequencing platform used subsequently, it is necessary to add a compatible common sequence to the 5' end of the primers shown in Table 1 for connection to the adapter. This is a conventional technical means in the art and will not be described in detail here. Exemplarily, the common sequence (5'→3') at the 5' end of the forward primer used in this example (SEQ ID NO: 163) is: CGTAATCGCCGAGCCCTACT; the common sequence (5'→3') at the 5' end of the reverse primer (SEQ ID NO: 164) is: TGGAACAACCTCCGAGATGGT.

[0085] The NTMs are specifically: Mycobacterium abscessus, Mycobacterium asiatica, Mycobacterium avium, Mycobacterium dieldii, Mycobacterium gastricum, Mycobacterium gordonii, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium marine, Mycobacterium suis, Mycobacterium scrofula, Mycobacterium schrenkiana, Mycobacterium stuartii, Mycobacterium ulcerans, Mycobacterium vaccae, Mycobacterium toadii, Mycobacterium chelonae, Mycobacterium minor, Mycobacterium fortuitum, Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium colorless, and Mycobacterium terrestris.

[0086] The first-line and second-line commonly used drugs for Mycobacterium tuberculosis in the drug resistance test are specifically:

[0087] Table 1

[0088]

[0089]

[0090] Specifically, the primer combination is used to detect the following Mycobacterium tuberculosis drug resistance gene detection sites:

[0091] (1) Rifampicin, including 1 drug resistance gene and 24 polymorphic sites, namely:

[0092] 1) 24 loci of the rpoB gene: V170F, L430P, Q432K, Q432L, Q432P, 1296_ins_3_a_attc, D435F, D435Y, D435V, S441Q, S441L, 1328_ins_3_t_tgac, H445C, H445D, H445N, H445S, H445Y, H445L, H445R, S450F, S450L, S450W, L452P, I491F;

[0093] (2) Isoniazid, including 11 polymorphic sites of 5 drug-resistant genes, namely:

[0094] 1) Two loci in the inhA gene: inhA g-154a and inhA c-777t;

[0095] 2) 2 loci of the ndh gene: V18A, R13C;

[0096] 3) 3 sites in the KatG gene: W328L, S315N, and S315T;

[0097] 4) 2 sites of kasA gene: G269S, G312S;

[0098] 5) 2 loci of the ahpC gene: L3L, Y13Y;

[0099] (3) Ethambutol, including 14 polymorphic sites of 2 drug-resistant genes, namely:

[0100] 1) embA gene 1 site: c.-12C>T;

[0101] 2) 13 loci in the embB gene: M306V, M306L, M306I, Y319C, Y319S, D328Y, D354A, G406C, G406S, G406A, G406D, Q497K, Q497R;

[0102] (4) Streptomycin, including 3 resistance genes and 13 polymorphic sites, namely:

[0103] 1) 3 sites in the rrs gene: g878a, aa514c, c517t;

[0104] 2) 7 loci of Gid gene: gid_A134E, gid_Q125X, 352_del_1_gc_g, gid_P75R, gid_G69D, 103_del_1_gc_g, L16R;

[0105] 3) 3 sites of rpsL gene: K43R, K88M, K88R;

[0106] (5) Moxifloxacin, including 2 drug resistance genes and 9 polymorphic sites, namely:

[0107] 1) 8 sites in the gyrA gene: G88C, A90V, S91P, D94Y, D94H, D94N, D94G, D94A;

[0108] 2) gyrB gene 1 site: E501D;

[0109] (6) Levofloxacin, including 1 drug resistance gene and 8 polymorphic sites, namely:

[0110] 1) 8 sites in the gyrA gene: G88C, A90V, S91P, D94Y, D94H, D94N, D94G, D94A;

[0111] (7) Amikacin, including 2 resistance genes and 2 polymorphic sites, namely:

[0112] 1) rrs gene 1 site: A1401G;

[0113] 2) eis gene 1 site: c.-14G>A;

[0114] (8) Kanamycin, including 2 drug resistance genes and 6 polymorphic sites, namely:

[0115] 1) Five sites in the eis gene: eis_-7_del_1_cg_c, c.-10C>T, c.-12G>A, c.-14G>A, c.-37C>A;

[0116] 2) rrs gene 1 locus: g1484t, A1401G;

[0117] (9) Pyrazinamide, including 2 drug resistance genes and 112 polymorphic sites, namely:

[0118] 1) rpsA gene 2 locus: T5A, A438del;

[0119] 2) 110 loci of the pncA gene: L182S, V180G, V180F, T177P, M175V, 518_ins_1_t_tc, L172P, S164P, T160P, L159R, 465_ins_1_c_ca, V155G, R154G, 457_ins_1_t_tg, L151S, A146V, A146T, A143G, T142M, T142A, Q141P, Q141X, V1 39A,V139G,C138R,T135P,A134V,I133T,395_del_9_ccgaccacat_c,G132A,G132S,392_ins_1_a_ac,392_ ins_2_a_acc,390_del_4_cacat_c,389_del_9_acatcgacct_a,V130G,V128G,V125F,Q122X,L120P,W119C, 318_del_1_ga_g,G105V,Y103X,Y103C,Y103H,A102P,G97D,G97C,G97R,G97S,K96R,K96T,K96E,F94L,F94 C,F94L,I90S,L85P,L85R,T76P,H71P,H71R,H71Y,P69L,W68C,W68G,W68R,S67P,D63A,P62L,S59P,F58L,H5 7R,H57D,H57Y,P54L,H51Q,H51R,H51D,D49A,D49G,T47A,Y34D,I31S,L27P,G24D,C14R,D12E,D12A,D12G, D12N,Q10P,Q10R,D8G,D8N,V7A,V7G,V7L,I6T,L4S,L4W,M1T,-4_del_1_tc_t,a-11c,a-11g,V138A,A128S;

[0120] (10) Ethionamide, including 4 drug-resistant genes and 10 polymorphic sites, namely:

[0121] 1) ethA gene 4 sites: L397R, R207G, 111_del_1_ct_c, M1R;

[0122] 2) ndh gene two sites: V18A, R13C;

[0123] 3) 1 locus of inhA gene: inhA_c-777t;

[0124] 4) 3 sites of the inhA gene: I21V, I21T, and S94A;

[0125] (11) Clofazimine, including two polymorphic sites of one drug resistance gene, namely:

[0126] 1) Two loci in the Rv0678 gene: G193 del, C466T;

[0127] (12) Bedaquiline, including two polymorphic sites of one drug resistance gene, namely:

[0128] 1) Two sites in the atpE gene: A63P and I66M;

[0129] (13) Capreomycin, including 6 polymorphic sites of 2 drug-resistant genes, namely:

[0130] 1) 3 loci in the rrs gene: c1402t, g1484t, and A1401G;

[0131] 2) 3 sites of tlyA gene: L74P, E75X / g223t, N236K;

[0132] (14) Fluoroquinolones, including 6 polymorphic sites of 2 drug resistance genes, namely:

[0133] 1) Four loci in the gyrB gene: D461H, N499D, T500N, and A504V;

[0134] 2) Three sites in the gyrA gene: A90V, D94Y, and D94G;

[0135] (15) Linezolid, including 1 polymorphic site of 1 drug resistance gene, namely:

[0136] 1) One site of rplC gene: C154R.

[0137] 2. Test kit

[0138] (1) Amplification reaction solution: 2× Gloria Nova HS Master Mix;

[0139] (2) Internal reference: quality control product;

[0140] (3) 5′ end sequencing adapter (10 μM), which must be compatible with the common sequence at the 5′ end of the forward primer;

[0141] (4) 3' end sequencing adapter (10 μM), which must be compatible with the common sequence at the 5' end of the reverse primer.

[0142] Example 2 Identification of Mycobacterium tuberculosis Complex, 24 NTM Species, and Detection of Mycobacterium tuberculosis Drug Resistance Genes

[0143] 1. Reagents: including DNA extraction kit, PCR premix, magnetic beads, and magnetic stand.

[0144] 2. Experimental steps:

[0145] (1) Sample DNA extraction:

[0146] 1) Collect sputum and obtain samples.

[0147] 2) Extract total DNA from the sample using a DNA extraction kit, detect the DNA concentration, and obtain a DNA extract of qualified quality.

[0148] (2) Multiple amplification primers: see Table 1.

[0149] (3) Multiplex PCR reaction: The multiplex PCR reaction system is shown in Table 2 below.

[0150] Table 2. Multiplex PCR reaction system

[0151] Reagents Volume per system (μL) 2×Gloria Nova HS Master Mix 12.5 100 μM primer combination 2.37 Internal Reference 0.5 EDTA [25 mM] 0.6 <![CDATA[(NH4)2SO4[1M]]]> 0.625 template X water 8.405-X total 25.0

[0152] After preparing the reaction system, place it in a PCR instrument to perform the PCR amplification reaction. The multiplex PCR reaction program (PCR instrument) is as follows:

[0153]

[0154] (4) Magnetic bead purification of PCR products

[0155] 1) Add magnetic beads (1.8x) to the above PCR product for purification and mix gently by pipetting 20 times.

[0156] 2) After incubation at room temperature for 5 minutes, place the PCR tube on a magnetic rack until the solution becomes clear. Carefully remove the supernatant.

[0157] 3) Keep the PCR tube in the magnetic rack, add 200 μl of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant.

[0158] 4) Repeat step 3) for a total of two rinses.

[0159] 5) Keep the PCR tube in the magnetic rack at all times, open the lid and air-dry the magnetic beads for 5-10 minutes until no ethanol residue remains.

[0160] 6) Remove the PCR tube from the magnetic stand, add 26 μL of TE Buffer, and gently resuspend the magnetic beads by pipetting to avoid creating bubbles. Let it stand at room temperature for 5 minutes.

[0161] 7) Place the PCR tube back on the magnetic rack. Once the solution becomes clear, transfer 21 μL of the supernatant to a new 200 μL PCR tube. The supernatant in this tube represents the multiplex PCR product.

[0162] (5) PCR reaction of linker sequence:

[0163] The PCR reaction system of the adapter sequence is shown in Table 3 below, wherein the 5′ end sequencing adapter (i.e., XA) sequence (SEQ ID NO: 165) is: 5′-TCAGCAGATGTGATGACTGGAGGAACAGGCTTCAGTCGCTGCTGGTAACTTAGCGTAATCGCCGAGCCCTACT-3′;

[0164] The 3' end sequencing adapter (ie, Idx) sequence (SEQ ID NO: 166) is: 5'-GCTAATCGCTTGGAGAGACAGGAGGTAAGTGTATGCCAATGTGCGAACTCTTCGCTGGAACAACCTCCGAGATGGT-3'.

[0165] Table 3. PCR reaction system for linker sequences

[0166] Reagents Volume per system (μL) 2×Gloria Nova HS Master Mix 25 XA-(10μM) 2 Idx (10 μM) 2 Purified product from the previous step 21 total 50

[0167] Adapter sequence PCR reaction conditions:

[0168]

[0169] (6) Magnetic bead purification:

[0170] 1) Add magnetic beads (0.9x) to the PCR product and gently pipette up and down 20 times to mix. Incubate at room temperature for 5 minutes. Place the PCR tube on a magnetic stand until the solution becomes clear. Carefully remove the supernatant.

[0171] 2) Keep the PCR tube in the magnetic rack, add 200 μl of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant.

[0172] 3) Repeat step 2) for a total of two rinses.

[0173] 4) Keep the PCR tube in the magnetic rack at all times, open the lid and air-dry the magnetic beads for 5-10 minutes until no ethanol residue remains.

[0174] 5) Remove the PCR tube from the magnetic stand, add 30 μL of TE buffer, and gently pipette to resuspend the magnetic beads to avoid creating bubbles. Let it stand at room temperature for 5 minutes.

[0175] 6) Place the PCR tube back on the magnetic rack. Once the solution becomes clear, transfer 28 μl of the supernatant to a new EP tube.

[0176] (7) Library quality testing:

[0177] 1) Take 1 μL of library sample and use Qubit 4.0 to detect the library concentration.

[0178] 2) Take out an appropriate amount of library and perform 2% agarose electrophoresis to check the length of library fragments.

[0179] (8) Sequencing on the machine:

[0180] The constructed sequencing library was sequenced on a Cygnus S100 sequencer to generate data.

[0181] 3. Result analysis:

[0182] After the data was downloaded, Timmomatic software was first used with default parameters to remove adapter sequences, low-quality sequences, and short fragments. The cleaned data was aligned with the reference genome to calculate the alignment rate and coverage. Sequences with alignment position errors and mismatch ratios greater than 10% were removed. After normalizing the sample reads (reads after filtering / total reads on the alignment), samples with a depth ratio greater than 1% were determined to be positive for Mycobacterium tuberculosis. For samples positive for Mycobacterium tuberculosis, Varscan variation analysis software was used, and the drug resistance site database was matched to obtain the mutation results of the drug resistance site. For the amplicon sequences obtained by NTM primers (amplified by primer pairs TP15, TP16, TP17, TP74, and TP75), after filtering by sequence quality value and alignment position, BLAST analysis was performed. Based on the sequence similarity score, the species with the highest alignment score was selected as the NTM species for NTM typing.

[0183] Example 3. Identification of the national reference material for the detection kit of Example 1 for the PCR detection kit for Mycobacterium tuberculosis

[0184] (1) The National Reference Material for Mycobacterium tuberculosis PCR Detection Kit (purchased from the China Food and Drug Administration, product number: 230030) consists of inactivated Mycobacterium tuberculosis, non-tuberculous mycobacteria, and respiratory infection bacteria and is used for quality control of Mycobacterium tuberculosis PCR Detection Kits. This reference material consists of 44 samples, as shown in Table 4:

[0185] Table 4. Types of national reference products used in Mycobacterium tuberculosis PCR detection kits

[0186]

[0187] 1 mL of the national reference sample for the Mycobacterium tuberculosis PCR detection kit was selected, and DNA was extracted using the HiPure MycoBacterial DNA Kit (D3178-02) from Guangzhou Meiji Biotechnology Co., Ltd. Mycobacterium tuberculosis was identified according to the detection method described in Example 2 (except for 2(1), the remaining steps were the same). The specific identification results are shown in Table 5.

[0188] Table 5. Test results of Mycobacterium tuberculosis PCR detection kit using national reference materials

[0189]

[0190]

[0191] The identification results are divided into three categories: MTBC-positive (i.e., Mycobacterium tuberculosis complex-positive), NTM, and completely negative. NTM are typed in the output, indicating the specific species. A completely negative result indicates all microorganisms except NTM. Statistical analysis of the sequencing data shows that the output results fully align with those of the national reference product for the Mycobacterium tuberculosis PCR detection kit, demonstrating that the present invention can accurately identify Mycobacterium tuberculosis and the ten NTM species used in this reference product.

[0192] Example 4. Sequencing data of amplicons corresponding to all primer combinations

[0193] A nucleic acid sample from a clinical test was selected, and the amplification of the primer composition in the sample was evaluated using the primer composition and kit described in Example 1 and the detection method described in Example 2. Detailed information is shown in Table 6.

[0194] Table 6. Sequencing data of amplicons corresponding to all primers in Example 1

[0195]

[0196]

[0197] Note: TP13 represents the primer pair consisting of TP13F and TP13R.

[0198] The above results demonstrate that the primer combination of the present invention can amplify the target DNA region for the identification of 24 non-tuberculous mycobacteria, the identification of Mycobacterium tuberculosis complex, and the detection of drug-resistant genes.

[0199] Example 5. Identification of non-tuberculous mycobacteria, identification of Mycobacterium tuberculosis complex and detection of drug resistance genes in clinical samples

[0200] Forty-eight clinical nucleic acid samples were selected and evaluated for Mycobacterium tuberculosis or nontuberculous mycobacterial infection and the distribution of drug-resistance loci using the primer combination and kit described in Example 1 and the detection method described in Example 2. Clinical Mycobacterium tuberculosis drug susceptibility testing results, probe melting curve analysis results, and tuberculosis-related examination results were compared.

[0201] The specific test results of the infection status of Mycobacterium tuberculosis complex or non-tuberculosis mycobacteria in clinical samples are shown in Table 7.

[0202] Table 7. Identification of Mycobacterium tuberculosis complex or nontuberculous mycobacteria in clinical specimens

[0203]

[0204]

[0205] As can be seen from the above table, a total of 31 (64.6%) Mycobacterium tuberculosis complex-positive samples and 17 (35.4%) Mycobacterium tuberculosis complex-negative samples were detected among the 48 clinical samples, of which 14 were identified as NTM infection and 3 were identified as completely negative; the identification results were completely consistent with the identification results of the hospital, indicating that the primer combination and kit of the present invention can accurately identify Mycobacterium tuberculosis and can accurately identify multiple NTM species.

[0206] The detection results of drug-resistant gene loci in 31 Mycobacterium tuberculosis complex-positive samples are shown in Table 8 .

[0207] Table 8. Drug-resistant mutation sites in 31 Mycobacterium tuberculosis complex-positive samples

[0208]

[0209]

[0210] The results showed that a total of 84 drug-resistant mutation sites were detected in 31 Mycobacterium tuberculosis complex-positive samples.

[0211] In order to verify whether the drug resistance information reflected by the above mutation sites is accurate, the drug resistance information detected by the present invention in 31 Mycobacterium tuberculosis complex-positive samples was compared with the test results of the hospital (results obtained by melting curve PCR and / or phenotypic drug sensitivity test). The results are shown in Table 9:

[0212] Table 9

[0213]

[0214]

[0215] Taking the hospital test results as a control, the drug resistance information detected by the method of the present invention is compared with the hospital test results. It can be found that among the 31 samples, the results of 26 samples are consistent (consistent means that the method of the present invention can cover the hospital test results). It should be noted that rifapentine and rifabutin are derivatives of rifampicin and share resistance sites with rifampicin; the fluoroquinolone resistance results in the hospital test results are obtained by detecting whether the 88th to 94th codons of the gyrA gene contain mutations. The above mutation sites are consistent with the resistance sites for levofloxacin and moxifloxacin of the present invention; isoniazid and para-aminosalicylic acid are mixed in proportion. To judge drug resistance, it is necessary to detect the resistance mutations of these two drugs at the same time. The resistance sites of the present invention do not contain para-aminosalicylic acid, so it cannot be consistent with the hospital results (TB23, TB32, TB40, TB41, TB44) and can be ignored. Prothionamide is not within the detection scope of this patent and can also be ignored. The three cases of clofazimine resistance (TB32, TB33, and TB41) detected by the hospital could not be replicated by the patented method. The WHO guidelines list 608 resistance sites for clofazimine, of which 601 have insufficient evidence and 7 are not related to resistance. The present invention covers 2 resistance sites. It is speculated that the mechanism of clofazimine resistance in these three samples is not yet clear. If the resistance is caused by a gene mutation, then the site may not be covered by the present invention. For sample TB42, the sequencing results of the present invention showed that there was a 3-base deletion on the rpoB gene of the sample. The deletion was assessed by the WHO guidelines as being related to rifampicin resistance, but the evidence was insufficient. The Xpert used by the hospital can detect mutations in the same region, and the results showed that the sample was rifampicin-resistant. It is speculated that the reason is that the deletion of the above 3 bases affects the probe binding efficiency, which in turn affects the interpretation of the results.

[0216] Example 6. Test results of the national reference product for the detection reagent of the isoniazid resistance gene of Mycobacterium tuberculosis

[0217] This reference product (purchased from the China Food and Drug Inspection Institute, product number: 230034) is an inactivated bacterial suspension prepared by culturing Mycobacterium tuberculosis strains that are resistant or sensitive to isoniazid. It can be used for quality control of Mycobacterium tuberculosis isoniazid resistance gene detection reagents.

[0218] 1. The mutation sites of drug-resistant reference products are shown in Table 10:

[0219] Table 10

[0220] Serial number Reference number strain number Rifampicin (R), isoniazid (I) drug susceptibility testing and gene mutation sites 1 I1-IR-1 94002' IR (rpoB 531, inhA-15) 2 I2-IR-2 94003' IR (rpoB 516, katG 315) 3 I3-IR-3 94004' IR (rpoB 531, inhA-15) 4 I4-IR-4 94008' IR (rpoB 526, katG 315) 5 I5-IR-5 94010' IR (rpoB 526, katG 315) 6 I6-IR-6 94011' IR(rpoB526、katG315 / inhA-15) 7 I7-IR-7 94015' IR (rpoB 531, inhA-15) 8 I8-IR-8 94019' IR (rpoB 516, katG 315) 9 I9-IR-9 94020' IR (rpoB 531, katG 315) 10 I10-IR-10 94288' IR(rpoB 526、katG315) 11 I11-IR-11 95377' IR(rpoB 522、katG315) 12 I12-IR-12 95577' IR (rpoB 510 511 512 deletion, katG315) 13 I13-IR-13 94024' IR(rpoB 526, inhA-15, katG315) 14 I14-IR-14 94286' IR(rpoB531, inhA-8, katG-12) 15 I15-R-1 94001’ I(ahpC-6) 16 I16-R-2 95242’ I(katG 315)

[0221] 1 ml of the national reference product for Mycobacterium tuberculosis isoniazid resistance gene detection reagent was selected, and DNA was extracted using the HiPure MycoBacterial DNA Kit (D3178-02) from Guangzhou Meiji Biotechnology Co., Ltd. The isoniazid resistance of Mycobacterium tuberculosis was detected according to the detection method described in Example 2. The reference results of the national reference product for Mycobacterium tuberculosis isoniazid resistance gene detection reagent were compared. The specific test results are shown in Table 11 below:

[0222] Table 11. Specific detection results of isoniazid-resistant bacteria

[0223] Reference number mutation site Mutation frequency Depth (x) mutation site Mutation frequency Depth (x) I1-IR-1 inhA-15 97.00％ 50401 I2-IR-2 katG 315 97.87％ 14486 I3-IR-3 inhA-15 97.00％ 50399 I4-IR-4 katG 315 97.75％ 17906 I5-IR-5 katG 315 98.20％ 19924 I6-IR-6 katG 315 97.42％ 14166 inhA-15 97.00％ 46360 I7-IR-7 inhA-15 97.00％ 46360 I8-IR-8 katG 315 97.77％ 14341 I9-IR-9 katG 315 97.71％ 15873 I10-IR-10 katG 315 98.40％ 19875 I11-IR-11 katG 315 98.01％ 19887 I12-IR-12 katG 315 96.62％ 9485 I13-IR-13 inhA-15 98.00％ 103870 katG 315 97.77％ 15764 I14-IR-14 inhA-8 99.95％ 15468 ahpC-12 70.52％ 1272 I15-I-1 ahpC-6 87.97％ 1363 I16-I-2 katG 315 98.65％ 19905

[0224] As can be seen from Table 12, samples I1-I16 were positive and had high-frequency mutations associated with isoniazid resistance, which was completely consistent with the reference product. However, no mutations associated with isoniazid resistance were detected in the sequencing data of samples N1-N10, meeting the criteria for detecting isoniazid resistance loci in the reference product.

[0225] The overall sequencing data information of the above samples is shown in Table 12 below:

[0226] Table 12. Overall sequencing data of national reference materials used in the detection of isoniazid resistance genes in Mycobacterium tuberculosis

[0227] Reference number Q20 Map average_depth I1-IR-1 96.15％ 99.79％ 11131.41 I2-IR-2 96.09％ 99.78％ 11119.88 I3-IR-3 96.13％ 99.78％ 11117.42 I4-IR-4 96.26％ 99.80％ 11124.41 I5-IR-5 95.89％ 99.78％ 11120.9 I6-IR-6 95.98％ 99.80％ 11129.32 I7-IR-7 96.20％ 99.76％ 11122.15 I8-IR-8 96.07％ 99.79％ 11037.68 I9-IR-9 96.06％ 99.76％ 11108.49 I10-IR-10 96.38％ 99.78％ 11127.68 I11-IR-11 95.94％ 99.76％ 11116.76 I12-IR-12 96.37％ 99.78％ 11124.12 I13-IR-13 96.16％ 99.77％ 11116.56 I14-IR-14 96.35％ 99.79％ 11125.2 I15-IR-1 96.17％ 99.77％ 11115.51 I16-IR-2 96.33％ 99.73％ 11078.76 N1 96.04％ 99.79％ 11105.61 N2 96.23％ 99.75％ 11113.01 N3 96.24％ 99.78％ 11094.01 N4 96.23％ 99.78％ 11129.97 N5 96.36％ 99.77％ 11127.57 N6 95.81％ 99.76％ 11115.68 N7 96.33％ 99.77％ 11132.64 N8 96.26％ 99.76％ 11128.22 N9 96.31％ 99.77％ 11130.86 N10 96.37％ 99.78％ 11126.69

[0228] In summary, the results obtained by the detection of the present invention are completely consistent with the given results of the national reference material for the detection reagent of the isoniazid resistance gene of Mycobacterium tuberculosis, which proves that the present invention can accurately detect the isoniazid resistance mutation site.

[0229] Example 7. Test results of the national reference product for the detection reagent of rifampicin resistance gene of Mycobacterium tuberculosis

[0230] This reference product (purchased from the China Food and Drug Inspection Institute, product number: 230033) is an inactivated bacterial suspension prepared by culturing rifampicin-resistant or -sensitive Mycobacterium tuberculosis strains and can be used for quality control of Mycobacterium tuberculosis rifampicin-resistant gene detection reagents.

[0231] 1. The gene mutation information of the reference product is shown in Table 13:

[0232] Table 13

[0233] Serial number Reference number strain number Rifampicin (R), isoniazid (I) drug susceptibility testing and gene mutation sites 1 R1-IR-1 94002' IR (rpoB B531, inhA-15) 2 R2-IR-2 94003' IR (rpoB 516, katG 315) 3 R3-IR-3 94004' IR (rpoB B531, inhA-15) 4 R4-IR-4 94008' IR (rpoB 526, katG 315) 5 R5-IR-5 94010' IR (rpoB 526, katG 315) 6 R6-IR-6 94011' IR(rpoB526, katG315, inhA-15) 7 R7-IR-7 94015' IR (rpoB 531, inhA-15) 8 R8-IR-8 94019' IR (rpoB 516, katG 315) 9 R9-IR-9 94020' IR (rpoB 531, katG 315) 10 R10-IR-10 94288' IR(rpoB 526、katG315) 11 R11-IR-11 95377, IR(rpoB 522、katG315) 12 R12-IR-12 95577' IR (rpoB 510 511 512 deletion, katG315) 13 R13-IR-13 94024' IR(rpoB 526, inhA-15, katG315) 14 R14-IR-14 94286' IR(rpoB531, inhA-8, katG-12) 15 R15-R-1 95113' R(rpoB 513) 16 R16-R-2 95329' R(rpoB 533) 17 R17-R-3 95581' R(rpoB 517 518 deletion)

[0234] DNA was extracted using 1 ml of the national reference product for Mycobacterium tuberculosis rifampicin resistance gene detection reagent (HiPure MycoBacterial DNA Kit D3178-02, available from Guangzhou Meiji Biotechnology Co., Ltd.). Rifampicin resistance in Mycobacterium tuberculosis was detected using the method described in Example 2. The results were compared with those of the national reference product for Mycobacterium tuberculosis rifampicin resistance gene detection reagent. The specific test results are shown in Table 14 below.

[0235] Table 14. Specific detection results of drug-resistant bacteria

[0236] Reference number Site frequency Depth (x) R1-IR-1 rpoB 531 97.68％ 907 R2-IR-2 rpoB 516 93.02％ 344 R3-IR-3 rpoB B531 97.98％ 594 R4-IR-4 rpoB 526 88.41％ 233 R5-IR-5 rpoB 526 97.98％ 1265 R6-IR-6 rpoB 526 95.39％ 672 R7-IR-7 rpoB 531 98.99％ 1876 R8-IR-8 rpoB 516 89.80％ 245 R9-IR-9 rpoB 531 98.43％ 1209 R10-IR-10 rpoB 526 97.37％ 1237 R11-IR-11 rpoB 522 96.88％ 1258 R12-IR-12 rpoB 510 511 512 missing 97.84％ 3150 R13-IR-13 rpoB 526 92.56％ 403 R14-IR-14 rpoB 531 97.55％ 572 R15-R-1 rpoB 513 97.41％ 1158 R16-R-2 rpoB 533 96.45％ 691 R17-R-3 rpoB 517 518 deletion 90.58％ 1730

[0237] As can be seen from the table above, samples R1-R17 were identified as positive for Mycobacterium tuberculosis complex, with high-frequency mutations at sites associated with rifampicin resistance. Samples N1-N10 were identified as positive, with no mutations detected at sites associated with rifampicin resistance. The above test results are completely consistent with the reference material information and meet the national reference material detection requirements for Mycobacterium tuberculosis rifampicin resistance gene detection reagents. The overall sequencing data information of the above samples is shown in Table 15 below:

[0238] Table 15. Overall sequencing data of national reference materials used in the detection of rifampicin resistance genes in Mycobacterium tuberculosis

[0239] Reference number Q20 Map average_depth N1 93.97％ 99.98％ 19309.43 N2 94.15％ 99.97％ 27729.64 N3 93.79％ 99.98％ 13899.74 N4 93.96％ 99.98％ 30202.92 N5 94.21％ 99.98％ 12210.78 N6 94.15％ 99.92％ 10428.07 N7 94.04％ 99.94％ 14505.94 N8 93.98％ 99.94％ 17801.92 N9 94.14％ 99.98％ 14432.11 N10 94.14％ 99.98％ 14967.84 R1-IR-1 95.28％ 99.14％ 7175.23 R2-IR-2 95.02％ 98.87％ 5253.47 R3-IR-3 95.11％ 98.78％ 5283.16 R4-IR-4 95.07％ 98.81％ 3747.19 R5-IR-5 94.93％ 99.14％ 11731.38 R6-IR-6 95.13％ 99.06％ 7265.81 R7-IR-7 95.12％ 99.17％ 12907.77 R8-IR-8 95.06％ 98.96％ 4275.67 R9-IR-9 95.13％ 99.17％ 7686.88 R10-IR-10 95.05％ 99.13％ 11796.76 R11-IR-11 95.10％ 98.57％ 13888.81 R12-IR-12 95.05％ 99.20％ 13861.59 R13-IR-13 94.95％ 99.03％ 6608.19 R14-IR-14 94.98％ 98.88％ 5412.86 R15-R-1 94.92％ 99.17％ 11096.56 R16-R-2 95.11％ 99.08％ 20193.02 R17-R-3 95.08％ 98.96％ 13174.12

[0240] In summary, the results obtained by the detection of the present invention are completely consistent with the given results of the national reference material for the detection reagent of rifampicin resistance gene of Mycobacterium tuberculosis, which proves that the present invention can accurately detect rifampicin resistance mutation sites.

[0241] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

Claims

1. A primer combination for identification of nontuberculous mycobacteria, identification of Mycobacterium tuberculosis complex and detection of drug-resistant genes, characterized in that: The primer combination includes a specific primer; the nucleic acid sequence of the specific primer includes the sequence shown in SEQ ID NO:1 to SEQ ID NO:

162.

2. The primer composition according to claim 1, characterized in that The non-tuberculous mycobacteria are specifically: Mycobacterium abscessus, Mycobacterium asiaticum, Mycobacterium avium, Mycobacterium difficile, Mycobacterium gastricum, Mycobacterium gordonii, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium suis, Mycobacterium scrofula, Mycobacterium schrenckii, Mycobacterium simianum, Mycobacterium sternbergii, Mycobacterium ulcerans, Mycobacterium vaccae, Mycobacterium toadum, Mycobacterium chelonae, Mycobacterium minor, Mycobacterium fortuitum, Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium achromatosis, Mycobacterium terrestris.

3. The primer composition according to claim 1, characterized in that The first-line commonly used drugs for Mycobacterium tuberculosis detected by the drug-resistant gene test specifically include: rifampicin, isoniazid, ethambutol, pyrazinamide, and streptomycin; The commonly used second-line drugs for Mycobacterium tuberculosis detected by the drug-resistant gene detection specifically include: moxifloxacin, levofloxacin, amikacin, kanamycin, ethionamide, clofazimine, bedaquiline, capreomycin, fluoroquinolones, linezolid and other drugs.

4. The primer composition according to claim 3, characterized in that The Mycobacterium tuberculosis drug resistance gene detection site: (1) Rifampicin, including 1 drug resistance gene and 24 polymorphic sites, namely: 1) 24 loci of rpoB gene: V170F, L430P, Q432K, Q432L, Q432P, 1296_ins_3_a_attc, D435F, D435Y, D435V, S441Q, S441L, 1328_ins_3_t_tgac, H445C, H445D, H445N, H445S, H445Y, H445L, H445R, S450F, S450L, S450W, L452P, I491F; (2) Isoniazid, including 11 polymorphic sites of 5 drug resistance genes, namely: 1) Two loci of the inhA gene: inhA g-154a and inhA c-777t; 2) 2 loci of ndh gene: V18A, R13C; 3) 3 sites of KatG gene: W328L, S315N, S315T; 4) 2 sites of kasA gene: G269S, G312S; 5) 2 loci of ahpC gene: L3L, Y13Y; (3) Ethambutol, including 14 polymorphic sites of 2 drug resistance genes, namely: 1) embA gene 1 site: c.-12C>T; 2) 13 loci of embB gene: M306V, M306L, M306I, Y319C, Y319S, D328Y, D354A, G406C, G406S, G406A, G406D, Q497K, Q497R; (4) Streptomycin, including 3 resistance genes and 13 polymorphic sites, namely: 1) 3 loci of the rrs gene: g878a, aa514c, c517t; 2) 7 loci of Gid gene: gid_A134E, gid_Q125X, 352_del_1_gc_g, gid_P75R, gid_G69D, 103_del_1_gc_g, L16R; 3) 3 sites of rpsL gene: K43R, K88M, K88R; (5) Moxifloxacin, including 2 drug resistance genes and 9 polymorphic sites, namely: 1) 8 loci of gyrA gene: G88C, A90V, S91P, D94Y, D94H, D94N, D94G, D94A; 2) 1 locus of gyrB gene: E501D; (6) Levofloxacin, including 1 drug resistance gene and 8 polymorphic sites, namely: 1) 8 loci of gyrA gene: G88C, A90V, S91P, D94Y, D94H, D94N, D94G, D94A; (7) Amikacin, including 2 resistance genes and 2 polymorphic sites, namely: 1) rrs gene 1 site: A1401G; 2) 1 site of eis gene: c.-14G>A; (8) Kanamycin, including 2 drug resistance genes and 6 polymorphic sites, namely: 1) 5 sites of eis gene: eis_-7_del_1_cg_c, c.-10C>T, c.-12G>A, c.-14G>A, c.-37C>A; 2) 1 locus of rrs gene: g1484t, A1401G; (9) Pyrazinamide, including 2 drug resistance genes and 112 polymorphic sites, namely: 1) rpsA gene 2 locus: T5A, A438del; 2) 110 loci of pncA gene: L182S, V180G, V180F, T177P, M175V, 518_ins_1_t_tc, L172P, S164P, T160P, L159R, 465_ins_1_c_ca, V155G, R154G, 457_ins_1_t_tg, L151S, A146V, A146T, A143G, T142M, T142A, Q141P, Q141X, V1 39A,V139G,C138R,T135P,A134V,I133T,395_del_9_ccgaccacat_c,G132A,G132S,392_ins_1_a_ac,392_ ins_2_a_acc,390_del_4_cacat_c,389_del_9_acatcgacct_a,V130G,V128G,V125F,Q122X,L120P,W119C, 318_del_1_ga_g,G105V,Y103X,Y103C,Y103H,A102P,G97D,G97C,G97R,G97S,K96R,K96T,K96E,F94L,F94 C,F94L,I90S,L85P,L85R,T76P,H71P,H71R,H71Y,P69L,W68C,W68G,W68R,S67P,D63A,P62L,S59P,F58L,H5 7R,H57D,H57Y,P54L,H51Q,H51R,H51D,D49A,D49G,T47A,Y34D,I31S,L27P,G24D,C14R,D12E,D12A,D12G, D12N,Q10P,Q10R,D8G,D8N,V7A,V7G,V7L,I6T,L4S,L4W,M1T,-4_del_1_tc_t,a-11c,a-11g,V138A,A128S; (10) Ethionamide, including 4 drug resistance genes and 10 polymorphic sites, namely: 1) 4 loci of ethA gene: L397R, R207G, 111_del_1_ct_c, M1R; 2) 2 loci of ndh gene: V18A, R13C; 3) 1 locus of inhA gene: inhA_c-777t; 4) 3 sites of inhA gene: I21V, I21T, S94A; (11) Clofazimine, including 2 polymorphic sites of 1 drug resistance gene, namely: 1) Two loci of Rv0678 gene: G193 del, C466T; (12) Bedaquiline, including 2 polymorphic sites of 1 drug resistance gene, namely: 1) Two sites of atpE gene: A63P, I66M; (13) Capreomycin, including 6 polymorphic sites of 2 drug resistance genes, namely: 1) 3 loci of rrs gene: c1402t, g1484t, A1401G; 2) 3 sites of tlyA gene: L74P, E75X / g223t, N236K; (14) Fluoroquinolones, including 6 polymorphic sites of 2 drug resistance genes, namely: 1) Three loci of gyrB gene: D461H, N499D, T500N, A504V; 2) Three sites of the gyrA gene: A90V, D94Y, and D94G; (15) Linezolid, including 1 polymorphic site of 1 drug resistance gene, namely: 1) One site of rplC gene: C154R.

5. Use of the primer composition according to any one of claims 1 to 4 in preparing a kit for detecting Mycobacterium tuberculosis or non-tuberculous mycobacteria and / or a kit for guiding the identification of Mycobacterium tuberculosis or non-tuberculous mycobacteria and the detection of Mycobacterium tuberculosis drug resistance and / or a kit for guiding the use of Mycobacterium tuberculosis drugs, wherein the use is for purposes other than disease diagnosis and treatment.

6. A kit for detecting drug resistance of Mycobacterium tuberculosis and / or a kit for guiding the identification of Mycobacterium tuberculosis or non-tuberculous mycobacteria and the use of drugs, characterized in that: The kit comprises a primer composition, wherein the primer composition comprises the specific primer according to any one of claims 1 to 4, and the 5' end of the specific primer further comprises a common sequence for connecting a sequencing adapter.

7. The kit according to claim 6, characterized in that The kit also includes an amplification reaction solution, a 5' end sequencing adapter, a 3' end sequencing adapter, and an internal reference fragment combination.

8. Use of the primer composition according to any one of claims 1 to 4 or the kit according to claim 6 or 7 in the preparation of products for identification of Mycobacterium tuberculosis or non-tuberculous mycobacterium species and detection of drug resistance genes, wherein the use is for purposes other than disease diagnosis and treatment.

9. A method for identifying Mycobacterium tuberculosis or non-tuberculous mycobacterium species and detecting Mycobacterium tuberculosis resistance genes, wherein the method is a non-disease diagnosis and treatment method, and the method comprises using the primer composition according to any one of claims 1 to 4 or the kit according to claim 6 or 7 to detect the strain-specific fragments and the sites of the drug resistance genes in the genome of the sample to be tested.

10. The method according to claim 9, characterized in that The method comprises the following steps: (1) DNA extraction from samples; (2) performing multiple PCR amplification on the DNA extracted in step (1) using the primer composition described in any one of claims 1 to 4 or the kit described in claim 6 or 7, and constructing a next-generation sequencing library; (3) Perform high-throughput sequencing of the sequencing library using a next-generation sequencing platform. Determine whether the sample is infected with Mycobacterium tuberculosis complex or non-tuberculous mycobacteria, the infected strain, and the specific genotype of the drug-resistant gene locus based on the sequencing results. Identify the sample as Mycobacterium tuberculosis or non-tuberculous mycobacteria, and identify and detect drug resistance based on the genotype.

Images