Primer for identifying sheep species rough type RM101 strain and method and application thereof

Abstract

The invention relates to the technical field of gene detection, in particular to a primer for identifying a sheep species rough type RM101 strain and a method and application thereof. The invention provides a primer for identifying a rough type RM101 strain of sheep species. Glycosyl transferase genes BMEI0997 (1560bp) and BMEI0998 (304bp) in the strain are respectively amplified through different primers by adopting a PCR (Polymerase Chain Reaction) technology. Through gene sequence analysis, specific point mutation exists on the BMEI0997 gene and the BMEI0998 gene respectively, so that the rough type RM101 strain of the sheep species is identified. The invention provides a reliable means, can accurately identify the sheep species rough type RM101 strain and other brucella strains, and provides powerful technical support for brucellosis prevention, control and research after the RM101 is prepared into vaccines for popularization and use.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a primer for identifying sheep rough type RM101 strain and a method and application thereof. Background Art

[0002] Brucellosis, also known as undulant fever, Mediterranean fever or Malta fever, is a zoonotic infectious disease. Brucella has multiple biological species, including sheep, cattle, pigs, dogs, sheep epididymis, and sarin rats.

[0003] The World Organization for Animal Health (WOAH) has reported that brucellosis is one of the most neglected diseases. In the case of severe brucellosis epidemics, vaccination is the only option for effective control. Since the early 20th century, researchers have never given up on developing a suitable vaccine for the prevention and control of brucellosis, but so far no ideal brucellosis vaccine has been obtained.

[0004] The live brucellosis vaccine made from the rough strain RM101 of sheep species has been shown to be 80 times safer than existing vaccines. It can effectively prevent brucellosis in cattle and sheep, can be injected to immunize pregnant animals, will not cause miscarriage in pregnant animals, and will not produce antibodies that interfere with diagnosis. This vaccine has a huge market application prospect. Therefore, the development of a method that can quickly and effectively identify the rough strain RM101 of sheep species is an urgent problem to be solved. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a primer for identifying the rough type RM101 strain of sheep, and the primer sequence is:

[0006] Primer 1:

[0007] RM-1-F (SEQ ID NO.1): 5'-ATGAATAAGCTCGGGCGTGTTTA-3';

[0008] RM-1-R (SEQ ID NO.2): 5'-CTAGTCTGCAACAGATTTAA-3';

[0009] and / or

[0010] Primer 2:

[0011] RM-2-F (SEQ ID NO.3): 5'-GCGTAAACCATCTCGCGAAC-3';

[0012] RM-2-R (SEQ ID NO.4): 5'-CGGCACGTACTGCCAATCTA-3';

[0013] The melittinea rough Brucella RM101 strain described in the present invention was deposited by the China General Microbiological Culture Collection Center on September 16, 2022, with the deposit number: CGMCC No.25728.

[0014] Furthermore, the PCR amplification sequence of the primer 1 is shown as SEQ ID NO.5.

[0015] Furthermore, the PCR amplification sequence of the primer 2 is shown as SEQ ID NO.6.

[0016] The present invention also provides a kit containing the primers for identifying the rough type RM101 strain of melitensis.

[0017] The present invention also provides application of the primers in identifying the rough type RM101 strain of Ovis oryzae.

[0018] The present invention also provides application of the kit in identifying the rough type RM101 strain of Ovis ovalis.

[0019] The present invention also provides a method for identifying the sheep rough type RM101 strain, comprising the following steps:

[0020] (1) Extract DNA from the rough type RM101 strain of melitensis;

[0021] (2) performing PCR amplification using the primers described in claim 1;

[0022] (3) Sequencing and sequence comparison analysis of PCR products.

[0023] Furthermore, the PCR amplification system is: Mix 12.5 μl, H2O 8.5 μl, RM-1-F / RM-2-F 1 μl; RM-1-R / RM-2-R 1 μl, DNA template 2 μl.

[0024] Furthermore, the PCR amplification program was as follows: denaturation at 95°C for 5 min; 30 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 1 min; and extension at 72°C for 10 min.

[0025] The beneficial effects of the present invention are:

[0026] The technical solution adopted by the present invention is to perform SNP analysis on the whole genome of RM101 strain and the whole genome of Brucella of sheep, dog and bovine species, find one SNP site on each of the glycosyltransferase BMEI0997 gene and the BMEI0998 gene, design a pair of primers in each SNP site interval, and then extract the DNA of the sheep rough type RM101 strain and the DNA of strains including but not limited to sheep, pig, bovine and dog species, perform PCR amplification, obtain specific bands of 1560bp of BMEI0997 gene and 304bp of BMEI0998 gene, and after sequence comparison, point mutations appear at specific sites of BMEI0997 gene and BMEI0998 gene in RM101 strain compared with other strains, so as to identify RM101 strain from other strains.

[0027] The identification method provided by the present invention is easy to operate, low in cost, and short in cycle, and can be completed in only 2 days. The present invention solves the problem of identifying the rough type RM101 strain of measles from other Brucella species, and indirectly solves the problem of differential diagnosis after RM101 seedling production from another aspect, which is conducive to its wider promotion and use, and provides support for brucellosis prevention and control technology and research. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the electrophoresis diagram of the PCR amplified BMEI0997 fragment, where M: Marker; 1: RM101 strain; 2: 2308 strain; 3: RM6 / 66 strain; 4: A19 strain; 5: S2 strain; 6: 16M strain; 7: M28 strain.

[0029] Figure 2 This is the electrophoresis diagram of the PCR amplified BMEI0998 fragment, where M: Marker; 1: RM101 strain; 2: 2308 strain; 3: RM6 / 66 strain; 4: A19 strain; 5: S2 strain; 6: 16M strain; 7: M28 strain.

[0030] Figure 3 This is a sequence alignment of the glycosyltransferase gene BMEI0997.

[0031] Figure 4 This is a sequence alignment of the glycosyltransferase gene BMEI0998. DETAILED DESCRIPTION

[0032] The following examples are for further explanation of this patent and do not limit this patent. The reagents used in the examples can be purchased from commercial channels unless otherwise specified. The RM101 strain of rough Brucella melitensis used is the company's own strain, which has been deposited by the China General Microbiological Culture Collection Center on September 16, 2022, with the deposit number: CGMCC No. 25728. The pig strain S2, cattle strain A19, cattle strain 2308, sheep strain M28, sheep strain 16M, and dog strain RM6 / 66 were all provided by the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences.

[0033] Example 1 Whole genome sequencing of Brucella melitensis RM101 strain

[0034] The bacteria were streaked on TSA plates and cultured at 37°C for 72 hours. A single colony was picked and inoculated into 5 ml of TSB medium, cultured at 37°C for 48 hours, inactivated in a water bath at 80°C for 1 hour, and sequenced. The whole genome sequencing and sequence assembly were completed by Biomarker Biotechnology Co., Ltd. After the genome assembly was completed, the results showed that the whole genome length of RM101 was 3361521bp.

[0035] Example 2 Determination of target genes

[0036] The full gene sequences of RM101 strain and three Brucella strain samples (sheep strain M28, dog strain RM6 / 66, cattle strain 2308) were aligned using mummer software, and the SNP, INDEL, and SV information of each sample were extracted using syri software. The sites that were different between RM101 strain and the other three samples were extracted. The target genes were finally determined to be glycosyltransferases BMEI0997 and BMEI0998. The gene sequence of glycosyltransferase BMEI0997 is shown in SEQ ID NO.5, and the gene sequence of glycosyltransferase BMEI0998 is shown in SEQ ID NO.6.

[0037] Example 3 Design of specific primers

[0038] A pair of primers were designed at the conserved regions at both ends of the SNPs of the glycosyltransferase genes BMEI0997 and BMEI0998. The primer sequences designed for the BMEI0997 gene were:

[0039] RM-1-F (SEQ ID NO.1): 5'-ATGAATAAGCTCGGGCGTGTTTA-3'

[0040] RM-1-R(SEQ ID NO.2):5'-CTAGTCTGCAACAGATTTAA-3'

[0041] The primer sequences designed for the BMEI0998 gene are:

[0042] RM-2-F (SEQ ID NO.3): 5'-GCGTAAACCATCTCGCGAAC-3'

[0043] RM-2-R(SEQ ID NO.4):5'-CGGCACGTACTGCCAATCTA-3'

[0044] Example 4 Extraction of bacterial DNA

[0045] Take 1ml bacterial solution (RM101 strain, S2 strain, A19 strain, 2308 strain, M28 strain, 16M strain, RM6 / 66 strain) into a 1.5ml centrifuge tube, centrifuge at 13000g for 2 minutes to collect bacterial cells, and discard the supernatant; add 600ul nuclear lysis buffer and resuspend; incubate at 80℃ for 5min, and cool to room temperature; add 3ul RNase solution to the bacterial lysis solution and mix by inversion; incubate at 37℃ for 15-60min, and cool to room temperature; add 200ul precipitate and oscillate for 20s, mix thoroughly, ice bath for 5min, and centrifuge at 13000g for 3min; transfer the supernatant to a clean 1.5ml centrifuge tube containing 600ul isopropanol, and mix by inversion; centrifuge at 13000g for 2min; discard the supernatant, invert the centrifuge tube on clean absorbent paper, and then add 600ul 70% ethanol, centrifuge at 13000g for 2 minutes; invert the centrifuge tube on clean absorbent paper, dry naturally for 10 to 15 minutes, and dissolve with an appropriate amount of deionized water.

[0046] Example 5 PCR amplification

[0047] The extracted DNA of strains RM101, S2, A19, 2308, M28, 16M, RM6 / 66, etc. was subjected to PCR. The PCR system was as follows: Mix 12.5μl, H2O 8.5μl, RM-1-F / RM-2-F 1μl; RM-1-R / RM-2-R 1μl, DNA template 2μl.

[0048] The PCR program was as follows: denaturation at 95°C for 5 min; 30 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 1 min; and extension at 72°C for 10 min.

[0049] Example 6 PCR product electrophoresis analysis and sequencing analysis

[0050] The electrophoresis results showed that all strain samples could amplify the 1560bp specific band of glycosyltransferase BMEI0997, and also the 304bp specific band of BMEI0998 gene. Figure 1 , Figure 2 shown.

[0051] The PCR products of several strains were sequenced and the sequences were compared. The sequencing results of the BMEI0997 gene of RM101, 16M, M28, 2308, RM6 / 66, A19, and S2 are shown in SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15, and SEQ ID NO.17. The sequencing results of the BMEI0998 gene of RM101, 16M, M28, 2308, RM6 / 66, A19, and S2 are shown in SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16, and SEQ ID NO.18.

[0052] The results are as follows Figure 3 , Figure 4 shown. Figure 3 RM666 is RM6 / 66. Figure 4 The 66th one is RM6 / 66.

[0053] At the 1104th position of the glycosyltransferase BMEI0997 gene, the base of the RM101 strain was C, the base of the M28 strain was T, and the rest were G. At the 294th position of the glycosyltransferase BMEI0998 gene, the base of the RM101 strain was T, and the rest were C.

[0054] From the above results, it can be seen that there are mutant bases at the 1104th position of the glycosyltransferase BMEI0997 gene and the 294th position of the MEI0998 gene in the RM101 strain, and this mutation site can be used to distinguish the RM101 strain from other Brucella strains.

[0055] SEQ ID NO.5>RM101 strain:

[0056]

[0057] SEQ ID NO.7>16M strain:

[0058]

[0059] SEQ ID NO.9>M28 strain:

[0060]

[0061] SEQ ID NO.11>2308 strain:

[0062]

[0063] SEQ ID NO.13> RM6 / 66 strain:

[0064]

[0065] SEQ ID NO.15>A19 strain:

[0066]

[0067] SEQ ID NO. 17>S2 strain:

[0068]

[0069] SEQ ID NO.6 > RM101 strain:

[0070] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCTCGCGCATTAAGAGTAGACACGGGAAATCAGT

[0071] SEQ ID NO.8 > 16M strain:

[0072] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACTTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT

[0073] SEQ ID NO.10 > M28 strain:

[0074] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT

[0075] SEQ ID NO.12>Strain 2308:

[0076] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT

[0077] SEQ ID NO.14>Strain RM6 / 66:

[0078] AGTCGCGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT

[0079] SEQ ID NO.16>Strain A19:

[0080] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT

[0081] SEQ ID NO.18>Strain S2:

[0082] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT。

Claims

1. A primer for identifying the rough type RM101 strain of Ovis ram, characterized in that: The primer sequences are: Primer 1: RM-1-F (SEQ ID NO.1): 5'-ATGAATAAGCTCGGGCGTGTTTA-3'; RM-1-R (SEQ ID NO.2): 5'-CTAGTCTGCAACAGATTTAA-3'; and / or Primer 2: RM-2-F (SEQ ID NO.3): 5'-GCGTAAACCATCTCGCGAAC-3'; RM-2-R (SEQ ID NO.4): 5'-CGGCACGTACTGCCAATCTA-3'; The deposit number of the meliloti rough type RM101 strain is CGMCC No.25728.

2. The primer for identifying the rough type RM101 strain of melitensis according to claim 1, characterized in that: The PCR amplification sequence of the primer 1 is shown as SEQ ID NO.

5.

3. The primer for identifying the rough type RM101 strain of melitensis according to claim 1, characterized in that: The PCR amplification sequence of the primer 2 is shown as SEQ ID NO.

6.

4. A kit comprising the primers for identifying the rough type RM101 strain of melitensis according to claim 1.

5. Use of the primers described in claim 1 in identifying the rough type RM101 strain of Ovis omyces.

6. Use of the kit according to claim 4 in identifying the rough type RM101 strain of melitensis.

7. A method for identifying the rough type RM101 strain of Ovis ram, characterized in that: The steps include: (1) Extract DNA from the rough type RM101 strain of melitensis; (2) performing PCR amplification using the primers described in claim 1; (3) Sequencing and sequence comparison analysis of PCR products.

8. The method according to claim 7, characterized in that The PCR amplification system was: Mix 12.5 μl, H2O 8.5 μl, RM-1-F / RM-2-F 1 μl; RM-1-R / RM-2-R 1 μl, and DNA template 2 μl.

9. The method according to claim 7, characterized in that: The PCR amplification program was: denaturation at 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, 72°C for 1 min, for 30 cycles; extension at 72°C for 10 min.

Images